Document	Document Title
US08168924B2	Overheat protection control component for liquid heating vessel The invention provides an overheat protection control component for a liquid heating vessel which includes a control body (1); a single-integrated dual-actuation thermally sensitive bimetallic actuator (2) is provided on the upper face of the control body (1), wherein the single-integrated dual-actuation thermally sensitive bimetallic actuator (2) is two integrated and relatively independent actuating units which are formed on a piece of bimetallic strip, and the outer kick limb (3) of either said actuating unit will produce an actuating movement downwards when an overheat state occurs; two groups of switch contacts (6) are also provided on the control body (1), wherein either group of switch contacts (6) cooperate with the outer kick limb (3) of a corresponding actuating unit, and the outer kick limb (3), when producing a downward actuating movement, will open a corresponding group of switch contacts (6) and cut off the power supply of the heater for the liquid heating vessel.
US08168922B2	Self-shielded flux cored electrode A cored electrode to form a high manganese metal deposition that includes at least about 4 weight percent manganese and at least about 10 weight percent chromium which is useful in joining dissimilar metals and/or for depositing buffer layers on carbon steel and/or low alloy steels.
US08168920B2	Bonding device A bonding device includes a bonding head including a bonding tool for sucking and holding an electronic component, and a laser heater for heating the electronic component by irradiating laser light on the electronic component held by the bonding tool from an inside of the bonding head, the laser heater including a collective unit for condensing laser light emitted from a light source. A focusing point of the laser light condensed by the collective unit is formed inside the bonding head.
US08168919B2	Laser working apparatus and method of controlling laser working apparatus A laser working apparatus includes: a laser head provided with a reflector which changes the direction of any one of a laser beam and a visible light; a robot which moves the laser head; and a robot control apparatus. When laser working is performed, the robot control apparatus controls the laser head so that the laser beam can draw a predetermined working pattern on the basis of a predetermined working position on a work piece. When an operation checking work is performed, the robot control apparatus controls the laser head so that the visible light beam can be emitted only to a reference position of the working pattern.
US08168914B2	Electric-discharge-machining power supply apparatus and electric discharge machining method In an electric discharge machining, in order to reduce damage of an object to be machined and an electrode and to achieve machining velocity enhancement and reduction of electrode wear amount by appropriately controlling a short-circuit current that flows when the electrode and the object to be machined are short-circuited, an electric-discharge-machining power supply apparatus for machining an object to be machined by interrupting every predetermined time period pulse trains that are turned on and off at predetermined timing, to supply electric power to a machining gap between a machining electrode (2) and the object (3) to be machined includes: a short circuit detecting means (11) for detecting a short circuit at the machining gap between the machining electrode (2) and the object (3) to be machined; and a pulse halting means (12) for, when the short circuit detecting means (11) detects a short circuit occurrence at the machining gap, halting generation of particular pulses in the pulse train so as to halt the power supply to the machining gap.
US08168912B1	Electrode for shaped film cooling hole An electrode used to form a film cooling hole in an air cooled turbine airfoil using the electrode discharge machining process. The electrode includes a number of film hole forming projections each having a metering hole forming section and a diffusion forming section. The diffusion forming section has a trapezoidal shape in which two sidewalls have both an outward expansion and are slanted outward to form a convergent diffusion or slanted inward to form a divergent diffusion.
US08168911B2	Circuit breaker with improved arc quenching A circuit breaker having an arc quenching system is provided. The quenching system includes an ablative device positioned within a chamber. On end of the ablative device includes an opening that receives a stationary contact. A movable contact arm travels within a channel between the closed position and an open position. When an abnormal operating condition is detected, the circuit breaker trips causing the contact arm to move. This generates a plasma arc that evaporates material from the ablative device. The evaporated material generates a pressurized gas that cools and quenches the plasma arc to improve the performance of the circuit breaker during undesired operating conditions such as a short circuit.
US08168907B2	Switch mechanism for a power cutter A switch mechanism for a power tool switchable between an ON and OFF state including a support structure; a first actuator rotatably mounted on the support structure and which is rotatable between a first position and a second position, wherein the first actuator is capable of being releasably latched in either of the first or second positions. The first actuator includes a recess. A second actuator is a slidable button located inside of the recess of the first actuator so that the first actuator at least partially surrounds the second actuator, and is linearly slidable within the recess between a first position and a second position. The second actuator is biased towards its first position. Movement of the first actuator from its first position to its second position, when the second actuator is in its first position, switches the switching mechanism to its ON state; and movement of the first actuator from its second position to its first position, when the second actuator is in its first position, switches the switching mechanism to its OFF state. Movement of the second actuator from its first position to its second position, when the first actuator is latched in its second position, switches the switch mechanism to its OFF state.
US08168906B2	Support member, keyswitch, and keyboard A support member for supporting a key cap, a keyswitch and a keyboard with the support structure are disclosed. The support member includes a first subunit and a second subunit. The first subunit includes a first arm which includes a first pivoting part at one end. The second subunit includes a third pivoting part connected to the first pivoting part temporarily. Therein, a second arm and a third arm are bended to extend from two ends of the third pivoting part respectively. There is a second position structure at an end of the second arm, and there is a third position structure at an end of the third arm. The second position structure and the third position structure can be connected to two first position structures on a base plate respectively. The distance between the second position structure and the position fixing structure is longer than that between the two first position structures.
US08168902B2	Electrical device with a waterproof keypad An electrical device includes a housing, a circuit unit disposed in the housing, a waterproof keypad disposed in the housing at a position above the circuit unit, and a press member. The waterproof keypad includes a rigid layer, a resilient pad body, a waterproofing ring, and a plurality of keys. The press member is connected to the housing and presses against the rigid layer. The waterproofing ring is connected to a bottom face of the resilient pad body, abuts against the housing, and surrounds the circuit unit. A portion of a top face of the resilient pad body is connected immovably to a bottom face of the rigid layer. Another portion of the top face of the resilient pad body is exposed from the rigid layer. The keys are connected to the exposed portion of the top face of the resilient pad body and are exposed from the rigid layer.
US08168901B2	Cutouts with automatic reclosing A cutout is used in an electrical distribution network to electrically connect a first electric cable with a second electrical cable, The cutout includes an electrically non-conductive insulator having first and second end. A first terminal assembly is secured to the first insulator end. A second terminal assembly is secured to the second insulator end. A failsafe fuse assembly is pivotally secured to the second terminal and is movable between an engaged position and a lockout position. A reclosing mechanism is secured to the first terminal and monitors electrical current through the fuse assembly. If a fault condition exists, the reclosing mechanism opens and then closes the electrical link between the first and second electrical cable. If, after a predetermined number of closes, the fault condition still exists, the reclosing mechanism disconnects from the fuse assembly, allowing the fuse assembly to fall to the lockout position.
US08168900B2	Auxiliary operating device for an electromechanical switching device An auxiliary operating device for an electromechanical switching device having an operating mechanism. The auxiliary operating device including an actuating element couplable to the operating mechanism and movable between a first position and a second position, an actuation member movable relative to the actuating element between a third position and a fourth position, and a drive dog arrangement configured to cooperate with the actuating element and the actuation member. The auxiliary operating device further includes a coupling device movable between a release position and an operating position. The coupling device is configured, when in the operating position, so as to move the actuating element with the actuation member in a second direction of movement when the actuation member is in the third position. The coupling device is configured, when in the release position, so as to allow movement of the actuation member in the first and second directions between the third and fourth positions.
US08168894B2	Light emitting diode (LED) circuit board with multi-directional electrical connection The present invention provides a light emitting diode (LED) circuit board with a multi-directional electrical connection. The board includes a board body with a surface and an assembly plane as well as four sides and corresponding corners, and a plurality of positive and negative electric contacts, separately arranged onto the surface of the board body nearby four sides, and also arranged at intervals. The circuit of the LED circuit board is simplified, helping to facilitate multi-directional electrical connection and expansion, and to improve significantly the paving efficiency of the LED circuit board with better practicability and industrial benefits.
US08168892B2	Soldermask-less printed wiring board A printed wiring board has a non-conducting substrate with first and second major outboard surfaces; printed electrical conductors over at least the first major outboard surface; and an electrically insulating coating selectively disposed over the printed electrical conductors such that the coating forms an outermost layer over the first major outboard surface. In various embodiments, the coating is screen printed dielectric carbon ink which is also disposed over keypads on the second major outboard surface. There is no need for a soldermask layer as the keypads and electrical conductors are protected by the carbon ink from oxidation due to humidity and from shorting against other components. A method for making the PWB is also detailed.
US08168891B1	Differential trace profile for printed circuit boards Circuit boards and methods for their manufacture are disclosed. The circuit boards carry high-speed signals using conductors formed to include lengthwise channels. The channels increase the surface area of the conductors, and therefore enhance the ability of the conductors to carry high-speed signals. In at least some embodiments, a discontinuity also exists between the dielectric constant within the channels and just outside the channels, which is believed to reduce signal loss into the dielectric material.
US08168874B2	Drumstick gripping aid The present invention is directed to a drumstick gripping aid. In one embodiment, the drumstick gripping aid includes a first strap having two loops and a second strap having one loop interconnected thereto. The first strap is adapted to fit about at least two fingers of a user while the second strap is adapted to fit about an outer circumference of a drumstick. In another embodiment, a drumstick gripping aid includes a single strap having two loops. In one variation, a first loop is adapted to fit about one finger of a user while a second loop is adapted to fit about an outer circumference of a drumstick. In another variation, the first loop and the second loop are adapted to fit about at least two fingers of a user, the drumstick gripping aid fixedly attached to a drumstick.
US08168862B2	Fructan biosynthetic enzymes This invention relates to isolated nucleic acid fragments encoding fructosyltransferases. More specifically, this invention relates to polynucleotides encoding 1-FFTs, 6-SFTs, or 1-SSTs. The invention also relates to the construction of a recombinant DNA constructs encoding all or a portion of the fructosyltransferases, in sense or antisense orientation, wherein expression of the recombinant DNA construct results in production of altered levels of the fructosyltransferases in a transformed host cell.
US08168861B2	Compositions and methods for increasing cellulose production This disclosure relates to methods and compositions for genetically altering cellulose biosynthesis.
US08168853B2	Extrusion bonded laminates for absorbent articles An absorbent article of the present invention may comprise a topsheet, an outer cover, and an absorbent core disposed therebetween. The outer cover may comprise an extrusion bonded laminate. The EBL may comprise a multi-layer coextruded elastomeric film and a nonwoven. The film may comprise a core layer, a first outer layer, and a second outer layer, wherein the core layer is between the first and second outer layers. The nonwoven may comprise fibers and/or filaments. The first outer layer may be non-adhesively joined to the nonwoven via extrusion coating. Further, the outer cover may be elastic to at least about 50% engineering strain. The nonwoven may have high chemical affinity for the first outer layer. The first outer layer may have a low chemical affinity for the core layer; and the multi-layer coextruded elastomeric film may have a basis weight no greater than about 40 gsm.
US08168846B2	Process and plant for converting hazardous waste containing chromium VI into non-hazardous waste The instant invention relates to a process and plant for the transformation of dangerous wastes containing chromium six as contaminant into non dangerous wastes that can be stored without special care and will be degraded in the environment without time limit. The process basically consists of milling, extracting chromium six in liquid phase and under controlled conditions of stirring, time and temperature, proceeding then, through reduction, to transform the chromium six in chromium three and then precipitating as chromium trioxide, through gasification.The solid resulting from the transformation process can be used as raw material for the manufacturing of firebricks or eventually for the manufacturing of bricks used in the building industry through a process not included in the instant description.
US08168841B2	Process for preparing cyclododecatriene Preparation of cyclododecatriene in a continuous or discontinuous process by trimerization of butadiene in the presence of a catalyst system and a solvent, the crude cyclododecatriene obtained being able to be isolated by means of distillation. The cyclooctadiene formed as by-product can likewise be isolated from the crude product.
US08168837B2	Process for separating hydrogen fluoride from organic feedstocks Provided is a process for purifying an organic feedstock comprising (a) distilling a raw organic feedstock comprising hydrogen fluoride, 2-chloro-1,1,1,2-tetrafluoropropane, and 2-chloro-3,3,3-trifluoropropene to produce a first distillate stream comprising an azeotrope-like composition of 2-chloro-1,1,1,2-tetrafluoropropane, 2-chloro-3,3,3-trifluoropropene, and hydrogen fluoride, and a first bottoms stream rich in hydrogen fluoride; (b) cooling said first distillate stream to produce an intermediate composition comprising an organic layer rich in 2-chloro-1,1,1,2-tetrafluoropropane and 2-chloro-3,3,3-trifluoropropene, and an acid layer rich in hydrogen fluoride; and, optionally but preferably, (c) distilling said organic layer to produce a second distillate stream comprising an azeotrope-like composition of 2-chloro-1,1,1,2-tetrafluoropropane, 2-chloro-3,3,3-trifluoropropene, and hydrogen fluoride, and a second bottoms stream comprising a purified organic feedstock substantially free of hydrogen fluoride.
US08168836B2	Method of hydrogenating aldehydes and ketones Methods and systems for the hydrogenation of aldehydes and/or ketones are described herein. The methods and systems incorporate the novel use of a high shear device to promote dispersion and solubility of the hydrogen-containing gas (e.g. H2 gas) in the aldehydes and/or ketones. The high shear device may allow for lower reaction temperatures and pressures and may also reduce hydrogenation time with existing catalysts.
US08168829B2	Synthesis of quaternary salt compounds The present invention is directed to a process, having a reduced environmental impact, for preparing phenylamino substituted quaternary salt compounds that are CCR2 antagonists.
US08168824B2	Purification of acetic acid from wood acetylation process using extraction There is shown a method of purifying glacial acetic acid containing terpene and terpenoid impurities. Substantially dry acetic acid containing terpene and terpenoid impurities is combined with water and a suitable organic solvent, which is substantially immiscible with acetic acid and water, to form a separating composite extraction medium having a weight ratio of acetic acid:water of at least 1:1. The components are separated into an organic phase and an aqueous acid phase, with the terpene and terpenoid impurities concentrated in the organic phase, and with the aqueous acid phase purified of terpene and terpenoid impurities. The purified aqueous acid phase is recovered, and the purified acetic acid is dried.
US08168823B2	Process for the preparation of betaines Betaines of formula R3N+-Q-COO− (I), wherein R is C1-4 alkyl and Q is C1-4 alkanediyl, optionally substituted with hydroxy, are prepared in one step by adding an ω-halocarboxylate of formula X-Q-COOR′ (II), wherein Q is as defined above, R′ is Cl1-4 alkyl and X is chlorine, bromine or iodine, to an aqueous solution containing a tertiary amine of formula R3N (III), Wherein R is as defined above and a base selected from alkali hydroxides and alkaline earth hydroxides. The process is particularly suited to the production of L-carnitine.
US08168813B2	Porous organic-inorganic hybrid materials and adsorbent comprising the same The present invention relates to an adsorbent using the porous organic-inorganic hybrid material(s) containing iron having a large surface area and a high pore volume, in particular, a water adsorbent. Also, it relates to an adsorbent that can be used in humidifiers, dehumidifiers, coolers/heaters, a refrigerating machine or an air conditioner, etc., which can easily absorb or desorb at 100° C. and below, and has a great adsorption amount per weight of the adsorbent.Also, the present invention relates to a novel preparation method of porous organic-inorganic hybrid material(s), in particular, a preparation method characterized by not using hydrofluoric acid, porous organic-inorganic hybrid material(s) prepared by said preparation method, and a use as an adsorbent thereof.
US08168812B2	Process for producing alkyl tin alkoxide compound and process for producing carbonic acid ester using said compound The present invention provides a process for producing: a compound represented by XOR2; a dialkyl tin dialkoxide compound having one tin atom, two Sn—R1 bonds and two Sn—OR2 bonds; and/or a tetraalkyl dialkoxy distannoxane compound having one Sn—O—Sn bond, in which each tin atom of the tetraalkyl dialkoxy distannoxane compound has two Sn—R1 bonds and one Sn—OR2 bond.
US08168809B2	2-methyl-3-(3,4-methylenedioxyphenyl)propanal, and method for production thereof Disclosed are: (1) a method for producing 2-methyl-3-(3,4-methylenedioxyphenyl)propanal, which comprises the step of providing a reaction mixture containing 1-acetoxy-2-methyl-3-(3,4-methylenedioxyphenyl)-1-propene by a process for reacting 1,2-methylenedioxybenzene with 2-methyl-3,3-diacetoxypropene or a process for reacting 1,2-methylenedioxybenzene, methacrolein and acetic anhydride with one another; subjecting the reaction mixture to hydrolysis or transesterification with an alcohol to provide a reaction mixture containing 2-methyl-3-(3,4-methylenedioxyphenyl)propanal; and purifying by distilling the reaction mixture, wherein a high boiling point compound contained in the reaction mixture is removed by a specific procedure; and (2) 2-methyl-3-(3,4-methylenedioxyphenyl)-propanal produced by the method, which has an acetic acid content of a less than 40 ppm, is useful as a perfume, and has a high purity.
US08168800B2	Aβ-binding small molecules In one aspect, the present invention provides for compounds and labeled compounds of Formula I, and pharmaceutical compositions thereof. In another aspect, the present invention provides for methods of using compounds or labeled compounds of Formula I for various therapeutic and imaging purposes, including, but not limited to, treating Alzheimer's disease in patient and imaging Aβ peptide aggregates in a patient.
US08168787B2	Process for the preparation of imatinib and intermediates thereof A process for the preparation of 4-methyl-N3-[4-(3-pyridinyl)-2-pyrimidinyl]-1,3-benzenediamine and analogues thereof, intermediates useful for the synthesis of Imatinib, or 4-[(4-methyl-1-piperazinyl)methyl]-N-[4-methyl-3-[[4-(3-pyridinyl)-2-pyrimidinyl]amino]phenyl]benzamide.
US08168780B2	Method for producing a specific polymorph of titanylphthalocyanine The present invention provides a method for producing a polymorphic form of a titanylphthalocyanine having superior photoreceptor characteristics, particularly superior chargeability and photosensitivity to those of the conventional titanylphthalocyanines.
US08168779B2	Anhydrous crystalline β-maltose, its preparation and uses Objects of the present invention are to provide a novel anhydrous crystalline β-maltose, its preparation and uses. The present invention attains the above objects by providing an anhydrous crystalline β-maltose with a melting point of 154 to 159° C.; a process for producing the same, comprising a step of keeping hydrous crystalline β-maltose in an organic solvent at an ambient temperature or higher for the dehydration; and uses of the same.
US08168778B2	Highly-branched starch, its production and uses An object of the present invention is to provide a novel starchy substance having a retrogradation-resistance, a process for producing the starchy substance efficiently from a material starch by enzymatic reaction, and uses thereof. The present invention attains the above object by providing branched starch having 6-α-maltosyl- and/or 6-α-maltotetraosyl-structure(s) with a marked retrogradation-resistance, a process for producing the branched starch without lowering the molecular weight of material starch, and uses thereof.
US08168776B2	Method for making a 21 nucleotide double stranded RNA chemically linked at one end The present invention provides methods and compositions for inhibiting gene expression using double stranded RNA molecules that are between 15 and 21 nucleotides in length and are complementary to a target gene sequence.
US08168773B2	Methods for monitoring multiple gene expression The present invention relates to methods for monitoring differential expression of a plurality of genes in a first Bacillus cell relative to expression of the same genes in one or more second Bacillus cells using microarrays containing Bacillus genomic sequenced tags. The present invention also relates to computer readable media and computer-based systems. The present invention further relates to substrates containing an array of Bacillus licheniformis or Bacillus clausii GSTs.
US08168759B2	Compositions monovalent for CD28 binding and methods of use Disclosed are domain antibodies that monovalently bind CD28. Domain antibodies that are monovalent for binding of CD28 can inhibit CD28 activity. In one aspect, a domain antibody consists of or comprises a single immunoglobulin variable domain that specifically binds and antagonizes the activity of CD28, in an aspect, without substantially agonizing CD28 activity. In another aspect, the domain antibody is a human domain antibody. The disclosure further encompasses methods of antagonizing CD80 and/or CD86 interactions with CD28 in an individual and methods of treating diseases or disorders involving CD80 and/or CD86 interactions with CD28, the methods involving administering a domain antibody to the individual.
US08168757B2	PD-1 binding proteins The present invention features PD-1 binding proteins, a subset of which inhibits binding of PD-L1 to the PD-1 receptor. These binding proteins can be employed to modulate the immune system through the manipulation of the PD-1 signaling pathway, enhancing host immunity to treat infections and cancer.
US08168749B2	Stimulating neurite outgrowth using Tctex-1-related polypeptides A method of stimulating neurite outgrowth in a subject may include administering to the subject a formulation that includes a tctex-1-related polypeptide that stimulates neurite outgrowth in vitro.
US08168743B2	Curable benzoxazine macromonomers, their preparation and cured products The invention relates to a curable benzoxazine macromonomer containing at least 3 benzoxazine rings and at least one aliphatic, heteroaliphatic, araliphatic, hetereoaraliphatic, aromatic or heteroaromatic fragment, the fragment comprising a shortest atom chain containing at least 40 consecutive atoms between two benzoxazine nitrogen atoms or between two benzoxazine oxygen atoms, and said atom chain must not include any oxazine ring atoms (“soft fragment”). The invention further relates to cured products made thereof and a method or producing the same.
US08168735B2	Silicone compound, a process for the preparation thereof and a process for the preparation of an ophthalmic device therefrom The present invention provides a hydrophilic silicone which has a predetermined number of silicon atoms and a high purity and is suitable for producing an ophthalmic device and a process for preparing the same.The silicone compound is represented by formula (1) with a purity of 95% by weight or higher, wherein m is one value out of the integers of from 3 to 10, n is one value out of the integers of from 1 to 10, R1 is one out of alkyl groups having 1 to 4 carbon atoms, and R2 is one out of a hydrogen atom and a methyl group.
US08168734B2	Lateral alpha-substituted acrylate compound and polymer thereof The invention relates to compounds represented by Formula (1): wherein Ra is independently halogen, cyano, —CF3, —CF2H, —CFH2, —OCF3, —OCF2H, —N═C═O, —N═C═S or alkyl having a carbon number of approximately 1 to approximately 20; in the alkyl, optional —CH2— may be substituted with —O—, —S—, —SO2—, —CO—, —COO—, —OCO—, —CH═CH—, —CF═CF— or —C≡C—, and optional hydrogen may be substituted with halogen; Rb is fluorine or —CF3; A is independently 1,4-cyclohexylene, 1,4-cyclohexenylene, 1,4-phenylene, naphthalene-2,6-diyl, tetrahydronaphthalene-2,6-diyl, fluorene-2,7-diyl or bicyclo[2.2.2]octane-1,4-diyl; in these rings, optional —CH2— may be substituted with —O—, optional —CH═may be substituted with —N═, and optional hydrogen may be substituted with halogen, alkyl having a carbon number of approximately 1 to approximately 5 or halogenated alkyl having a carbon number of approximately 1 to approximately 5; Z is independently a single bond or alkylene having a carbon number of approximately 1 to approximately 20; in the alkylene, optional —CH2— may be substituted with —O—, —CO—, —COO—, —OCO—, —CH═CH—, —CF═CF— or —C≡C—, and optional hydrogen may be substituted with halogen; Y is a single bond or alkylene having a carbon number of approximately 1 to approximately 20; in the alkylene, optional —CH2— may be substituted with —O—, —CO—, —COO—, —OCO— or —CH═CH—, and optional hydrogen may be substituted with halogen; and m and n are each an integer of approximately 0 to approximately 5, wherein m and n are not 0 at the same time.
US08168723B2	Brominated styrenic polymers and their preparation Preparing brominated styrenic polymer by maintaining a mixture formed from (i) brominating agent, (ii) a solvent solution of styrenic polymer, and (iii) aluminum halide catalyst, at −20 to +20° C., and terminating bromination in 20 minutes or less. New brominated anionic styrenic polymers have better melt flow and/or lower initial ΔE values than the best previously-known brominated anionic styrenic polymers. Other features of such new polymers include high thermal stabilities at 320° C. and/or very low initial color values. Brominated styrenic polymers, especially brominated anionic styrenic polymers, are useful as flame retardants for thermoplastic polymers.
US08168719B2	Thermoplastic molding compound with processing-independent viscosity The present invention relates to thermoplastic molding compositions comprising a mixture composed of (A) at least one methyl methacrylate polymer, (B) at least one copolymer, obtainable via polymerization of a mixture, composed of (B1) at least one vinylaromatic monomer, and (B2) at least one vinyl cyanide, as monomers, (C) at least one graft polymer, obtainable from a core, and a first graft shell, and a second graft shell, (D) at least one polybutyl acrylate whose molar mass is from 1700 to 4000 g/mol (determined as Mw by means of gel permeation chromatography), and (E) if appropriate conventional additives, as component (E), to a process for preparation of these thermoplastic molding compositions, to the use of this thermoplastic molding composition for production of moldings, and also to the use of styrene-methyl methacrylate copolymers whose molar mass is from 1700 to 4000 g/mol (determined as Mw by means of gel permeation chromatography) for improvement of flowability and for reduction of the dependency of notched impact strength and haze values of thermoplastic molding compositions on injection-molding conditions.
US08168712B2	Golf ball The object of the present invention is to provide a golf ball having excellent durability and resilience. The present invention provides a golf ball which includes a core, and a cover covering the core. The cover contains an ionomer resin and an organically modified layered silicate. The organically modified layered silicate has an interlayer distance, measured by X-ray diffraction, in a range from 2.5 nm to 15 nm.
US08168709B2	Method of processing rubber composition, rubber composition and pneumatic tire The present invention is directed to a method of processing a rubber composition, comprising the steps of mixing at least one diene base elastomer with at least one additive selected from the group consisting of fillers, to a final temperature of about 150 to about 160° C. in a first non-productive mix step to form a first non-productive mix; cooling the first non-productive mix to a temperature of about 60 to about 90° C.; mixing the first non-productive mix with 0.1 to 10 parts by weight, per 100 parts by weight of elastomer, of a treated short aramid fiber having a length ranging from 1 to 10 mm and having a thickness ranging from 5 to 15 microns and comprising 3 to 40 percent by weight of a peroxide radical initiator in a second non-productive mix step to a final temperature of about 150 to about 160° C. to form a second non-productive mix; and mixing the second non-productive mix with curatives in a productive mix step to form a productive mix.
US08168707B2	Moldable polyester compositions, processes of manufacture, and articles thereof A thermoplastic composition comprises, based on the total weight of the composition: 51-90 wt % of a polyester, 10-49 wt % of an ABS impact modifier; 0 to 20 wt % of a multifunctional epoxy compound; 0-40 wt % of a filler; 0-2 wt % of a fibrillated fluoropolymer; and from more than 0 to 5 wt % of a stabilizer composition. An article blow molded or injection molded from the composition has a multi-axial impact total energy from 40-100 Joules at −30° C.; a ductility of more than 90%, a permeability of more than 0 to less than or equal to 1.5 g/m2-day, measured after exposure Fuel C vapor for 20 weeks at 40° C.; an MVR of 1-20 cc/10 min; a flexural modulus of greater than 1300 MPa; and retains at least 75% of its initial tensile elongation at break after exposure to Fuel E85 for 28 days at 70° C.
US08168703B2	Flexible panel with interrupted sheaths for tie rods Membrane body (1) comprising at least one pair of panels (10, 11) connected together in an adhesive manner and for each pair of said panels (10, 11), at least one flexible sheath (15) arranged stably according to a set pattern to resist membrane stress acting on the panels (10, 11); each sheath (15) housing a respective tie rod (16), connected to the panels (10, 11) in an end position in a set manner in such a way as to be suitable for resisting normal stress to free the panels (10, 11) from the respective membrane stress, thereby maintaining the group of the panels (10, 11) flexible and maintaining the corresponding production method.
US08168701B2	Concrete or mortar admixture composition A concrete admixture composition concurrently using (A) a polycarboxylic acid type water-reducing agent for concrete, (B) a hydroxycarboxylic acid type water-reducing agent for concrete, and (C) a polysaccharide type thickening agent is offered, with the view to manufacture a high-performance and multi-functional concrete excelling in high fluidity, freshness retention, early strength, pumpability, material segregation resistance and anti-washout properties under water.
US08168686B2	Integrated biorefinery for production of liquid fuels A method and system for reforming a carbonaceous feedstock comprising the steps, reforming the feedstock produce a first synthesis gas, subjecting a portion of the first synthesis gas to catalytic conversion, separating from the synthesis gas conversion product at least one byproduct, and utilizing at least a portion of the at least one byproduct during reforming of additional carbonaceous material. In certain instances, the method and system may be used to produce a liquid fuel.
US08168676B2	Production on peracids using an enzyme having perhydrolysis activity A process is provided for producing peroxycarboxylic acids from carboxylic acid esters. More specifically, carboxylic acid esters are reacted with an inorganic peroxide, such as hydrogen peroxide, in the presence of an enzyme catalyst having perhydrolysis activity. The present perhydrolase catalysts are classified as members of the carbohydrate esterase family 7 (CE-7) based on the conserved structural features. Further, disinfectant formulations comprising the peracids produced by the processes described herein are provided.
US08168673B2	Compounds having CRTH2 antagonist activity Compounds of general formula (I) wherein W is chloro or fluoro; Z is a group SO2R1; wherein R1 is —C3-C8 cycloalkyl or heterocyclyl optionally substituted with one or more substituents chosen from halo, —CN, —C1-C6 alkyl, —SOR3, —SO2R3, —SO2N(R2)2, —N(R2)2, —NR2C(O)R3, —CO2R2, —CONR2R3, —NO2, —OR2, —SR2, —O(CH2)pOR2, and —O(CH2)pO(CH2)qOR2 wherein each R2 is independently hydrogen, —C1-C6 alkyl, —C3-C8 cycloalkyl, aryl or heteroaryl; each R3 is independently, —C1-C6 alkyl, —C3-C8 cycloalkyl, aryl or heteroaryl; p and q are each independently an integer from 1 to 3; and their pharmaceutically acceptable salts, hydrates, solvates, complexes or prodrugs are useful in orally administrable compositions for the treatment of allergic diseases such as asthma, allergic rhinitis and atopic dermatitis.
US08168668B2	Compounds The present invention relates to new compounds or salts, solvates or solvated salts thereof, processes for their preparation and to new intermediates used in the preparation thereof, pharmaceutical compositions containing said compounds and to the use of said compounds in therapy.
US08168666B2	Substituted carbinol compound There is provided a novel LXRβ agonist useful as a preventative and/or therapeutic agent for arteriosclerosis; arteriosclerosis such as those resulting from diabetes; hyperlipidemia; hypercholesterolemia; lipid-related diseases; inflammatory diseases caused by inflammatory cytokines, skin diseases such as allergic skin diseases, diabetes or Alzheimer's disease. The agonist is a carbinol derivative represented by the following general formula (1) or salt thereof, or their solvate.
US08168665B2	Substituted 2-phenyl-benzimidazoles and their use as pharmaceuticals The present invention relates to derivatives of 2-phenyl-benzimidazoles of the formula I, in which X, R, R1 to R3 and n have the meanings indicated in the claims, which modulate the transcription of endothelial nitric oxide (NO) synthase and are valuable pharmacologically active compounds. Specifically, the compounds of the formula I upregulate the expression of the enzyme endothelial NO synthase and can be applied in conditions in which an increased expression of said enzyme or an increased NO level or the normalization of a decreased NO level is desired. The invention further relates to processes for the preparation of compounds of the formula I, to pharmaceutical compositions comprising them, and to the use of compounds of the formula I for the manufacture of a medicament for the stimulation of the expression of endothelial NO synthase or for the treatment of various diseases including cardiovascular disorders such as atherosclerosis, thrombosis, coronary artery disease, hypertension and cardiac insufficiency, for example.
US08168662B1	Use of picoplatin to treat colorectal cancer The invention provides a method of treatment of colorectal cancer by administration of the anti-cancer platinum drug picoplatin in conjunction with 5-FU and leucovorin in a variety of treatment regimens. Dosages, dosing schedules, and ancillary treatments are described.
US08168658B2	Inhibitors of histone deacetylase The present invention relates to a novel class of compounds. These compounds can inhibit histone deacetylase and are suitable for use in selectively inducing terminal differentiation, and arresting cell growth and/or apoptosis of neoplastic cells, thereby inhibiting proliferation of such cells. Thus, the compounds of the present invention are useful in treating a patient having a tumor characterized by proliferation of neoplastic cells. The compounds of the invention may also be useful in the prevention and treatment of TRX-mediated diseases, such as autoimmune, allergic and inflammatory diseases, and in the prevention and/or treatment of diseases of the central nervous system (CNS), such as neurodegenerative diseases. The present invention further provides pharmaceutical compositions comprising the compounds of the instant invention and safe dosing regimens of these pharmaceutical compositions, which are easy to follow, and which result in a therapeutically effective amount of these compounds in vivo.
US08168651B2	Protein kinase modulators The invention relates in part to molecules having certain biological activities that include, but are not limited to, inhibiting cell proliferation, modulating protein kinase activity and modulating polymerase activity. Molecules of the invention can modulate Pim kinase activity and/or FMS-like tyrosine kinase (Flt) activity. The invention also relates in part to methods for using such molecules.
US08168639B2	Heterotricyclic compounds as serotonergic and/or dopaminergic agents and uses thereof Novel heterocyclic compounds of formula I: A-B-D Formula I or a pharmaceutically acceptable salt thereof, wherein: A is selected from the group consisting of a moiety having general Formula II and a moiety having general Formula III: B is a moiety selected from the group consisting of: D is a moiety selected from the group consisting of: which exhibit a dopamine receptor (preferably a D4 receptor) and/or a serotonine receptor (preferably 5HTA1 agonistic activity), processes of preparing same, pharmaceutical compositions containing same and uses thereof in the treatment of medical conditions associated with the dopaminergic and/or serotonergic systems (e.g., sexual disorders, dyskinesia, anxiety) are disclosed.
US08168637B2	Beta-amino heterocyclic dipeptidyl peptidase inhibitors for the treatment of diabetes The present invention is directed to compounds which are inhibitors of the dipeptidyl peptidase-IV enzyme (“DP-IV inhibitors”) and which are useful in the treatment or prevention of diseases in which the dipeptidyl peptidase-IV enzyme is involved, such as diabetes and particularly type 2 diabetes. The invention is also directed to pharmaceutical compositions comprising these compounds and the use of these compounds and compositions in the prevention or treatment of such diseases in which the dipeptidyl peptidase-IV enzyme is involved.
US08168635B2	Modulators of central nervous system neurotransmitters Disclosed are agents having pharmacological activity against cellular receptors and intracellular signaling, particularly receptors and signaling pathways of central nervous system (CNS) neurotransmitters. Also disclosed are related methods and compositions for the treatment or prevention of diseases or disorders using the agents.
US08168634B2	Thiazole derivatives as kinase inhibitors A series of thiazole derivatives which are substituted in the 2-position by a substituted morpholin-4-yl moiety, being selective inhibitors of P13 kinase enzymes, are accordingly of benefit in medicine, for example in the treatment of inflammatory, autoimmune, cardiovascular, neurodegenerative, metabolic, oncological, nociceptive or ophthalmic conditions.
US08168632B2	Bicyclic amide derivatives for the treatment of respiratory disorders This invention relates to compounds, pharmaceutical compositions and methods for use in the prevention and treatment of disorders of respiration such as overdose of an alcohol, an opiate, an opioid, a barbiturate, an anesthetic, or a nerve toxin. In a particular aspect, the invention relates to bicyclic amide compounds useful for treatment of such conditions, and methods of using these compounds for such treatment.
US08168631B2	3-(4-fluorophenyl)-3-hydroxy-2-amino-propionic acid amides and related compounds having analgesic activity Compounds according to the formula below are disclosed herein: Therapeutic methods, compositions, and medicaments related thereto are also disclosed.
US08168627B2	Helix 12 directed non-steroidal antiandrogens Compounds having the structure (or their salts): are used to treat or reduce the likelihood of acquiring androgen-dependent diseases, such as prostate cancer, benign prostatic hyperplasia, polycystic ovarian syndrome, acne, hirsutism, seborrhea, androgenic alopecia and male baldness. The compounds can be formulated together with pharmaceutically acceptable diluents or carriers or otherwise made into any pharmaceutical dosage form. Combinations with other active pharmaceutical agents are also disclosed.
US08168621B2	6-substituted estradiol derivatives and methods of use A compound having the structure: wherein R1, R2, R, R, X, Y and Z are as defined herein. The compounds are estrogen receptor modulators useful for the treatment of proliferative disorders.
US08168618B2	Emulsifying agent The present invention has its object to provide a novel emulsifier which is obtainable from an edible yeast and is highly safe and shows by itself a high level of emulsifying property and high emulsion stability; a water-soluble composition containing a liposoluble substance, together with the emulsifier; and methods of producing these. The present invention includes: an emulsifier which comprises, as an active ingredient, a carbohydrate- and protein-based complex derived from a culture fluid obtained by cultivating an edible yeast; a water-soluble composition which comprises an emulsifier and a liposoluble substance; and a method of producing the emulsifier and the water-soluble composition.
US08168614B2	Boron-containing small molecules as anti-inflammatory agents Methods of treating anti-inflammatory conditions through the use of boron-containing small molecules are disclosed.
US08168611B1	Compositions, kits and methods for nutrition supplementation The present invention relates to compositions, kits and methods for the administration of various vitamin, mineral and nutrient compositions, and in a specific embodiment, the compositions, kits and methods may utilize or include twelve carbon chain fatty acids and/or twelve carbon chain acylglycerols, vitamin D, iodine, vitamin B1, vitamin B6, vitamin B12, vitamin B2, vitamin B9, vitamin B3, vitamin E, vitamin A, vitamin C, iron, zinc, copper, magnesium, omega 3 fatty acids and one or more pharmaceutically acceptable carriers.
US08168608B2	Promoter and plasmid system for genetic engineering This invention provides a series of low-copy number plasmids comprising restriction endonuclease recognition sites useful for cloning at least three different genes or operons, each flanked by a terminator sequence, the plasmids containing variants of glucose isomerase promoters for varying levels of protein expression. The materials and methods are useful for genetic engineering in microorganisms, especially where multiple genetic insertions are sought.
US08168604B2	Antisense antiviral compounds and methods for treating a filovirus infection The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Filoviridae family, and in the treatment of a viral infection. The compounds and methods relate to the treatment of viral infections in mammals including primates by Ebola and Marburg viruses. The antisense antiviral compounds are morpholino oligonucleotides having: a) a nuclease resistant backbone, b) 15-40 nucleotide bases, and c) a targeting sequence of at least 15 bases in length that hybridizes to a target region selected from the following: i) the Ebola virus AUG start site region of VP24; ii) the Ebola virus AUG start site region of VP35; iii) the Marburg virus AUG start site region of VP24; or iv) the Marburg virus AUG start site region of NP.
US08168601B2	Method of delivering RNA interference and uses thereof The invention provides a method of RNA interference, which comprises contacting the cell with a fusion protein-double stranded RNA complex, the complex comprising the double stranded RNA segment containing a double stranded RNA of interest and a fusion protein, the fusion protein comprising (1) a targeting moiety, which will specifically binds to a site on a target cell, and (2) a binding moiety, which will bind to the double stranded RNA, wherein the double stranded RNA segment initiates RNA interference in the cell.
US08168599B2	Composition and method for healing tissues The composition and method for healing tissues is a medicinal composition for facilitating the growth, protection and healing of tissues and cells in animals and humans. The composition is formulated as a either a powder, gel, paste, film, fluid injectable, rehydratable freeze-dried paste or sponge, sprayable solution, topically applied patch with adhesive and reservoir system, an intermediate for coatables such as films and bandages, a matrix for membranes, or as a matrix of flexible polymer(s), or delivered as either an orally ingestible liquid, tablet or capsule. The main ingredient of the formulated compositions is hydrolyzed collagen, which can be combined with polysulfated glycosaminoglycans, hyaluronic acid or salts thereof, or a glucosamine salt, and mixtures thereof. The composition may be formulated as an aqueous eye drop solution.
US08168597B2	Method for treating cystic fibrosis The present invention is directed to a method for treating cystic fibrosis. The method comprises the steps of: identifying a patient suffering from cystic fibrosis, and administering to the patient an effective amount of denufosol or a pharmaceutically acceptable salt thereof and an effective amount of a macrolide. In one method, denufosol and the macrolide are administered by inhalation, preferably in a single formulation. In another method, denufosol is administered by inhalation and the macrolide is administered orally. The present invention is also directed to a pharmaceutical formulation comprising denufosol or a pharmaceutically acceptable salt thereof, a macrolide, and a pharmaceutically acceptable carrier. Preferred denufosol is denufosol tetrasodium and preferred macrolide is azithromycin. The pharmaceutical formulation preferably is in a form of an inhalable dry powder or in a liquid form.
US08168594B2	Method for treating celiac disease Enteric compositions comprising one or more tight junction agonists and/or one or more tight junction antagonists are provided. Compositions of the invention may comprise a delayed-release coating disposed over a tight junction agonist and/or tight junction antagonist layer which may be disposed over an inert core. Delayed-release coatings may be substantially stable in gastric fluid and substantially unstable in intestinal fluid, thus providing for substantial release of the tight junction agonist and/or antagonist from the composition in the duodenum or jejunum of the small intestine.
US08168587B2	Combination enzyme replacement and small molecule therapy for treatment of lysosomal storage diseases This invention provides various combinations of enzyme replacement therapy, gene therapy, and small molecule therapy for the treatment of lysosomal storage diseases.
US08168584B2	Methods of treating age-related macular degeneration by compstatin and analogs thereof The present invention features the use of compstatin and complement inhibiting analogs thereof for treating and/or preventing age related macular degeneration and other conditions involving macular degeneration, choroidal neovascularization, and/or retinal neovascularization. The invention also provides compositions comprising compstatin or a complement inhibiting analog thereof and a second therapeutic agent. The invention also provides compositions comprising compstatin or a complement inhibiting analog thereof and a gel-forming material, e.g., soluble collagen, and methods of administering the compositions.
US08168582B2	Fabric softening composition comprising a polymeric viscosity modifier A liquid fabric treatment composition comprising a cationic fabric softening agent and a water-soluble linear polymeric viscosity modifier represented by the formula: Z—Y—(X—Y)n—Z in which: X represents a polyether chain, each Y independently represents a linking group derived from a diisocyanate, each Z independently represents a hydrophobic group and optionally includes a spacer linked to Y, n represents an integer of at least 2, and the molecular weight of the polymer is from 2,000 to 80,000.
US08168578B2	Water-based silicone dispersion containing low level of silicone oils A water-based composition for enhancing shine or gloss in an elastomeric surface is in the form of a stable aqueous dispersion having a pH of from about 6 to about 7 and containing by weight: (a) less than 10% of at least one polydiorganosiloxane fluid; (b) from about 0.02% to about 2.0% of an alkali-swellable acrylic homopolymer or copolymer crosslinked with a polyalkenyl polyether; and (c) water. In one embodiment, the composition contains less than 1% by weight of a wetting agent and has no additional surfactants, hydrotropes and emulsifying agents. The composition can be used to enhance shine or gloss in elastomeric surfaces such as rubber or vinyl, preferably automotive tires, by applying an effective amount of the composition to the surface and distributing the composition with an application implement. The composition contains less organopolysiloxane than commercial formulations but exhibits gloss-enhancing performance that is comparable or even higher than that exhibited by commercial compositions.
US08168575B2	Metalworking fluids comprising neutralized fatty acids An additive for an aqueous metalworking fluid (MWF) comprises a C12-20 fatty acid neutralized with at least one of an amine, alkanolamine and a caustic. The additive is designed for use in an aqueous MWF having a pH of at least about 7 and comprising at least about 0.10 weight percent, based on the weight of the MWF, of the neutralized C12-20 fatty acid. The additive inhibits the staining of ferrous and nonferrous metals during and after machining.
US08168572B2	Lubricant blend composition The present invention relates to a lubricant composition. The present invention more particularly relates to a fully miscible lubricant composition that comprise a polyether and a renewable raw material such as an unsaturated seed or vegetable oil.
US08168564B2	Catalyst support A catalyst support in the shape of a non-planar ring having a bore; wherein there is no rotational symmetry around the axis extending through the center of the bore defined by the ring, and wherein the ratio of the thickness of the ring to the outer diameter of the ring is less than 0.5. The catalyst support shape is especially advantageous to pack within a fixed bed multitubular reactor such as that used for Fischer-Tropsch reactions. The packing of such shapes can reduce the pressure drop across the tubes with little or no difference in the porosity.
US08168560B2	Exhaust gas purifying catalyst An exhaust gas purifying catalyst is provided which includes a catalyst substrate and a catalyst coating layer. The catalyst coating layer is formed on the catalyst substrate and contains a noble metal and a refractory inorganic oxide. The catalyst coating layer has a layered structure including an A-layer and a B-layer. The A-layer contains Pd and Pt as the noble metal in a weight ratio of 3:1 to 20:1. The B-layer includes Rh as the noble metal.
US08168546B2	Method for selective deposition and devices A chemical vapor deposition method such as an atomic-layer-deposition method for forming a patterned thin film includes applying a deposition inhibitor material to a substrate. The deposition inhibitor material is a hydrophilic polymer that is has in its backbone, side chains, or both backbone and side chains, multiple secondary or tertiary amide groups that are represented by the following acetamide structure: >N—C(═O)—. The deposition inhibitor material is patterned simultaneously or subsequently to its application to the substrate, to provide selected areas of the substrate effectively not having the deposition inhibitor material. A thin film is substantially deposited only in the selected areas of the substrate not having the deposition inhibitor material.
US08168545B2	Solar cell fabrication using extruded dopant-bearing materials Wafer-based solar cells are efficiently produced by extruding a dopant bearing material (dopant ink) onto one or more predetermined surface areas of a semiconductor wafer, and then thermally treating the wafer to cause diffusion of dopant from the dopant ink into the wafer to form corresponding doped regions. A multi-plenum extrusion head is used to simultaneously extrude interdigitated dopant ink structures having two different dopant types (e.g., n-type dopant ink and p-type dopant ink) in a self-registered arrangement on the wafer surface. The extrusion head is fabricated by laminating multiple sheets of micro-machined silicon that define one or more ink flow passages. A non-doping or lightly doped ink is co-extruded with heavy doped ink to serve as a spacer or barrier, and optionally forms a cap that entirely covers the heavy doped ink. A hybrid thermal treatment utilizes a gaseous dopant to simultaneously dope exposed portions of the wafer.
US08168544B2	Oxide etching method There is provided an etching method of an amorphous oxide layer containing In and at least one of Ga and Zn, which includes etching the amorphous oxide layer using an etchant containing any one of acetic acid, citric acid, hydrochloric acid, and perchloric acid.
US08168539B2	Method for forming tungsten film at a surface of a processing target material, film-forming apparatus, storage medium and semiconductor device with a tungsten film A tungsten film with a lower specific resistance and a lower fluorine concentration over its boundary with the base barrier layer, which adheres to the barrier layer with a high level of reliability, compared to tungsten films formed through methods in the related art, is formed. The tungsten film is formed through a process in which a silicon-containing gas is delivered to a wafer M placed within a processing container 14 and a process executed after the silicon-containing gas supply process, in which a first tungsten film 70 is formed by alternately executing multiple times, a tungsten-containing gas supply step for supplying a tungsten-containing gas and a hydrogen compound gas supply step for supplying a hydrogen compound gas with no silicon content with a purge step in which an inert gas is supplied into the processing container and/or an evacuation step for evacuating the processing container executed between the tungsten-containing gas supply step and the hydrogen compound gas supply step.
US08168531B2	Semiconductor device and method of fabricating the same A semiconductor device and method of fabricating the same, which forms a contact hole, a via hole or a via contact hole with multiple profiles with various taper angles. The semiconductor device includes a substrate, a thin film transistor formed on the substrate and having a semiconductor layer, a gate insulating layer, a gate electrode, and an interlayer dielectric, and a contact hole penetrating the gate insulating layer and the interlayer dielectric and exposing a portion of the semiconductor layer. The contact hole has a multiple profile in which an upper portion of the contact hole has a wet etch profile and a lower portion of the contact hole has at least one of the wet etch profile and a dry etch profile.
US08168526B2	Semiconductor chip package and method for manufacturing thereof A semiconductor chip package and a method for manufacturing thereof includes sequentially forming upper dielectric layer patterns and lower dielectric patterns over a substrate to expose an underlying metal line such that the lower dielectric layer patterns overlap the metal line, positioning a solder ball over and contacting the lower dielectric layer patterns such that the solder ball does not contact the metal line, and then placing the solder ball in a contacting position over the metal line by performing an etching process on the lower dielectric layer patterns. Therefore, no cracks occur on the chip pads so that there is no concern of short phenomenon generated in the terminal.
US08168525B2	Electronic part mounting board and method of mounting the same An electronic part mounting board includes an insulating board, a pad formed on the insulating board, a bump formed on the pad, and a film having heat resistance and electrical insulating properties and formed on the insulating board except the pad and the bump. A method of mounting an electronic part on the mounting board is also disclosed.
US08168520B2	Method of manufacturing semiconductor device A method of manufacturing a semiconductor device according to an embodiment of the present invention forms at least one pair of gate electrodes having end portions opposed to each other across a gap. The method includes forming a gate insulator and a gate electrode layer on a substrate in order, forming a first anti-reflection coating and a first resist on the gate electrode layer in order, exposing and developing the first resist, etching the gate electrode layer, using the first resist or the first anti-reflection coating as a mask, to remove the gate electrode layer from a region for forming the gap, thereby forming a hole penetrating the gate electrode layer, forming a second anti-reflection coating and a second resist on the gate electrode layer where the hole has been formed, in order, exposing and developing the second resist, and etching the gate electrode layer, using the second resist or the second anti-reflection coating as a mask, to form, from the gate electrode layer, the at least one pair of gate electrodes having the end portions opposed to each other across the gap.
US08168519B2	Plasma immersion ion implantation method using a pure or nearly pure silicon seasoning layer on the chamber interior surfaces Plasma immersion ion implantation employing a very high RF bias voltage on an electrostatic chuck to attain a requisite implant depth profile is carried out by first depositing a partially conductive silicon-containing seasoning layer over the interior chamber surfaces prior to wafer introduction.
US08168516B2	Method of fabricating single crystal gallium nitride semiconductor substrate, nitride gallium semiconductor substrate and nitride semiconductor epitaxial substrate A method of fabricating a single crystal gallium nitride substrate the step of cutting an ingot of single crystal gallium nitride along predetermined planes to make one or more single crystal gallium nitride substrates. The ingot of single crystal gallium nitride is grown by vapor phase epitaxy in a direction of a predetermined axis. Each predetermined plane is inclined to the predetermined axis. Each substrate has a mirror polished primary surface. The primary surface has a first area and a second area. The first area is between an edge of the substrate and a line 3 millimeter away from the edge. The first area surrounds the second area. An axis perpendicular to the primary surface forms an off-angle with c-axis of the substrate. The off-angle takes a minimum value at a first position in the first area of the primary surface.
US08168510B2	Method for manufacturing semiconductor layer and semiconductor device An object is that a region separated from a semiconductor substrate when a supporting substrate is larger than the semiconductor substrate does not easily move. A method for manufacturing a semiconductor layer includes the steps of: irradiating a plurality of semiconductor substrates with ions to form embrittlement layers in the plurality of semiconductor substrates; forming bonding layers on respective surfaces of the plurality of semiconductor substrates; placing, over a supporting substrate, the surfaces of the plurality of semiconductor substrates on which the bonding layers are formed; placing a cover including depressed portions which house the plurality of semiconductor substrates over the plurality of semiconductor substrates; and heating the plurality of semiconductor substrates housed in the depressed portions of the cover, and thereby collecting semiconductor layers fixed to the supporting substrate, and regions separated from the plurality of semiconductor substrates along with the embrittlement layers.
US08168507B2	Structure and method of forming enhanced array device isolation for implanted plate EDRAM A method for forming a memory device in a semiconductor on insulator substrate is provided, in which a protective oxide that is present on the sidewalls of the trench protects the first semiconductor layer, i.e., SOI layer, of the semiconductor on insulator substrate during bottle etching of the trench. In one embodiment, the protective oxide reduces back channel effects of the transistors to the memory devices in the trench that are formed in the semiconductor on insulator substrate. In another embodiment, a thermal oxidation process increases the thickness of the buried dielectric layer of a bonded semiconductor on insulator substrate by oxidizing the bonded interface between the buried dielectric layer and at least one semiconductor layers of the semiconductor on insulator substrate. The increased thickness of the buried dielectric layer may reduce back channel effects in devices formed on the substrate having trench memory structures.
US08168504B2	Integrated circuit comprising a gradually doped bipolar transistor and corresponding fabrication process An integrated circuit includes a bipolar transistor comprising a substrate and a collector formed in the substrate. The collector includes a highly doped lateral zone, a very lightly doped central zone and a lightly doped intermediate zone located between the central zone and the lateral zone 4a of the collector. The substrate includes a lightly doped lateral zone and a highly doped central zone. The dopant species in the zone of the substrate are electrically inactive.
US08168492B2	Field effect transistors with vertically oriented gate electrodes and methods for fabricating the same In semiconductor devices, and methods of formation thereof, both planar-type memory devices and vertically oriented thin body devices are formed on a common semiconductor layer. In a memory device, for example, it is desirable to have planar-type transistors in a peripheral region of the device, and vertically oriented thin body transistor devices in a cell region of the device. In this manner, the advantageous characteristics of each type of device can be applied to appropriate functions of the memory device.
US08168489B2	High performance stress-enhanced MOSFETS using Si:C and SiGe epitaxial source/drain and method of manufacture A semiconductor device and method of manufacturing a semiconductor device. The semiconductor device includes channels for a pFET and an nFET. A SiGe layer is selectively grown in the source and drain regions of the pFET channel and a Si:C layer is selectively grown in source and drain regions of the nFET channel. The SiGe and Si:C layer match a lattice network of the underlying Si layer to create a stress component. In one implementation, this causes a compressive component in the pFET channel and a tensile component in the nFET channel.
US08168486B2	Methods for manufacturing enhancement-mode HEMTs with self-aligned field plate Various embodiments of the disclosure include the formation of enhancement-mode (e-mode) gate injection high electron mobility transistors (HEMT). Embodiments can include GaN, AlGaN, and InAlN based HEMTs. Embodiments also can include self-aligned P-type gate and field plate structures. The gates can be self-aligned to the source and drain, which can allow for precise control over the gate-source and gate-drain spacing. Additional embodiments include the addition of a GaN cap structure, an AlGaN buffer layer, AlN, recess etching, and/or using a thin oxidized AlN layer. In manufacturing the HEMTs according to present teachings, selective epitaxial growth (SEG) and epitaxial lateral overgrowth (ELO) can both be utilized to form gates.
US08168483B2	Manufacturing method for light emitting device The present invention provides a vapor deposition method and a vapor deposition system of film formation systems by which EL materials can be used more efficiently and EL materials having superior uniformity with high throughput rate are formed. According to the present invention, inside a film formation chamber, an evaporation source holder in a rectangular shape in which a plurality of containers sealing evaporation material is moved at a certain pitch to a substrate and the evaporation material is vapor deposited on the substrate. Further, a longitudinal direction of an evaporation source holder in a rectangular shape may be oblique to one side of a substrate, while the evaporation source holder is being moved. Furthermore, it is preferable that a movement direction of an evaporation source holder during vapor deposition be different from a scanning direction of a laser beam while a TFT is formed.
US08168476B2	Interconnects for packaged semiconductor devices and methods for manufacturing such devices Packaged semiconductor devices and assemblies including interconnects and methods for forming such interconnects are disclosed herein. One embodiment of a packaged semiconductor assembly includes a die attached to a support layer. A plurality of interconnects are embedded in and project from the support layer, such that the support layer at least partially retains the interconnects in a predetermined array. An encapsulant is molded around each of the interconnects and encases at least a portion of the die, support layer and interconnects.
US08168469B2	Nonvolatile memory device made of resistance material and method of fabricating the same A nonvolatile memory device using a resistance material and a method of fabricating the same are provided. The nonvolatile memory device includes a switching element, and a data storage part electrically connected to the switching element. In the data storage part, a lower electrode is connected to the switching element, and an insulating layer is formed on the lower electrode to a predetermined thickness. The insulating layer has a contact hole exposing the lower electrode. A data storage layer is filled in the contact hole and the data storage layer is formed of transition metal oxide. An upper electrode is formed on the insulating layer and the data storage layer.
US08168464B2	Microelectronic assembly with an embedded waveguide adapter and method for forming the same A microelectronic assembly and a method for forming a microelectronic assembly are provided. A semiconductor substrate (22) is provided. The semiconductor substrate (22) has first and second opposing sides (24, 26) and first and second portions (28, 30). A tuning depression (32) is formed on the second opposing side and the second portion of the semiconductor substrate. A radio frequency conductor (34) is formed on the first opposing side (24) of the first semiconductor substrate. The radio frequency conductor (34) has a first end (46) on the first portion (28) of the first semiconductor substrate (22) and a second end (48) on the second portion (30) of the first semiconductor substrate (22). A microelectronic die (78) having an integrated circuit formed therein is attached to the first opposing side (24) and the first portion (28) of the semiconductor substrate (22) such that the integrated circuit is electrically connected to the first end (46) of the radio frequency conductor (34).
US08168454B2	Vertical light emitting diode and method of manufacturing the same Provided is a vertical LED including an n-electrode; an n-type GaN layer formed under the n-electrode, the n-type GaN layer having a surface coming in contact with the n-electrode, the surface having a Ga+N layer containing a larger amount of Ga than that of N; an active layer formed under the n-type GaN layer; a p-type GaN layer formed under the active layer; a p-electrode formed under the p-type GaN layer; and a structure support layer formed under the p-electrode.
US08168447B2	Multiple component nanoparticles for multiplexed signaling and optical encoding The present invention provides multiple-luminophore silica nanoparticles for multiplexed signaling in bioanalysis. In specific embodiments, two inorganic luminophores, Tris(2,2′-bipyridyl)osmium(II) bis(hexafluorophosphate) (OsBpy) and Tris(2,2′-bipyridyl)dichlororuthenium(II) hexahydrate (RuBpy), or three organic luminophores 5-Fluorescein isothiocyanate (5-FITC), 5-carboxyrhodamine 6G, succinimidyl ester (5-CR6G, SE), 6-carboxy-X-rhodamine, succinimidyl ester (6-ROX, SE) can be simultaneously entrapped inside silica nanoparticles at controlled ratios, with desirable sizes and required surface functionality. Single-wavelength excitation with multiple emission endows the nanoparticles with optical encoding capability for rapid and high-throughput multiplexed detection.
US08168443B2	Instrument for cassette for sample preparation A parallel processing system for processing samples is described. In one embodiment, the parallel processing system includes an instrument interface parallel controller to control a tray motor driving system, a close-loop heater control and detection system, a magnetic particle transfer system, a reagent release system, a reagent pre-mix pumping system and a wash buffer pumping system.
US08168441B2	Sample holder for MALDI mass spectrometric analysis, and mass spectrometric analysis method Used is a sample holder for MALDI mass spectrometry, which has a CuO secondary particle as a laser-beam-absorbing matrix and in which the secondary particle comprises an aggregate of CuO primary particles having an average particle diameter of 100 nm or smaller and has an uneven surface arising from the shape formed by the primary particles constituting the outermost surface of the secondary particle. As the CuO secondary particle, usable is one derived from a CuO powder produced by baking basic copper carbonate in air at 200 to 300° C., and the basic copper carbonate is produced in a process of mixing an aqueous ammonium hydrogencarbonate solution and an aqueous copper nitrate solution. The CuO secondary particle has an average particle diameter of, for example, from 0.3 to 10 μm.
US08168437B2	Quantitative determination of risedronate in urine by SPE-LC-MS-MS The disclosure provides a method for quantitatively determining risedronate in a urine sample by adding an internal standard to the urine sample, applying the urine sample to a polymeric water-wettable reverse-phased sorbent preconditioned with methanol, washing the sorbent with TEA in water and formic acid in methanol, eluting risedronate with a mixture of methanol and water containing EDTA under vacuum, evaporating the eluted solution and reconstituting with a mixture of methanol and NH4OH buffer and analyzing the sample with a LC-MS/MS system.
US08168433B2	Cell culture article and screening A method for producing a cell culture article having a synthetic polymer layer for incubating with cells includes diluting one or more (meth)acrylate monomers in a solvent and dispersing the diluted monomers on a surface of the cell culture article. Some or substantially all of the solvent is removed and the monomers are then polymerized on the surface of the article to form the synthetic polymer layer attached to the surface of the article.
US08168427B2	Monoclonal antibodies against claudin-18 for treatment of cancer The present invention provides antibodies useful as therapeutics for treating and/or preventing diseases associated with cells expressing CLD18, including tumor-related diseases such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer, ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, and cancer of the gallbladder.
US08168426B2	Multiple inducible gene regulation system The present invention relates to the field of biotechnology or genetic engineering. More specifically, the present invention relates to a multiple inducible gene regulation system that functions within cells to simultaneously control the quantitative expression of multiple genes.
US08168423B2	Device for detecting nitrosothiol content in solution A device for detecting nitrosothiol content in a solution includes at least two electrodes disposed in a housing, wherein one of the at least two electrodes is a working electrode having a platinized tip and the other of the at least two electrodes is a counter electrode. A filter membrane is disposed at an end of the housing and is configured to come in contact with the solution. The filter membrane and at least a portion of the working electrode have a material coated thereon. The material includes a polymer and a source of copper dispersed within the material. The material and the platinized tip are configured to come into contact with the solution containing nitrosothiols to convert the nitrosothiols to nitric oxide in order to detect the nitrosothiol content.
US08168420B2	Microorganism capable of microbially decomposing chloro-, methylthio- and methoxy-triazine agrichemicals Disclosed are: a novel microorganism which can decompose a methylthiotriazine compound (particularly, simetryn, dimethametryn, prometryn), a chlorotriazine compound (particularly, simazine, atrazine, propazine) and a methoxytriazine compound (particularly, simeton, atraton, prometon) which have been frequently used as agrichemicals or the like; and a method for decomposing a methylthiotriazine compound, a chlorotriazine compound and/or a methoxytriazine compound by using the microorganism. Specifically disclosed are: a novel bacterium Nocardioides sp. strain MTD22 which is capable of decomposing a methylthiotriazine compound, a chlorotriazine compound and a methoxytriazine compound; and a method for decomposing a methylthiotriazine compound, a chlorotriazine compound and/or a methoxytriazine compound, particularly simetryn, dimethametryn, prometryn, simazine, atrazine, propazine, simeton, atraton and/or prometon, by using the microorganism.
US08168419B2	Prevention and remediation of petroleum reservoir souring and corrosion by treatment with virulent bacteriophage Petroleum reservoir souring, caused by microbially induced production of hydrogen sulfide and other sulfur compounds, and the attendant corrosion are remediated by isolating bacteriophage(s) specific for the problematic bacteria (target bacteria) and adding an effective amount of such bacteriophage(s) to water introduced into or resident in the reservoir to kill at least some of the target bacteria. Suitable virulent bacteriophage(s) may be indigenous to the water, located in surrounding areas, or taken from a known banked stock. Means of concentrating solutions of bacteriophage(s) are also disclosed.
US08168413B2	Luminescent diamond particles A method for preparing luminescent diamond particles (e.g., fluorescent nanodiamonds). The method includes irradiating diamond particles with an ion beam and heating the irradiated diamond particles in a non-oxidizing atmosphere at a temperature between 600 and 1000° C. The diamond particles have a diameter of 1 nm to 1 mm and the ion beam has a kinetic energy of 1 KeV to 900 MeV. Also disclosed are luminescent diamond particles prepared by this method and methods of using them.
US08168410B2	Anti-IGF-IR antibodies and uses thereof The present invention relates to novel antibodies capable of binding specifically to the human insulin-like growth factor I receptor IGF-IR and/or capable of specifically inhibiting the tyrosine kinase activity of said IGF-IR receptor, especially monoclonal antibodies of murine, chimeric and humanized origin, as well as the amino acid and nucleic acid sequences coding for these antibodies. The invention likewise comprises the use of these antibodies as a medicament for the prophylactic and/or therapeutic treatment of cancers overexpressing IGF-IR or any pathology connected with the overexpression of said receptor as well as in processes or kits for diagnosis of illnesses connected with the overexpression of the IGF-IR receptor. The invention finally comprises products and/or compositions comprising such antibodies in combination with anti-EGFR antibodies and/or compounds and/or anti-cancer agents or agents conjugated with toxins and their use for the prevention and/or the treatment of certain cancers.
US08168407B2	Method of synthesizing a suppressor TRNA, DNA construct and use thereof for producing a protein including a non-natural amino acid There are provided a DNA construct comprising non-eukaryote-derived suppressor tRNA gene containing no internal promoter functioning in a eukaryotic cell, and a eukaryote-derived or bacteriophage-derived promoter linked at the 5′ end of the tRNA gene, a method for synthesizing a suppressor tRNA by using the DNA construct, and a process for producing a non-natural amino acid-incorporated protein by using the same.
US08168401B2	Methods of detecting T1R2- and T1R3-expressing cells potentially sensitive to sweet tastants The present invention relates to the discovery that the T1R receptors assemble to form functional taste receptors. Particularly, it has been discovered that co-expression of T1R1 and T1R3 results in a taste receptor that responds to umami taste stimuli, including monosodium glutamate. Also, it has been discovered that co-expression of the T1R2 and T1R3 receptors results in a taste receptor that responds to sweet taste stimuli including naturally occurring and artificial sweeteners.Also the present invention relates to the use of hetero-oligomeric taste receptors comprising T1R1/T1R3 and T1R2/T1R3 in assays to identify compounds that respectively respond to umami taste stimuli and sweet taste stimuli.Further, the invention relates to the constitutive of cell lines that stably or transiently co-express a combination of T1R1 and T1R3; or T1R2 and T1R3; under constitutive or inducible conditions. The use of these cells lines in cell-based assays to identify umami and sweet taste modulatory compounds is also provided, particularly high throughput screening assays that detect receptor activity by use of fluorometric imaging.Finally, the invention relates to the discovery that some compounds, e.g., lactisole, inhibit both the activities of human T1R2/T1R3 and T1R1/T1R3 receptors, and accordingly the sweet and umami taste, suggesting that these receptors may be the only sweet and umami receptors.
US08168400B2	Methods and kits for detection of thromboxane A2 metabolites Methods, compositions and kits are provided for measuring aspirin's anti-thrombotic effectiveness on a subject. Included are a novel assay for quickly and specifically measuring TxA2 metabolite levels in urine and correlating the levels with aspirin dose in a subject. The methods, compositions and kits utilize a novel anti TxA2 metabolite antibody.
US08168395B2	Taste receptors of the T1R family from domestic dog The present invention relates to the discovery of several genes of the domestic dog (Canine familiaris) associated with taste perception. The invention provides, inter alia, the nucleotide sequence of the canine Tas1r1, Tas1r2, and Tas1r3 receptor genes, the amino acid sequences of the polypeptides encoded thereby, and antibodies to the polypeptides. The present invention also relates to methods for screening for compounds that modify the genes' function or activity, the compounds identified by such screens, and mimetics of the identified compounds. The invention further provides methods for modifying the taste preferences, ingestive responses, or general behavior of a mammal such as a dog by administering compounds that affect the function or activity of the gene or the polypeptide encoded thereby.
US08168391B2	Method for modulating insulin production The present invention provides screening methods for the detection of agents that affect various aspects of β-cell biology, particularly insulin gene expression. Screening methods are also provided for detection of agents that affect β-cell differentiation from progenitor cells. Additionally, agents identified using such methods are provided and are useful for increasing insulin gene expression and reducing lipotoxicity.
US08168387B2	Oligonucleotides, use thereof, detecting method and kit for diagnosing the presence of H5 and N1 genes of the Influenza A virus The present invention relates to a double pair of oligonucleotides for amplifying two target sequences located, respectively, in the H5 and N1 genes of the genome of the Influenza A virus, said oligonucleotides being of a length ranging between 10 and 50 nucleotides and comprising at least one fragment of 10 consecutive nucleotides derived from the following sequences: SEQ ID No. 1:TGTATGTTGTGGAATGGCA, SEQ ID No. 2:GCCGAATGATGCCATCAA, SEQ ID No. 3:CGTGGATTGTCTCCGAAA, and SEQ ID No. 4:GGAATGCTCCTGTTATCCTGA or the sequence complementary thereto. The invention also relates to oligonucleotides for detecting amplicons, to the use of all these sequences, and to a method for detecting and a kit for diagnosing the presence of the H5 and N1 genes of the Influenza A virus.The invention is particularly applicable in the field of diagnosis.
US08168381B2	Template directed split and mix systhesis of small molecule libraries The present invention provides a method for combining the advantages of encoded molecule fragments made by split and mix synthesis with the advantages of template directed synthesis of molecules. The method provided in the invention comprises the steps of: Adding a linker molecule L to one or more reaction wells; Adding a molecule fragment to each of said reaction wells; Adding an oligonucleotide identifier to each of said reaction wells; Subjecting said wells to conditions sufficient to allow said molecule fragments and said oligonucleotie identifiers to become attached to said linker molecule, or conditions sufficient for said molecule fragments to bind to other molecule fragments and sufficient for said oligonucleotide identifiers to bind to other oligonucleotide identifiers; Combining the contents of said one or more reaction wells; Optionally, distributing the combined product to one or more new reaction wells; Optionally, repeating steps b) to e) one or more times; Contacting the resulting bifunctional molecule(s) of step e) or g) with one or more Contacting the resulting bifunctional molecule(s) of step e) or g) with one or more (oligonucleotide) templates each capable of hybridizing to at least one of the oligonucleotide identifiers added in step c).
US08168373B2	Method for fabricating 3D microstructure A method for fabricating 3D microstructure is disclosed. A matching fluid is arranged between the mask and the photoresist layer. When the mask and photoresist layer perform the relative scanning and exposure process simultaneously, the matching fluid will reduce the diffraction error, so that the gap between the mask and the photoresist layer becomes more tolerable. Besides, the matching fluid also acts as a lubricant for achieving a smooth scanning process, so as to fabricate a high-precision large-area 3D optical microstructure.
US08168363B2	Toner and producing method thereof, developer, two-component developer, developing device and image forming apparatus A toner is so configured as to satisfy the following conditions: (b)/(a) is from 0.90 to 1.02, (a) is from 140 to 150 and the average value in the entire toner particles of a shape factor SF-2 of the toner particles is larger than 140, where (a) represents a shape factor SF-2 showing the degree of irregularity on the surface of toner particles having a particle size D75V or less which is a particle size at which a cumulative volume from a large particle size side in particle size distribution by volume is 75%, and (b) represents a shape factor SF-2 of toner particles having a particle size D25V or more which is a particle size at which a cumulative volume from a large particle size side in particle size distribution by volume is 25%.
US08168357B2	Polyfluorinated core shell photoconductors A photoconductor that includes a photogenerating layer and a charge transport layer containing a charge transport component, a fluorinated polymer, and a core shell component, and wherein the core is comprised of a metal oxide and the shell is comprised of silica.
US08168352B2	Reflective mask blank for EUV lithography and mask for EUV lithography Provision of an EUV mask whereby an influence of reflected light from a region outside a mask pattern region is suppressed, and an EUV mask blank to be employed for production of such an EUV mask.A reflective mask for EUV lithography (EUVL), comprising a substrate having a mask pattern region and an EUV light-absorbing region located outside the mask pattern region; a reflective layer provided on the mask pattern region of the substrate for reflecting EUV light and having a portion on which an absorber layer is present and a portion on which no absorber layer is present; the portion on which an absorber layer is present and the portion on which no absorber layer is present being arranged so as to constitute a mask pattern; wherein the reflectivity of a surface of the absorber layer for EUV light is from 5 to 15% and the reflectivity of a surface of the EUV light-absorbing region for EUV light is at most 1%.
US08168346B2	Fuel cell stack structure Solid oxide fuel cells each include a circular cell plate holding single cells as a solid oxide fuel cells and having a gas introducing opening and a gas exhausting opening in a central section. A circular separator plate has a gas introducing opening and a gas exhausting opening in a central section. Sealing members allow the gas intruding openings of the cell plate and the separator plate to airtightly communicate with each other and allow the gas exhausting openings of the cell plate and the separator plate to airtightly communicate with each other.
US08168345B2	Device and method for operation of a fuel cell A pressure equalizing system (16) having two variable volume elements which interact with one another via a separating medium which can be deformed or can be moved as a function of the pressure difference, with a constant total volume, is positioned upstream of a fuel cell (11) in order to feed the fuel cell (11) with its raw-material gases (H, O). A pressure equalizing container (19) can be provided for this purpose, which is subdivided into two chambers (17H, 17O) by a separating wall (18) which can be deformed or can be moved as a function of the pressure difference; alternatively, two chambers (17H, 17O) are connected to one another by an equalizing channel (21) with a solid or liquid separating medium which can be moved therein as a function of the pressure difference. If the raw-material gas pressures are different, the separating medium is moved towards the chamber (17) with the lower gas pressure until a pressure equilibrium is achieved as a consequence of the corresponding change in the volume elements on both sides of the separating medium. In the fuel cell (11) which is fed from the chambers (17), its membrane (12), which is susceptible to fracture, therefore no longer has a destruction-critical dynamic pressure difference applied to it, without having to take control measures for this purpose in feed fittings for the raw-material gases.
US08168339B2	Reducing loss of liquid electrolyte from a high temperature polymer-electrolyte membrane fuel cell A method for controlling an amount of a liquid electrolyte in a polymer-electrolyte membrane of a fuel cell is provided. The method comprises enriching one or more of a fuel flow and an air flow with a vapor of the liquid electrolyte, the liquid electrolyte being unreplenishable via an electrochemical reaction of the fuel cell. The method further comprises delivering the vapor of the liquid electrolyte to the fuel cell including the polymer-electrolyte membrane via one or more of the gas-permeable anode and or the gas-permeable cathode. In this manner, loss of liquid electrolyte from the PEM membrane of the fuel cell can be reduced, leading to improved fuel-cell endurance.
US08168335B2	Electrolytic diffusion fuel cell The invention is a new and improved method of generating an electric current in an Electrolytic Fuel Cell. An electric current is produced by the rupture of hydrogen bonds to oxygen atoms of water molecules by hydrolyzation of alkaline metals from the surface of a tape passing through a turbulent moving stream of a diffuse mixture of air and water. The electrons produced by the chemical reaction of dissociation are subsequently attracted to the finned surfaces of an ionic capacitor which is connected in series with an electrolytic capacitor which delivers the current to the load.
US08168320B2	Secondary battery A battery including: a spirally wound electrode body in which a cathode having a cathode active material layer on a strip-shaped cathode current collector and an anode having an anode active material layer on a strip-shaped anode current collector are layered with a separator in between, and spirally wound in a planular state; and a lead joined to the cathode current collector or the anode current collector in a center portion of the spirally wound electrode body. An inner circumferential end of the cathode active material layer is provided in a region where the inner circumferential end does not overlap with the lead in a short axis direction of the spirally wound electrode body.
US08168318B2	Method for high volume manufacturing of thin film batteries Concepts and methods are provided to reduce the cost and complexity of thin film battery (TFB) high volume manufacturing by eliminating and/or minimizing the use of conventional physical (shadow) masks. Laser scribing and other alternative physical maskless patterning techniques meet certain or all of the patterning requirements. In one embodiment, a method of manufacturing thin film batteries comprises providing a substrate, depositing layers corresponding to a thin film battery structure on the substrate, the layers including, in order of deposition, a cathode, an electrolyte and an anode, wherein at least one of the deposited layers is unpatterned by a physical mask during deposition, depositing a protective coating, and scribing the layers and the protective coating. Further, the edges of the layers may be covered by an encapsulation layer. Furthermore, the layers may be deposited on two substrates and then laminated to form the thin film battery.
US08168312B2	Magnetic recording medium and a method of manufacturing the same A magnetic recording medium and a method of manufacturing a magnetic recording medium are provided, in which degradation of wear resistance against a magnetic head and performances of the medium is restrained, and metal dissolving out of the magnetic recording layer and degradation of corrosion resistance due to low coverage of a protective layer are suppressed. The method of manufacturing provides a magnetic recording medium having a convex portion of a magnetic recording layer for recording information and a concave portion without a recording function on a disk substrate. An ALD protective layer is formed on the magnetic recording medium using an ALD method. The magnetic recording medium has a convex portion of a magnetic recording layer for recording information and a concave portion without a recording function on a disk substrate, and has a protective layer formed by an ALD method on the concavo-convex pattern.
US08168309B2	Perpendicular recording media with sublayers of oxide dopant magnetic materials Perpendicular recording media with sublayers of dual oxide dopant magnetic materials are disclosed. The magnetic layer may comprise multiple sublayers of magnetic materials. In each sublayer, dual oxide dopants are incorporated. The compositions of the sublayers can be the same or different depending on the application. The magnetic layer may be deposited using a target comprising a mixture of CoPtCrB and dual oxides as dopants. The layer deposited with such targets can be the entire magnetic layer or a sublayer.
US08168306B2	Weld metal compositions for joining steel structures in the oil and gas industry Provided are metal structures and methods of forming such structures for use in oil, gas and/or petrochemical applications that are joined with non-ferrous weld metal compositions or a high alloy weld metal compositions. The welded metal structures include two or more segments of ferrous or non-ferrous components, and fusion welds, friction stir welds or a combination thereof bonding adjacent segments of the components together, wherein the welds comprise a non-ferrous weld metal composition or a high alloy weld metal composition that is substantially different from the metal composition of the two or more components. The resultant welded structures exhibit improvements in fatigue resistance, toughness, strain capacity, strength, stress corrosion cracking resistance, and hydrogen embrittlement resistance compared to traditional iron-based weld compositions. The structures and methods of forming such structures are advantageous in joining metal components in applications for natural gas transportation and storage, oil and gas well completion and production, and oil and gas refinery and chemical plants.
US08168292B2	Composite materials including amorphous thermoplastic fibers Disclosed are composites that can exhibit low transmission energy loss and can also be temperature resistant. The composites include reinforcement fibers held in a polymeric matrix. The reinforcement fibers can include an amorphous polymer component. The fibers can be woven or knit to form a fabric or can be included in a nonwoven fabric. The composites can include other fibers as well, such as fiberglass. The composites can be multi-layer structures and can include layers of other materials, for instance layers formed of polyaramids, fiberglass, or carbon fiber wovens or nonwovens. The composites can advantageously be utilized in low loss dielectric applications, such as in forming circuit board substrates.
US08168283B2	Highly reflective materials for use as logos and/or identification The present invention is generally directed to tapes or laminates designed for use in conjunction with lighter-than-air vehicles, platforms or other inflated structures. In one embodiment, the present invention is directed to tapes or laminates designed for use in logos and/or identification numbers that can be, for example, used on a lighter-than-air vehicle, platform or other inflated structure. In another embodiment, the present invention is directed to tapes or laminates that include, among other layers, at least one dichroic layer designed to produce a logo, letter and/or number that can be, for example, used on a lighter-than-air vehicle, platform or other inflated.
US08168281B2	Polyurea adhesive A polyurea adhesive composition that is obtainable by reaction of reaction components that include a polyisocyanate comprising isocyanurate rings, the polyisocyanate having a functionality equal to or greater than 3, a polyamine having an average molecular weight greater than about 500 dalton and a carboxylic acid. Additionally, the reaction components may comprise an aromatic diamine chain extender. The molar ratio of the isocyanate groups to whole amine and carboxylic acid functions of the reaction components is between 1.5 and 3.5. Further provided is an article comprising a component bonded to the article with the polyurea adhesive described above. The bonded faces between the component and the article may be of cross-linked rubber composition. The article may be, for example, a tire, a tread band and/or a patch applied to the tire.
US08168279B2	System and method for forming labels A method of forming a label includes providing a semi-opaque or transparent film, disposing an ink receptive coating on at least one side of the semi-opaque or transparent film, forming an adhesive track on a perimeter of the ink receptive coating, and masking the adhesive track with a release member configured to provide access to the ink receptive coating for image formation.
US08168278B2	Plastic tube for use in automotive air brake systems The invention relates to a multilayered plastic tube for use in automotive airbrake systems comprising an outer layer and an inner layer, and optionally at least one intermediate layer positioned between the inner and outer layer, wherein at least one layer of the inner layer and the optional intermediate layer or layers consists of a thermoplastic polymer composition having a flexural modulus in the range of 1000-2300 MPa and comprising a semicrystalline polyamide and/or polyester polymer having a melting temperature of at least 1800 C., and wherein the outer layer and any other remaining layer consist of a copolyester elastomer composition and/or copolyamide elastomer composition.
US08168277B2	High barrier laminated body A laminated body having a thermoplastic resin layer (I) and a polyamide resin layer (II) which is made of nylon 11 and/or nylon 12. The thermoplastic resin layer (I) includes 100 parts by weight of a polyamide resin composition (A) and 0.1 to 10 parts by weight of a carbodiimide compound (B) having two or more carbodiimide groups. The polyamide resin composition (A) contains a polyamide resin (a-1) having diamine units 70 mol % or more of which are derived from m-xylylenediamine and dicarboxylic acid units 70 mol % or more of which are derived from a C4 to C20 α,ω-linear aliphatic dicarboxylic acid and a nylon 12 and/or nylon 11 component (a-2) in an amount of 5 to 95% by weight of the component (a-1) and 95 to 5% by weight of the component (a-2) each based on a total weight of the components (a-1) and (a-2). The laminated body is excellent in the barrier property, peeling resistance and mechanical properties such as strength, impact resistance and elongation, particularly in the barrier property to alcohol-containing fuels.
US08168268B2	Thin film deposition via a spatially-coordinated and time-synchronized process A deposition system and process for the formation of thin film materials. In one embodiment, the process includes forming an initial plasma from a first material stream and allowing the plasma to evolve in space and/or time to extinguish species that are detrimental to the quality of the thin film material. After the initial plasma evolves to an optimum state, a second material stream is injected into the deposition chamber to form a composite plasma that contains a distribution of species more conducive to formation of a high quality thin film material. The deposition system includes a deposition chamber having a plurality of delivery points for injecting two or more streams (source materials or carrier gases) into a plasma region. The delivery points are staggered in space to permit an upstream plasma formed from a first material stream deposition source material to evolve before combining a downstream material stream with the plasma. Injection of different material streams is also synchronized in time. The net effect of spatial coordination and time synchronization of material streams is a plasma whose distribution of species is optimized for the deposition of a thin film photovoltaic material at high deposition rates. Delivery devices include nozzles and remote plasma sources.
US08168265B2	Method for manufacturing electrochromic devices This invention contemplates the use of laser patterning/scribing in electrochromic device manufacture, anywhere during the manufacturing process as deemed appropriate and necessary for electrochromic device manufacturability, yield and functionality, while integrating the laser scribing so as to ensure the active layers of the device are protected to ensure long term reliability. It is envisaged that the laser is used to pattern the component layers of electrochromic devices by directly removing (ablating) the material of the component layers. The invention includes a manufacturing method for an electrochromic device comprising one or more focused laser patterning steps. To minimize redeposition of laser ablated material and particulate formation on device surfaces a number of approaches may be used: (1) ablated material generated by the focused laser patterning may be removed by vacuum suction and/or application of an inert gas jet in the vicinity of the laser ablation of device material; (2) spatial separation of the edges of layers and patterning of lower layers prior to deposition of upper layers; and (3) the laser patterning step may be performed by a laser beam focused directly on the deposited layers from above, by a laser beam directed through the transparent substrate, or by a combination of both.
US08168264B2	Hydrophobic coating compositions, articles coated with said compositions, and processes for manufacturing same Methods of forming a surface coating are provided. A first component can be applied to a surface and can include at least one adhesion promoter compound. The adhesion promoter compound can include (i) a furfuryl ring structure, (ii) a polymerizable reactive group, and (iii) an alkyloxy moiety linking the furfuryl ring structure to the polymerizable reactive group. A second component can be applied to the surface after the first component is applied to the surface, and the second component can include at least one fluorinated component including from about one to about 100 carbon atoms. The polymerizable reactive group can be polymerized to form a coating on the surface and the first component can improve adhesion of the second component to the surface.
US08168253B2	Method of manufacturing piezoelectric actuator and method of manufacturing liquid transporting apparatus A recess is formed on an upper surface of a vibration plate at a position corresponding to a pressure chamber. Next, a low-elasticity material having a lower modulus of elasticity than the vibration plate is filled in the recess. Then, aerosol including a piezoelectric material particles and carrier gas is sprayed on the upper surface of the vibration plate to form a piezoelectric layer. At this time, the particles of the piezoelectric material do not adhere to a surface of the low-elasticity material filled in the recess, and hence the piezoelectric layer can be formed only in an area excluding the surface of the low-elasticity material. Thus, there is provided a method of manufacturing a piezoelectric actuator, the method capable of easily preventing, when forming the piezoelectric layer by an aerosol deposition method, formation of the piezoelectric layer on a surface of the recess.
US08168248B2	Food intermediate having sequestered phytosteryl esters in a polysaccharide matrix The present invention is related to a novel food intermediate containing a phytosteryl esters complex and the method used to create the food intermediate. The food product provides beneficial hypocholesterolemic activity through increased cholesterol-uptake inhibition while simultaneously delivering a food product that is not adversely affected by its inclusion, either in taste or texture or in any undesirable side effects.
US08168243B1	Coffee press grounds remover apparatus A coffee press grounds removal apparatus for removing coffee grounds or tea leaves from a coffee press machine is provided. The coffee press machine has a plunger apparatus for pressing the coffee grounds or tea leaves within a carafe. The apparatus comprises a basket receivable within the carafe with the basket having an open top, a bottom wall, and a side wall extending in a generally upward direction from the bottom wall toward the open top. A handle is pivotally connected to the basket wherein the basket is completely receivable within the carafe. The basket comprises a configuration substantially mirroring the interior circumference and shape of the carafe in which the basket is seatable wherein as the basket is inserted into the carafe, the basket slidably engages the interior circumference of the carafe such that an outer surface of the side wall of the basket contacts the interior circumference of the carafe. The entire bottom wall contacts a bottom surface within the carafe with the bottom wall sandwiched between the coffee grounds or tea leaves and the bottom surface and the plunger apparatus pressable against the coffee grounds or tea leaves.
US08168229B2	Methods for making a multicomponent hemostatic dressing A method of making a pliable, bioabsorbable hemostatic dressing wherein the dressing is composed of fibers with at least one molecular-scale coating, which upon first contact with blood and due to a large area of contact with blood per unit weight of active ingredients, initiates and accelerates the biochemical blood clotting cascade processes. The steps of the method include dissolving in an organic solvent one or more soluble bioabsorbable polymers and organic or aqueous-organic media of non-protein constituents to create a homogeneous mixture; forming fibers from the homogeneous mixture; adding to the fibers a molecular-scale first coating of one or more proteins of blood clotting species that minimally react with each other; and optionally adding a second coating of one or more proteins of blood clotting species to the fibers that minimally react with each other and that, together with the one or more proteins of blood clotting species in the molecular-scale first coating, induce blood coagulation in the presence of blood. The fibers may optionally have occluded in them or at their surface other chemicals of abiological or biological origin that aid in the blood clotting process.
US08168219B2	Synergistic binder composition, method for making same, and tablets of an active and said binder having advantageous hardness and friability Tablets of a pharmaceutical, nutritional or vitamin active compound or composition, e.g. a poorly compressible drug are made by direct compression using a synergistic binder composition of co-processed (a) copolymer of vinylpyrrolidone (VP) and vinyl acetate (VA) and (b) microcrystalline cellulose (MCC), in a wt. ratio of (a):(b) of 1-30:99-70, which is spray dried to provide a readily compressible excipient binder powder for such active. The tablets obtained herein have advantageous hardness and friability at an acceptable compression force.
US08168216B2	Treatment of triple receptor negative breast cancer The present invention relates to the use of a liposomal preparation for the manufacture of a pharmaceutical composition and the use of such a composition for the treatment of ‘triple receptor negative’ breast cancer.
US08168213B2	Medical devices having coating with improved adhesion According to an aspect of the present invention, a medical device is provided which comprises a metallic substrate and polymeric region disposed over and in contact with the metallic substrate. The polymeric region comprises (a) a block copolymer that comprises (i) a hard polymer block that comprises a high Tg monomer and (ii) a soft polymer block that comprises a low Tg monomer, (b) an adhesion promoting copolymer that comprises (i) a first monomer that covalently or non-covalently bonds with the metallic substrate and (ii) a second monomer that is compatible with the low Tg monomer and/or the high Tg monomer and (c) a therapeutic agent. The polymeric region may further comprise an optional polymer that is used to tailor the release rate of the therapeutic agent.
US08168205B2	Streptococcus pneumoniae polypeptides The present invention provides polynucleotide sequences of the genome of Streptococcus pneumoniae, polypeptide sequences encoded by the polynucleotide sequences, corresponding polynucleotides and polypeptides, vectors and hosts comprising the polynucleotides, and assays and other uses thereof. The present invention further provides polynucleotide and polypeptide sequence information stored on computer readable media, and computer-based systems and methods which facilitate its use.
US08168202B2	Hexavalent bovine rotavirus reassortant composition designed for use in developing countries The present invention provides vaccine compositions for protection against human rotaviral disease designed for use in particular areas of the world. Human× bovine reassortant rotavirus comprising each of the four clinically most important VP7 serotypes of human rotavirus are combined with other VP7 serotypes typically found in the area of interest into a multivalent formulation which provides a high degree of infectivity and immunogenicity. Methods and an administration protocol for producing an immunogenic response without producing an increased risk of intussusception are also provided.
US08168201B2	Vaccines The present invention relates to compositions for inducing immune responses, including an antigen and a promiscuous T-cell epitope. Also provided are methods of inducing immune responses in hosts, comprising administering compositions comprising antigens and promiscuous T-cell epitopes to the host.
US08168200B2	Vaccine against african horse sickness virus The present invention provides vectors that contain and express in vivo the genes encoding VP2 and VP5 of African Horse Sickness Virus or an epitope thereof that elicits an immune response in a horse against African horse sickness virus, compositions comprising said vectors, methods of vaccination against African horse sickness virus, and kits for use with such methods and compositions.
US08168196B2	Grifola frondosa-derived substance having anti-influenza virus activity and method for producing the same This invention is intended to discover a fraction having strong anti-influenza virus activity via Mφ activation in the Grifola frondosa extract or an active substance distributed therein to develop a simple and effective production method and to use such fraction for food and beverage products, pharmaceutical products, feeds or feed additives, and the like. This is realized by treatment of maitake mushrooms with a molecular sieve apparatus, such as an ultrafiltration apparatus or gel filtration apparatus, to isolate glycoprotein-containing fractions or sugar-protein complex-containing fractions having molecular weights of 30,000 to 100,000, so as to minimize the influence on substances having strong anti-influenza virus activity and contaminants.
US08168186B2	Therapeutic using a bispecific antibody Multivalent, multispecific molecules having at least one specificity for a pathogen and at least one specificity for the HLA class II invariant chain (Ii) are administered to induce clearance of the pathogen. In addition to pathogens, clearance of therapeutic or diagnostic agents, autoantibodies, anti-graft antibodies, and other undesirable compounds may be induced using the multivalent, multispecific molecules.
US08168185B2	Process for the purification of anti CD-25 antibodies The invention relates to a process for the purification of an Fc-containing protein based on cation exchange chromatography.
US08168181B2	Methods of impairing osteoclast differentiation using antibodies that bind siglec-15 This invention relates, in part, to unique and newly identified genetic polynucleotides involved in the process of bone remodeling; variants and derivatives of the polynucleotides and corresponding polypeptides; uses of the polynucleotides, polypeptides, variants and derivatives; and methods and compositions for the amelioration of symptoms caused by bone remodeling disorders. Disclosed in particular are, the isolation and identification of polynucleotides, polypeptides, variants and derivatives involved in osteoclast activity, validation of the identified polynucleotides for their potential as therapeutic targets and use of the polynucleotides, polypeptides, variants and derivatives for the amelioration of disease states and research purposes.
US08168170B2	Compositions having an inner core and at least three surrounding layers Disclosed are compositions comprising an inner core and at least two surrounding layers. The compositions are suitable for use in humans and other mammals, particularly wherein a component of the inner core is susceptible to moisture. The compositions comprise an inner core comprising one or more components; an inner layer which surrounds the inner core, wherein the inner layer is selected from continuous coatings insoluble at a pH of about 3 or less, continuous coatings having a coating weight of from about 3 mg/cm2, and combinations thereof; and an outer layer which surrounds the inner layer, wherein the outer layer is hydrophobic.
US08168163B2	[(4E, 4Z)-5-methoxy-3-methyl-4-pentenyl]-benzene and its use in perfume compositions The present invention is directed to a novel compound, [(4E,4Z)-5-methoxy-3-methyl-4-pentenyl]-benzene, and a method of improving, enhancing or modifying a fragrance formulation through the addition of an olfactory acceptable amount of this novel compound.
US08168156B2	Method of fabricating layered nanomaterial used for mid-high temperature CO2 capture A material is fabricated for capturing CO2 at mid-high temperature. The material is a layered material containing Ca, Al carbonates. A higher ratio of Ca to Al helps capturing CO2. The temperature for capturing CO2 is around 600° C. The material can even release CO2 at a high temperature. Thus, the material can process looping cycles of carbonation and decarbonization at a CO2 carbonation scale of 45% gCO2/g.
US08168154B2	Start-up method for producing chlorine A start-up method of a process for producing chlorine from hydrogen chloride has a mixed gas producing step of producing a mixed gas containing chlorine from hydrogen chloride, a compressed mixed gas producing step of introducing the mixed gas into an inlet of a compressor and compressing the mixed gas in compressor, a purifying step of introducing the compressed mixed gas into a purifying column and separating the compressed mixed gas into purified chlorine and impurities by distillation, and a recompressing step of introducing the purified chlorine into an inlet of the compressor and compressing the mixed gas and the purified chlorine.
US08168152B2	Method for producing trichlorosilane and method for utilizing trichlorosilane The present invention relates to a method for producing trichlorosilane. In this method for producing trichlorosilane, first, silicon tetrachloride and hydrogen are subjected to a conversion reaction at a temperature of equal to or higher than 1000° C. and equal to or lower than 1900° C., to produce a reaction gas containing trichlorosilane, dichlorosilylene, hydrogen chloride and high-order silane compounds, and then the reaction gas discharged from the conversion furnace is cooled to 600° C. or higher within 0.01 seconds from the initiation of cooling and to 500° C. or lower within 2 seconds. Subsequently, the reaction gas is maintained in a temperature range of equal to or higher than 500° C. and equal to or lower than 950° C. for a time period of equal to or longer than 0.01 seconds and equal to or shorter than 5 seconds. The reaction gas is further cooled to below 500° C.
US08168148B2	Flue-gas purification and reclamation system and method thereof A flue-gas purification system includes a flue-gas cycling system, a reactor, an absorbent adding system having at least a catalytic absorbent, wherein the catalytic absorbent is being gasified for reacting with the flue-gas in the reactor in a homogenous gas-gas phase reacting manner. Therefore, the purification system has fast reaction rate between the pollutants of the flue-gas and the catalytic absorbent, which is preferably ammonia, to efficiently remove pollutants, so as to effectively purify the flue-gas.
US08168145B2	Porous titanium oxide and process for producing the same The present invention provides a porous titanium oxide having improved ultraviolet protection ability, usability, and transparency in the visible region and a process for producing thereof. The porous titanium oxide powder according to the present invention can be obtained by adding an alkali to a titanium salt solution containing a polyalcohol and then thermally hydrolyzing the solution. In addition, it is possible that after the addition of the alkali, an acid is further added to the solution and then the thermal hydrolysis is conducted, or that after thermal hydrolysis, further heat treatment with an acid is conducted. A porous titanium oxide has a mean particle size of 0.01 to 1.0 μm and a specific surface area of 50 m2/g or more.
US08168140B2	Microfluidic apparatuses with nanochannels In some embodiments of the present invention, the buried silicon oxide technology is employed in the fabrication of fluid channels, particularly nanochannels. For example, a fluid channel can be made in a buried silicon oxide layer by etching the buried oxide layer with a method that selectively removes silicon oxide but not silicon. Thus, one dimension of the resulting fluid channel is limited by the thickness of the buried oxide layer. It is possible to manufacture a very thin buried oxide layer with great precision, thus a nanochannel can be fabricated in a controlled manner. Moreover, in addition to buried oxide, any pairs of substances with a high etch ratio with respect to each other can be used in the same way. Further provided are the fluid channels, apparatuses, devices and systems comprising the fluid channels, and uses thereof.
US08168139B2	Recirculating fluidic network and methods for using the same The present invention provides a variety of microfluidic devices and methods for conducting assays and syntheses. The devices include a solid substrate layer having a surface that is capable of attaching ligand and or anti-ligand, and an elastomeric layer attached to said surface. Preferred embodiments have deflectable membrane valves and pumps, for example, rotary pumps associated therewith.
US08168135B2	Reaction container plate and its reaction processing equipment Intrusion of foreign matters from the outside of a reaction container plate and environmental contamination onto the outside are prevented. The reaction container plate (1) comprises a container base (3) having a reaction container (5), a channel base (11) having an introduction hole (11b) above the reaction container (5) and arranged on the surface of the container base (3), and a channel cover (13) arranged on the channel base (11) in order to form in cooperation with the surface of the channel base, an introduction channel (15) passing above the introduction hole (11b). The channel (13) is formed to be enclosed. The introduction hole (11b) does not allow liquid to pass under an introduction pressure state in the channel (15) where the liquid is introduced into the channel (15) but allows the liquid in the channel (15) to pass to the reaction container (5) side under a pressurized state where the inside of the channel (15) is pressurized higher than the introduction pressure. The channel cover (13) is composed of a flexible member, and, when it is urged to the channel base (11) side after the liquid is introduced into the channel (15), the inside of the channel (15) is brought into a pressurized state and the liquid is passed through the introduction hole (11b) and injected into the reaction container (5).
US08168134B2	Biological analysis systems, devices and methods A device for performing biological sample reactions comprising a plurality of flow cells each with at least one port for receiving reaction fluids delivered to a chamber of each flow cell and a manifold configured to receive the plurality of flow cells, wherein the manifold is configured to receive at least one reaction fluid, and wherein each flow cell is configured with a sample holder wherein the sample holder contains biological sample.
US08168128B2	Plasma reactor A plasma reactor (10) comprises a microwave resonant cavity (12) having a gas inlet (18) and a gas outlet (20), a waveguide (14) for conveying microwave radiation to the resonant cavity, and a plasma torch (40) for injecting into the resonant cavity a plasma stream containing ions for reacting with a gas flowing from the gas inlet (18) to the gas outlet (20).
US08168127B2	Honeycomb structure, exhaust gas purifying apparatus and method for manufacturing honeycomb structure A honeycomb structure includes a honeycomb block which includes at least one honeycomb fired body having a first end face side and a second end face side in a longitudinal direction of the honeycomb fired body. The honeycomb fired body includes a plurality of cell walls extending along the longitudinal direction to define cells. Either one of first and second end portions in the longitudinal direction of each of the cells is sealed. The first end portion provided on the first end face side of the at least one honeycomb fired body is sealed with a first plug which is made from a plug material paste and fired. The second end portion provided on the second end face side of the at least one honeycomb fired body is sealed with a second plug which is made from a plug material paste and unfired.
US08168123B2	Fluidized bed reactor for production of high purity silicon Methods and apparatus for the production of high purity silicon including a fluidized bed reactor with one or more protective layers deposited on an inside surface of the fluidized bed reactor. The protective layer may be resistant to corrosion by fluidizing gases and silicon-bearing gases.
US08168119B1	Anti-microbial system for input terminal A method and apparatus disinfecting a computer keyboard includes a metal ion treatment applied to the computer keyboard and other user input devices. A further measure taken is the installation of a shutoff mechanism in the link connecting the computer keyboard to the computer system to open the data connections between the keyboard and host system. Another measure is the periodic and reiterated wipedown of the keyboard and ancillary input devices with an antiseptic wipe. The shutoff mechanism is turned off before the wipedown procedure is carried out, to prevent any incidental keyboard entries made during the wipedown process from being transmitted to the host system.
US08168118B2	Powder metallurgy sputtering targets and methods of producing same A method of forming a sputtering target and other metal articles having controlled oxygen and nitrogen content levels and the articles so formed are described. The method includes surface-nitriding a deoxidized metal powder and further includes consolidating the powder by a powder metallurgy technique. Preferred metal powders include, but are not limited to, valve metals, including tantalum, niobium, and alloys thereof.
US08168112B2	Blown films and processes of forming the same Blown films and processes of forming the same are described herein. The processes generally include providing a bimodal ethylene based polymer, blending the bimodal ethylene based polymer with at least about 30 ppm peroxide to form modified polyethylene and forming the modified polyethylene into a blown film.
US08168110B2	Method for producing a deep-drawn film part from a thermoplastic material Process for the production of an at least partly printed, metallized and/or otherwise coated thermoformed film part with at least the following process steps: a flat film piece which is at least partly printed, metallized and/or otherwise coated on one or on both surface(s) and is made of at least one thermoplastic, and which includes at least one film section which corresponds to the thermoformed part to be produced with respect to size and printing, metallizing and/or coating is provided; this film piece is mounted in a defined arrangement on a frame, only the edge sections of the film piece lying on the frame; the film piece lying on the frame in this way is introduced into a heating zone, and at least the film section is heated there to a given temperature; and the film piece heated in this way is introduced rapidly into a forming zone and is charged there immediately and directly with a fluid pressure means under a pressure means pressure of greater than 20 bar and is formed isostatically to give the desired thermoformed part within a period of time of less than 5 sec. characterized in that such a heating is carried out so that at least one side of the entire film section or of the predominant part of the film section has a film surface temperature in the range of from 10 to 65° C. above the Vicat softening temperature B/50.
US08168107B2	Method of forming a pattern using nano imprinting and method of manufacturing a mold to form such a pattern Example embodiments relate to a method of forming a three-dimensional micro pattern or a multi-step pattern using a nano imprinting process and a method of manufacturing a mold to form such a pattern. A molding polymer may be patterned in a one-step shape on a substrate having UV barrier patterns, thereby easing the manufacture of a mold for multi-step imprinting and simplifying the formation of a multi-step pattern using the one-step shaped mold by avoiding the repetition of more complicated processes. Consequently, it may be possible to form a relatively large-area micro pattern, a relatively large-area pattern usable in flat panel displays, and a nano pattern having a size of several tens of nanometers in a semiconductor process, thereby contributing to the reduction of process costs, the reduction of process time, and the improvement of production yield.
US08168104B2	In-line process for preparing wood plastic composite panel with the appearance and texture similar to natural lumbers and apparatus therefor Disclosed herein are a method of manufacturing a wood plastic composite panel, including a panel manufacturing process of extruding and cooling a resin complex, such that wood fiber is uniformly dispersed into a synthetic resin matrix, to manufacture the resin complex into the form of a panel, an embossing process of forming a wood pattern corresponding to the cut-open surface of a natural lumber on the surface of the panel to a predetermined depth, and a brushing process of removing some of a synthetic resin layer from the surface of the panel to form linear micro concavo-convex parts to a predetermined depth, and an apparatus for manufacturing a wood plastic composite panel that is capable of efficiently performing the same. The method of manufacturing a wood plastic composite panel according to the present invention has the effect of directly realizing a wood pattern, which has the appearance and the texture similar to the open-cut surface of a natural lumber, on the surface of the wood plastic composite panel, and, at the same time, maximizing the advantage of the material comprising the wood fiber and the synthetic resin.
US08168100B2	Molten resin supply method, molten resin supply device, molten resin compression molding method, molten resin compression molding device, and synthetic resin container manufacturing method Each of supply means 30 arranged around an extrusion port 22 of an extruder 20 supplies, while cutting a molten resin which has been extruded from the extrusion port 22 of the extruder 20 alternately in a predetermined length, the molten resin D which has been cut to a supply position which is provided at each of the supply means, and then sequentially supplies the molten resin D to each of a compression molding dies 40 which are provided in a pair with each of the supply means. As a result, in producing a synthetic resin molded article with a predetermined shape by compression molding by cutting a molten resin which has been extruded from an extruder and supplying the resin which has been cut to a compression molding die, the above-mentioned constitution can be preferably utilized for the production of a synthetic resin molded product which requires a further high load. In addition, by this constitution, not only a molten resin can be supplied to a compression molding die with a sufficient accuracy, but also the positional accuracy of the supplied molten resin is prevented from being impaired after the resin is supplied to the compression molding die.
US08168096B2	Process for producing polystyrene foam particles having a high density A process for producing polystyrene foam particles having a bulk density in the range from 40 to 400 g/l by extrusion of a polystyrene melt comprising carbon dioxide and/or water as blowing agent through a nozzle and underwater pelletization, wherein the underwater pelletization is carried out at a pressure in the range 1-30 bar.
US08168088B2	Electrically conductive compositions/shaped articles comprising polyamide matrices Polyamide matrix-based compositions containing electrically conductive fillers are molded into plastic shaped articles, e.g., automotive body parts, which are improvedly painted by electrostatic deposition processing.
US08168085B2	White light phosphors for fluorescent lighting Materials suitable for use in highly energy-efficient production of white light through photo-luminescence, such as in light emitting devices, are generally provided. A composition comprising a compound having the formula: Sr3-vAvMO4-xF1-ywherein A is Ca, Ba, or a mixture thereof; M is Al, Ga, In, W, Mo, or a mixture thereof; 0≦v≦1; 0
US08168079B2	Solid oxygen scavenger composition and process for producing the same A molded oxygen absorbent composition and a process of producing the molded oxygen absorbent composition are disclosed. The molded oxygen absorbent composition is composed of a molded product of an oxygen absorbent composition which contains an oxygen absorbing substance, water or moisture, and a swelling component capable of being swelled with water or moisture. The product is formed by pressure molding the composition. The molded oxygen absorbent composition is reduced in its size and excellent in oxygen absorbing property.
US08168070B2	Method for removing chromium from water using ion exchange resins including interpenetrating polymer networks The invention includes ion exchange resins and their use in the removal of chromium from water. In one embodiment, the invention comprises a method for removing chromium from a water source by contacting the water with an ion exchange resin, wherein the ion exchange resin comprises particles of a crosslinked copolymer comprising: an interpenetrating polymer network (IPN) of at least two polymer components each having a styrenic content greater than 50 molar percent, and a quaternary ammonium functionality.
US08168069B2	Enrichment process for a PGM-metals containing stream The invention provides an enrichment process for a PGM-group metals containing stream, said process including the steps of contacting activated carbon particles with a PGM-rich stream by contacting the stream with a batch of the particles on a continuous basis, whereby at least some of the PGM-group metals are adsorbed from the stream onto active surface sites of the activated carbon and a PGM-metals depleted stream passes out of contact with the activated carbon batch, thereafter stripping the PGM-group metals from the activated carbon batch by means of a concentrated HCl solution as stripping agent, wherein the stripping agent is contacted with the activated carbon batch on a continuous flow basis and the PGM-group metals loaded stripping agent is removed from contact with the activated carbon from which the PGM-group metals have been stripped, and then regenerating the activated carbon batch by washing with water and, if necessary, reactivating the carbon particles.
US08168067B2	Process for incorporating a dry treatment product into a liquid waste A process for treating and disposing a liquid waste, which is solidified prior to disposal, includes steps of adding to said liquid waste a dry treatment product generally comprising approximately 25% to 75% bentonite clay and respectively 75% to 25% of a liquid-sorbing polymer, subjecting the liquid waste to a single pass high shear mix so as to incorporate the treatment product into the liquid waste with increased dispersion and reduced agglomeration, subjecting the treated liquid waste to a retention time suitable for solidification, and disposing of the solidified liquid waste. The liquid waste preferably is recirculated prior to addition of dry treatment product so as to permit a calibration of the characteristics of the liquid waste, and subsequent determination of the correct rate of dry treatment addition.
US08168064B2	Step flange catch basin adaptor and method of using A method of mounting a grate adapter unit beneath a stormwater collection grate includes steps of providing a grate adapter unit having a plurality of outwardly extending mounting flanges, each mounting flange being adapted to fit a different size commercially common stormwater collection grate. The grate adapter unit is trimmed, either at the factory, at the contractor's facilities or at the installation site, at the desired location to select a desired one of the mounting flanges that is appropriate for the collection grate to which the grate adapter is being fit. The grate adapter unit is then mounted beneath the stormwater collection grate using the selected mounting flange. A stormwater remediation unit may be pre-mounted to a lower end of the grate adapter unit or mounted to the lower end after installation.
US08168058B2	Method for manufacturing a lithium phosphate thin film An electrochemical method for manufacturing a lithium phosphate (Li3PO4) thin film includes preparing an electroplating solution and forming the lithium phosphate thin film on a conductive substrate under suitable conditions. The electroplating bath includes about 10−2 M to about 10−1 M lithium ion and about 10−2 M to about 1 M monohydrogen phosphate ion (HPO42−) or dihydrogen phosphate ion (H2PO4−).
US08168057B2	Balancing pressure to improve a fluid seal A method of fluid sealing a workpiece is provided. The method includes providing a force to cause a ring to form a barrier to fluid entry with the workpiece and preventing fluid from crossing the barrier to fluid entry by forming a pressure differential across the barrier.
US08168055B2	Arrangement of ion exchange material within an electrodeionization apparatus An electrodeionization apparatus is provided comprising an ion-concentrating compartment partially bounded by an anion permeable membrane and also partially bounded by a cation permeable membrane, and a first ion exchange material domain disposed within the ion-concentrating compartment, wherein the first ion exchange material domain is contiguous with at least a portion of an ion-concentrating compartment side surface of one of the anion permeable membrane and the cation permeable membrane, and is spaced apart from the other one of the one of the anion permeable membrane and the cation permeable membrane. In the case where the one of the anion permeable membrane and the cation permeable membrane, having the at least a portion of an ion-concentrating compartment side surface with which the first ion exchange material domain is contiguous, is an anion permeable membrane, the first ion exchange material domain is an anion exchange material predominant domain. In the case where the one of the anion permeable membrane and the cation permeable membrane, having the at least a portion of an ion-concentrating compartment side surface with which the first ion exchange material domain is contiguous, is a cation permeable membrane, the first ion exchange material domain is a cation exchange material predominant domain.
US08168054B2	Gas sensing element with increased response A gas sensing element is disclosed as having a measuring gas chamber to which measuring gases are admitted, a diffusion resistance portion for introducing measuring gases to the measuring gas chamber under diffusion resistance, a sensor cell for detecting a specified gas concentration of measuring gases, and an oxygen pump cell for adjusting an oxygen concentration in the measuring gases. The sensor cell includes a measuring electrode, placed facing the measuring gas chamber, and a reference electrode formed in pair with the measuring electrode. The oxygen pump cell includes an inner pump electrode placed facing the measuring gas chamber, and an outer pump electrode formed in pair with the inner pump electrode. The diffusion resistance portion is placed in an area inside of external end walls of the inner pump electrode to be exposed to the measuring gas chamber.
US08168053B2	Gas sensing member used for gas sensor and method of manufacturing the member A gas sensing member has a unit structure and a porous protective layer disposed on the unit structure. The unit structure has a solid electrolyte body, a gas measurement electrode disposed on a surface of the body and exposed to a measured gas entering at a gas inlet, a reference gas electrode disposed on another surface of the body and exposed to a reference gas, and a heater disposed close to the body. The heater has a heater substrate and heating elements disposed in the heater substrate. The heating elements heat the body. The heater substrate has side corner areas placed on side corners of the unit structure and being adjacent to the heating elements. The protective layer is disposed on the gas inlet such that the side corner areas are not covered with the protective layer and are directly exposed to the measured gas.
US08168051B2	Sensor for determination of glucose A process for the manufacture of small sensors with reproducible surfaces, including electrochemical sensors. One process includes forming channels in the surface of a substrate and disposing a conductive material in the channels to form an electrode. The conductive material can also be formed on the substrate by other impact and non-impact methods. In a preferred embodiment, the method includes cutting the substrate to form a sensor having a connector portion and a transcutaneous portion, the two portions having edges that define one continuous straight line.
US08168049B2	Sputtering apparatus and method of manufacturing solar battery and image display device by using the same A sputtering apparatus of a continuous system that a first target 17a and a second target 17b are arranged to obliquely face a substrate 6 and other targets to form a film while conveying the substrate 6 along a conveying path 15, wherein shields 19a, 19b facing the conveying direction of at least the substrate 6 are provided between the conveying path 15 and the first and second targets 17a, 17b to have therebetween an extended region toward the conveying path 15 in the space between the first target 17a and the second target 17b to enable to obtain a high quality film and to enable to prevent particles from diffusing in a chamber 3.
US08168048B1	Carbon dioxide generation and dispensing device and method of production A CO2 generating and dispensing device having container with a first space for receiving oxalic acid and water, and a second space for receiving a CO2 generator which generator is attached to a lid. The lid secures to the container. Two conductive rods extend above the lid and are attached to the CO2 generator. Electric current is applied to the rods which initiates the CO2 generation. Generated CO2 rises from the second space and out a discharge vent on the lid. An hose attached to the discharge vent direct the CO2 to a pre-determined destination.
US08168046B2	Method and apparatus for treating a component of a gas turbine engine A surface treatment device for applying a surface treatment medium to an article is provided with the surface treatment device having an application member for applying the surface treatment medium to the article and an electrode, which applies an electrical potential between the application member and the article. The device provides localized treatment to the article and can remove oxide layers or the like from metallic materials without removing or damaging the underlying metallic material.
US08168038B2	Processing biomass Biomass (e.g., plant biomass, animal biomass, and municipal waste biomass) is processed to produce useful products, such as fuels. For example, systems are described that can use feedstock materials, such as cellulosic and/or lignocellulosic materials, to produce ethanol and/or butanol, e.g., by fermentation.
US08168033B1	Methods and devices for printing and affixing an individual label onto an item having a machine readable code thereon Methods and systems are disclosed for printing and affixing an individual label onto an item having a machine readable code thereon. The method includes steps of scanning the machine readable code to obtain unique item information from the scanned machine readable code; supplying a label to a printer; sending the unique item information to the printer; printing information to the label using the unique item information; and affixing the printed label onto the item.
US08168030B2	Manufacturing method of laser processed parts and adhesive sheet for laser processing Providing a method of manufacturing a laser processed part capable of processing at high speed and high precision when processing a workpiece by optical absorption ablation of laser beam, effectively suppressing contamination of a workpiece surface by decomposition products, and recovering the workpiece easily after processing. Another object is to present an adhesive sheet for laser processing preferably used in the method of manufacturing a laser processed part.
US08168028B2	Method and apparatus for making article having side seams A method for forming an undergarment comprises providing a web, cutting the web to form a pre-form, the pre-form comprising the first and the second transverse edges and two longitudinal edges, each longitudinal edge having two waist sections and a crotch section located intermediate the waist sections, a sealing area being located adjacent and inboard of each waist section, and transferring the pre-form to a processing wheel. The method further comprises gripping the pre-form adjacent each waist section with the grippers in four gripping areas, each gripping area being located near a respective sealing area, jointly rotating at least the grippers that hold the gripping areas in the region of one of the transverse edges around at least one hinging axis extending substantially parallel to the transverse edges of the pre-form to place the transverse edge generally parallel and opposite to the second transverse edge, superimposing the sealing areas in a contacting relationship, joining the superimposed sealing areas, thus forming the undergarment, and releasing the undergarment from the grippers.
US08168024B2	Elastic composite for a disposable absorbent garment, and a system and process for making the elastic composite and a garment having the elastic composite A method is provided for making an elastic composite for incorporation into a disposable absorbent garment. An elastic element applicator is provided that is configured to move a section of a continuous strand of elastic element generally about a plane. A first web of material is conveyed in a first web moving direction such that the first web intersects the plane. Then, the applicator is operated to move the elastic element about the plane, thereby applying the section of elastic element onto the first web along a direction generally transverse to the web moving direction and such that the first web draws the continuous elastic strand from the elastic element applicator as the first web is conveyed away from the plane. The elastic element applicator may be in the form of a spin cylinder or bracket that is operated to spin the elastic element about the moving first web, thereby applying the elastic element on the first web.
US08168017B2	Bonding silicon silicon carbide to glass ceramics A wafer chuck for use in a lithographic apparatus, which includes a low-thermal expansion glass ceramic substrate, a silicon silicon carbide layer, and a bonding layer comprising silicate having a strength of at least about 5 megapascals, the bonding layer attaching the silicon silicon carbide layer to the substrate is described. Also, a method of forming a wafer chuck for use in a lithographic apparatus, which includes coating a portion of one or both of a low-thermal expansion glass ceramic substrate and a silicon silicon carbide layer with a bonding solution, and contacting the substrate and the silicon silicon carbide layer to bond the substrate and the silicon silicon carbide layer together is described.
US08168012B2	Binary titanium-zirconium alloy for surgical implants and a suitable manufacturing process The present invention relates to a binary single phase titanium-zirconium alloy suitable for the production of surgical implants. The alloy includes a zirconium content of less than 25% but more than 5% by weight, and 0.1% to 0.3% by weight of oxygen as a strength enhancing additive, and not more than 1% by weight of other strength enhancing additives and technical impurities.
US08168010B2	Low alloy steel for oil well pipes having excellent sulfide stress cracking resistance Disclosed is a low alloy steel for oil well pipes which has excellent sulfide stress cracking resistance and is suitable for casing and tubing for oil wells or gas wells. Specifically disclosed is a low alloy steel for oil well pipes containing, in mass %, 0.2-0.35% of C, 0.05-0.5% of Si, 0.05-1.0% of Mn, not more than 0.025% of P, not more than 0.01% of S, 0.005-0.10% of Al, 0.1-1.0% of Cr, 0.5-1.0% of Mo, 0.002-0.05% of Ti, 0.05-0.3% of V, 0.0001-0.005% of B, not more than 0.01% of N, not more than 0.01% of O (oxygen), 0-0.1% of Nb, 0-0.01% of Ca, 0-0.01% of Mg and 0-0.1% of Zr, and having a half-value breadth (H) and a hydrogen diffusion coefficient (D) (10−6 cm2/s) satisfying the following formula (1): 30H+D≦19.5 (1).
US08168009B2	Hard alloys with dry composition “HARD ALLOYS WITH DRY COMPOSITION”, presenting a composition of alloy elements consisting, in mass percentage, of Carbon between 0.5 and 2.0; Chrome between 1.0 and 10.0; Tungsten-equivalent, as given by ratio 2Mo+W, between 7.0 and 14.0; Niobium between 0.5 and 3.5. Niobium can be partially or fully replaced with Vanadium, at a ratio of 2% Niobium to each 1% Vanadium; Vanadium between 0.5 and 3.5. Vanadium can be partially or fully replaced with Niobium, at a ratio of 2% Niobium to each 1% Vanadium; Cobalt lower than 8, the remaining substantially Iron and impurities inevitable to the preparation process. As an option to refine carbides, the steel of the present invention can have content of Nitrogen controlled, below 0.030 and addition of Cerium or other earth elements at content between 0.005 and 0.020. For the same purpose, Silicon and Aluminum can be optionally added, at content between 0.5 and 3.0% for both of them.
US08168002B2	Device for clamping and positioning an evaporator boat The invention relates to a vacuum treatment plant comprising an evaporator (1) for vacuum coating facilities. The evaporator (1) according to the invention comprises a device for guiding a supply line (4) movable in a gripping direction (A) and intended for gripping and positioning an evaporation boat (3) having a base (22) and further comprises two spacers (18, 19) which the movable supply line (4) flexibly connects to the base (22), with the spacers (18, 19) being disposed on one side each with the movable supply line (4) and with the other side on the base (22), thus enabling the first supply line (4) to be forcibly guided, and with the spacers (18, 19) having such a length and configuration between the first supply line (4) and the base (22) that the guidance direction (B) is essentially parallel to the gripping direction (A) at least across a small deflection range of the spacers (18, 19).
US08167978B2	Gas generator and method therefor A gas generator includes a high pressure gas-generation system that is capable of generating a product gas stream at a non-ambient, elevated nominal pressure. A thermal swing absorber has a first configuration and a second configuration relative to being connected with the product gas stream. In the first configuration, the thermal swing absorber is connected with the high pressure gas-generation system to receive the product gas stream and remove a constituent gas from the stream. In the second configuration, the thermal swing absorber is disconnected from the product gas stream and releases the constituent gas at a pressure that is substantially equal to the elevated nominal pressure. In the second configuration, the thermal swing absorber is an input source to provide the released constituent gas into the high pressure gas-generation system, which permits more efficient use of materials within the system.
US08167976B2	Gas separation membrane system and a method of preparing or reconditioning and the use thereof A gas separation membrane system and a method of preparing such gas separation membrane system by providing a porous support upon which is supported a membrane layer comprising a first gas-selective material and having a membrane thickness and removing therefrom a substantial portion of the first gas-selective material from the membrane layer by the use of an ultra-fine abrasive to thereby provide the membrane layer having a reduced membrane thickness. A second gas-selective material is deposited upon the membrane layer having the reduced membrane thickness to provide an overlayer of the second gas-selective material having an overlayer thickness so as to thereby provide the gas separation membrane system having the membrane layer of the reduced membrane thickness and the overlayer of the overlayer thickness.
US08167975B2	Exhaust gas purifying method and apparatus A system is provided that prevents inhibition of adsorption of Hg and other heavy metals by activated carbon or other heavy metal adsorbent due to prior adsorption of sulfur trioxide (SO3) in an exhaust gas containing SO3. As it has been found that while SO3 is adsorbed, the adsorption of SO3 precedes the adsorption of Hg and other heavy metals onto activated carbon, a basic substance injection system is disposed along an exhaust gas flow channel at an upstream side of an activated carbon injection system, thereby attaining effective removal of Hg and other heavy metals from the exhaust gas by adsorption thereof onto surface pores of the activated carbon. The SO3 concentration after removal by basic substance conversion is computed from the SO3 concentration before removal, and the activated carbon injection rate can be controlled based on the concentration after removal.
US08167972B2	Process for producing metal nanoparticle and metal nanoparticle produced by the process The present invention has an object of providing a single-stage production method that enables the production of ultra fine metal nanoparticles and ordered alloy nanoparticles within solution.The production method includes irradiating a solution of a salt or complex of a metal element, thereby decomposing and/or reducing the salt or complex within the solution and generating metal nanoparticles having an average particle size within a range from 0.3 to 100 nm within the solution.
US08167969B2	Snapband filter design for horizontal bottom access collector A horizontal dust collector includes a plurality of elongated filter elements in a horizontally-oriented array, each filter element connected at one end to a tube sheet, and at an opposite end to a support plate. The one end of each filter element is fitted with a substantially rigid coupler having an insertion portion, a peripheral, outwardly facing groove adopted to receive a mating edge defining an aperture in the tube sheet, and a radially outwardly extending flange axially behind the annular groove for engagement with a filter element assembly tool. A tool is also provided to facilitate installation of the filter elements within the dust collector.
US08167953B2	Carpometacarpal (CMC) joint arthroplasty implants and related jigs, medical kits and methods Thumb carpometacarpal (CMC) joint implants include a trapezium implant defining an articulating surface and a cooperating first metacarpal implant with a base portion of the first metacarpal defining an articulating surface. The first metacarpal base articulating-surface is configured to articulate against the trapezium implant articulating surface.
US08167948B2	Anterior prosthetic spinal disc replacement The present invention relates generally to a prosthetic spinal disc for replacing a damaged disc between two vertebrae of a spine. The present invention also relates to a method for implanting a prosthetic spinal disc via anterior or anterior lateral implantation. Other surgical approaches for implanting the prosthetic disc may also be used.
US08167940B2	Aspheric toric intraocular lens An aspheric toric intraocular lens (IOL) having toricity and asphericity in a single lens. The toricity and asphericity may be provided on separate surfaces, such as an anterior surface and a posterior surface, or the toricity and asphericity may be combined onto a single surface. The edge thickness may be varied sinusoidal to maintain equal edge thickness at 45 degree meridian.
US08167932B2	Heart valve delivery system with valve catheter A heart valve delivery system is provided wherein a prosthetic valve is carried on a valve catheter inside a delivery sleeve. A step balloon protrudes from the delivery sleeve and provides a tapered surface for facilitating advancement through a body vessel. The step balloon also aids in crossing the leaflets of a native valve. After the prosthetic valve is positioned within the native valve, the delivery sleeve is retracted to expose the prosthetic valve. In one embodiment, the delivery sleeve is retracted by the use of a lead screw, which effectuates relative movement between the valve catheter and delivery sleeve. The prosthetic valve is preferably self-expandable. If necessary, the step balloon may be expanded to securely seat the prosthetic valve at the site of the native valve. The prosthetic valve is preferably coupled to the valve catheter by a plurality of flexible extension arms which allow the prosthetic valve to be collapsed after initial deployment such that the prosthetic valve may be repositioned if necessary.
US08167926B2	Fenestration for stent graft arrangements and stent graft including the same A fenestration (32) for a stent graft (30). The fenestration is an aperture in the biocompatible graft material and has at least one flap (38, 40) of a biocompatible graft material covering the aperture on the inside whereby the flap closes off the aperture but can be displaced to allow access through the fenestration. An array of such fenestrations may be placed on a stent graft to facilitate alignment of a branch vessel with a fenestration. A slip knot (46, 46) which can be released by forcing a dilator between the flaps can be used to hold the flaps together.
US08167924B2	Therapeutic garment A therapeutic garment includes a brassiere having opposed first and second shoulder straps formed with opposed first and second breast-receiving cups, respectively, each having an outer surface. A reusable gel pack for heat or cold therapy is suspended from the first and second shoulder straps, extends downwardly from the first and second shoulder straps to the first and second breast-receiving cups, and overlies and extends across the outer surfaces of the first and second breast-receiving cups to provide heat or cold therapy to the first and second breast-receiving cups at the outer surface of each of the first and second breast-receiving cups.
US08167922B2	Cooling and warming blanket A cooling and warming blanket includes a blanket, a first channel, and a plurality of air chambers. The blanket includes an upper layer and a lower layer, each of which further includes a cover layer and an inner layer. The inner layers of the upper and lower layers are melted and integrated into one piece by high-frequency sealing to define a liquid inputting area and a liquid outputting area. The first channel is formed between a portion of the liquid inputting and outputting areas for conveying a liquid from the liquid inputting area to the liquid outputting area. The air chambers are formed in the liquid inputting and outputting areas, and a second channel is formed between each two adjacent air chambers. Thus, the liquid in the liquid inputting and outputting areas can be conveyed throughout the liquid inputting and outputting areas via the second channels.
US08167909B2	Connecting element The connecting element (1) has the shape of a rod with longitudinal axis (2), a rear end (6), and a front end (7), and serves to span a number of bone anchoring elements (12) implanted in the bone. The connecting element (1) comprises at least one longitudinal slot (5). This provides it with a greater elasticity during implantation so that it can be reversibly deformed. The connecting element can then be stiffened once it has been fixed in the bone anchoring elements (e.g. pedicle screws).
US08167905B2	Endovascular flexible stapling device The present invention concerns a flexible stapling device (1). More particularly, this invention concerns a flexible endovascular stapling device (1) for an intavascular procedure such as patent foramen ovale closure, which is designed to avoid open heart surgery by permitting the closure of the defect utilizing a stapling means (26) which is positioned by using a flexible shaft/guidewire system.
US08167902B2	Rapid exchange catheters for embolic protection devices Catheter having a first elongate tubular body having a lumen, a second elongate tubular body having a lumen, and an elongate member. The elongate member joins the first and second elongate tubular bodies. The first tubular body is fixedly attached on the distal portion of the elongate member, and the second elongate tubular body is disposed on the elongate member is slidable along a portion of the elongate member. The second elongate tubular body can be in a first position so that the first and second tubular bodies are not adjacent to each other and can be in a second position so that the first and second tubular bodies are adjacent to each other. The catheter may have a locking mechanism that can lock the first and second elongate tubular bodies to each other so that the lumens of the first and second elongate tubular bodies form one continuous lumen.
US08167900B2	Acupuncture device An acupuncture device includes an acupuncture needle which has an elongate grip part with a substantially cylindrical main portion and a needle part which is fixed to the distal end of the grip part such that its longitudinal axis is aligned with the grip part and a guide tube which is open at both ends and whose lumen has a substantially cylindrical main portion and a releasable clamping device, by means of which the acupuncture needle is held in the condition of readiness for use inside the guide tube so that the grip part projects outwardly out of the proximal end of the guide tube while the distal end of the guide tube extends beyond the tip of the needle part. The grip part further has a portion which is thickened in relation to its main portion and the lumen of the guide tube has a narrowed portion which adjoins the proximal end of its main portion and whose smallest inside diameter is smaller than the largest outside diameter of the thickened portion of the grip part and larger than the outside diameter of the cylindrical main portion of the grip part, wherein the clamping device is formed by the thickened portion of the grip part and the narrowed portion of the lumen of the guide tube.
US08167888B2	Tibial spacer blocks and femoral cutting guide The present invention relates to one or more tibial spacer blocks used during knee arthroplasty, each configured to be temporarily positioned upon a resected proximal portion of a tibia (essentially mimicking the tibial component of the knee prosthesis), for performing a range of motion analysis and for checking flexion and extension gaps prior to cutting the distal or posterior femur. Preferably, the spacer blocks each include an attachment arrangement configured and arranged to mate with a complementary attachment arrangement of an alignment tower and/or a femoral cutting guide. The alignment tower, which is configured to be used with an alignment rod, is used for verifying the alignment of the limb's mechanical axis when the spacer block is positioned between the tibia and the femur. The femoral cutting guide is used for guiding a cutting member into proper orientation for resecting a distal or posterior portion of a femur.
US08167887B2	Introducer for inserting a connecting rod into a spine An introducer is provided for inserting a connecting rod into tissue of a spine that comprises an outer sleeve with an actuatable rod attachment portion at a distal end thereof to releasably pivotally attach to a connecting rod, and an elongate inner shaft movable translationally within the outer sleeve. The proximal end of the shaft is coupled to an actuation mechanism for selectively translating the inner shaft. The distal end of the shaft includes a rod engagement surface that is movable y the actuation mechanism to a first position to engage a cooperative engagement surface on the rod to hold the rod in a selected locked orientation, to a second position to space the rod engagement surface from the cooperative engagement surface of the rod to allow pivoting of the rod, and to a third position to release the rod from the outer sleeve.
US08167878B2	Bipolar electrosurgical probe for use with conductive irrigation fluids An electrosurgical probe configured for cutting or coagulating tissue, and an electrosurgical procedure that employs the electrosurgical probe. The probe includes first and second conductors disposed in a sheath, and first and second electrodes electrically insulated from the sheath and protruding from its distal end. The first electrode is electrically connected to the first conductor to define an active pole of a radio frequency circuit, and configured to perform cutting or coagulation of tissue when the radio frequency current flows to the first electrode. The second electrode is electrically connected to the second conductor, and configured to define a focused ground point in close proximity to the active pole defined by the first electrode so as to complete the radio frequency circuit with the first electrode when a conductive fluid surrounds the first and second electrodes and the radio frequency current flows to the first electrode.
US08167877B2	Endoscopic mucosal resection device with overtube and method of use A medical apparatus and method useful for resecting tissue from the gastrointestinal tract are disclosed. The apparatus can include an RF tissue cutting device disposed inward of a side opening in the device. A tissue stop can be used to control the depth of tissue resected, and the tissue stop can include holes for communicating vacuum for drawing tissue into the side opening. The tissue stop can be electrically grounded with respect to the RF tissue cutting device, and the tissue stop can provide one pole of an RF electrical circuit.
US08167876B2	Tracking system using field mapping In some aspects, a method includes (i) causing current to flow among multiple sets of current injecting electrodes to generate a field in an organ, (ii) obtaining the positions of one or more measuring electrodes used for measuring the field generated by the current injecting electrodes, (iii) in response to the current flow, measuring the field at multiple locations in the organ using the one or more measuring electrodes, (iv) modeling the field using the measurements of the field from the one or more measuring electrodes and the positions of the one or more measuring electrodes, and (v) determining expected signal measurements of the field at additional locations within the organ using the model of the field.
US08167874B2	Assembly and kit for marking tubal ostia A method, apparatus, and kit for marking the opening between the fallopian tube and the uterus (tubal ostia) are provided. A marking dye provided in a marking assembly including a fluid dispenser coupled to a catheter having an open end and a guide wire. The catheter is inserted into the uterus and to a position adjacent the tubal ostia. When properly inserted, the fluid dispenser is activated to cause fluid to flow through the catheter and to the wall of the uterus to provide a mark. Once the mark is provided, endometrial ablation process can be provided in the uterus. The marks can then be used to guide the insertion of tubal occlusion devices.
US08167871B2	Device for actively removing a target cell from blood or lymph of a vertebrate subject Devices, systems, and methods are described herein for controlling the level of one or more target cell types in the blood fluid and/or lymph fluid of a vertebrate subject. Devices and systems are provided that include a body defining at least one lumen configured for fluid flow; at least one controllable flow barrier to the at least one lumen; one or more sensor configured to detect one or more target cell types in blood fluid or lymph fluid of a vertebrate subject; at least one treatment region disposed within the at least one lumen; at least one reactive component disposed in the at least one treatment region, the at least one reactive component configured to modulate a physiological effect of the one or more target cell types in the vertebrate subject; and at least one controller in communication with the one or more sensor and in communication with the at least one controllable flow barrier to the at least one lumen; wherein the at least one controller is configured to open or close the at least one controllable flow barrier in response to the one or more sensor.
US08167867B2	Oval-shaped cardiac cannula A method of performing minimally invasive cardiac surgery includes the step of creating an access aperture into a patient's chest cavity, the access aperture being considerably smaller than a traditional cardiac surgery incision. A cannula is provided that has an oval portion with a longer major axis and a shorter minor axis and the cannula is inserted into the chest cavity through the access aperture.
US08167866B2	Drug delivery system for accelerated subcutaneous absorption A method for accelerating subcutaneous absorption of a fluid or drug into the systemic circulation of a specific targeted tissue. A first drug operative to produce local capillary vasodilatation and/or increase the rate of bulk flow of solution through the interstitial space is mixed with a fluid. The fluid may contain a crystalloid solution or a dilute solution of a pharmacologic drug required for a routine or emergency therapeutic treatment for a patient. The first drug is substantially non-toxic to the patient. The fluid mixed with the first drug is then delivered subcutaneously or into deeper tissues of the patient, by use of a hyperdermic needle or infiltration cannula. As the capillaries are dilated, the fluid is efficiently absorbed and circulated systemically.
US08167852B2	Microneedle device and method for producing the same Microneedle device is provided, which include microneedles that can be easily inserted into skin and dissolve or swell in skin. The microneedle devices comprise a substrate and cone-shaped or pyramid-shaped microneedles for skin insertion set on the substrate. The microneedles for skin insertion contain over 50 weight percent of one or multiple biomaterials chosen from chitosan, collagen, gelatin, hyaluronic acid, and they are fabricated from the materials that can dissolve or swell in the body.
US08167844B2	Safety IV needle/cannula introducer An improved safety IV placement device includes a reciprocal tubular needle sheath disposed on the exterior of the syringe body and a latch mechanism engaging the syringe body and the sheath to latch the sheath in a needle-covering position after placement of the IV cannula and removal of the needle from within the cannula. An internal spring, which engages the sheath, expands to move the sheath to cover the needle point prior to placement of the IV cannula and after the needle is removed from the indwelling cannula. The spring is a non-uniform helical spring having multiple 360 turns each turn uniformly spaced from adjacent turns.
US08167843B2	Trocar with retention cannula A trocar comprises a retention cannula comprising an inverted or incised retention pattern disposed thereon. Embodiments of the incised cannula exhibit reduced tissue trauma compared with screw-threaded cannula, improved fixation and/or retention compared with an unthreaded cannula, and good sealing between the cannula and the incision.
US08167839B2	Stretch resistant therapeutic device A vasoocclusive coil is reinforced with a stretch resistant member to improve safety during retraction of the coil. The stretch resistant member is fixedly attached at one end to the vasoocclusive coil, and the other end of the stretch resistant member is detachably mounted to an elongated pusher member to allow for placement and release of the vasoocclusive coil within the patient's vasculature.
US08167838B2	Stretch resistant therapeutic device A vasoocclusive coil is reinforced with a stretch resistant member to improve safety during retraction of the coil. The stretch resistant member is fixedly attached at one end to the vasoocclusive coil, and the other end of the stretch resistant member is detachably mounted to an elongated pusher member to allow for placement and release of the vasoocclusive coil within the patient's vasculature.
US08167830B2	Methods and systems for low frequency mechanical treatment of the prostate Methods and apparatus for treating benign prostatic hyperplasia rely on imparting a low frequency vibration to the prostate. A treatment catheter is introduced through the urethra, and the vibrating element on the catheter energized within the prostate. The low frequency vibration reduces pressure from the prostate on the urethra, possibly by inducing apoptosis of smooth muscle cells.
US08167822B2	Splittable wire guide A splittable wire guide having a plurality of separable elongate components that may be separated or otherwise re-positioned relative to each other so as to alter the physical properties of the wire guide or to form a plurality of separate wire guide members.
US08167820B2	Retractable needle-safety blood sampling device A safety device is presented for securely stowing a double sharp-ended needle. The device comprises a tubular adapter with a longitudinally-elongated channel. A needle holder is located in the channel to move from a distal orientation, in which one needle end projects from a distal adapter opening, and a proximal orientation, in which both needle ends are enclosed within the adapter body. A top plate transitions from a distal orientation, in which the plate is distal from a proximal adapter opening, and a proximal orientation, in which the top plate obstructs the proximal adapter opening. An actuator plate is attached to the adapter body to transition from a first position where the actuator plate retains the needle holder and top plate in distal orientations, and a second position where the needle holder and top plate move to proximal orientations.
US08167818B2	Biopsy apparatus with vacuum relief A method of relieving vacuum in a biopsy apparatus includes applying vacuum through at least one motor to an inner cannula lumen; providing a continuously open leak path that permits fluid communication between the outer cannula lumen and atmosphere, wherein fluid is drawn from the leak path through the outer cannula; retracting the inner cannula proximally to permit tissue to prolapse into a tissue receiving opening of the outer cannula due to the vacuum; translating the inner cannula distally to sever the prolapsed tissue; aspirating the severed tissue through the inner cannula lumen; and selectively relieving vacuum distally of the severed tissue by retracting the inner cannula proximally to permit the inner cannula lumen to communicate with the respective outer cannula lumen and the leak path while a portion of the biopsy apparatus, including the tissue receiving opening, is positioned within tissue.
US08167817B2	Methods and devices for removing tissue from a patient and placing a marker in the patient The device is used to remove tissue from a patient and to also place a marker in the patient. The device has an opening through which tissue enters the device. The tissue, which enters the opening is cut and the tissue is removed. The device may be used a number of times to remove a number of tissue masses. The device also includes a marker, which the user may release in the patient at the desired time.
US08167812B2	Device and method for detecting obstructive events In a method for detecting a physiological signal at least one ventilation parameter is measured. The device for detecting a physiological signal has at least one sensor for measuring a ventilation parameter and a control unit for the ventilation pressure. A device for monitoring at least one ventilation parameter while respiratory gas is being supplied to a patient is provided with a sensing device for detecting the behavior of the ventilation parameter as a function of time.
US08167811B2	Apparatus and method for outputting heart sounds An apparatus for outputting heart sounds includes an implantable system and an external system. The implantable system includes a sensor for generating sensed signals representing detected heart sounds, an interface circuit and a control circuit for receiving the sensed signals, generating data representing the heart sounds therefrom, and transmitting the data to the external system via the interface circuit. The external system includes an interface circuit for communicating with the implantable system, and a control circuit for receiving the data representing the heart sounds and for generating control signals that cause an output device to generate outputs representing the sounds. The implantable system may also include a sensor(s) for detecting cardiac electrical signals. In this case, outputs representing the cardiac electrical signals are also output.
US08167810B2	Catheter device for treating a blockage of a vessel The invention relates to a catheter device for treating a blockage of a vessel, with the catheter device featuring a treatment catheter for treating the vessel blockage which is embodied as an integrated unit with front-mounted stent.
US08167807B2	Ultrasonic diagnosis device, ultrasonic image analysis device, and ultrasonic image analysis method A motion parameter measuring unit two-dimensionally measures a motion parameter of a myocardial tissue by a tracking process on time-series ultrasonic image data acquired from a sample. A time phase setting unit adds a diastolic heartbeat time phase, which is set on the basis of a systole end specified by a time phase where a cardiac cavity area of the ultrasonic image data is the smallest and a diastole end specified by an R wave in an electrocardiographic waveform of the sample, relative to the systole end to time-series parameter image data generated by a parameter image data generating unit on the basis of the motion parameter. An image data extracting unit extracts parameter image data to which the diastolic heartbeat time phase closest to a desired diastolic heartbeat time phase set by an input unit is added and displays the extracted parameter image data.
US08167800B2	Apparatus and method for processing pulse waves Pulse wave signal data expressing the pulse wave of a subject and body movement signal data expressing body movements of the subject are obtained so that a correlation coefficient expressing the degree of correlation between the pulse wave signal data and the body movement signal data is calculated. One or more pieces of the pulse wave signal data in which the correlation coefficient is equal to or larger than a predetermined threshold value are eliminated.
US08167793B2	Augmented stereoscopic visualization for a surgical robot using time duplexing An endoscope with a stereoscopic optical channel is again held and positioned by a robotic surgical system. A capture unit captures (1) at a first time, a first image from light from the channel; and (2) at a second time different from the first time, a second image from the light. Only one of the first image and the second image includes a combination of a fluorescence image and a visible image. The other of the first image and the second image is a visible image. An intelligent image processing system generates an artificial fluorescence image using the captured fluorescence image. An augmented stereoscopic display system outputs an augmented stereoscopic image of at least a portion of the tissue comprising the artificial fluorescence image.
US08167792B2	Endoscope system having passage position setting section and passage position correction section An endoscope system includes an endoscope provided with an image pickup section that picks up an image of an object in a body cavity, a position setting section that sets information on a predetermined position in the object based on information obtained from the image of the object picked up by the image pickup section and a position correction section that corrects the information on the predetermined position set by the position setting section based on information on a boundary line extracted in the image of the object picked up by the image pickup section and outputs information on the corrected position.
US08167791B2	Endoscope system An endoscope system of the present invention includes an image pickup section that picks up an image of an object, a position detection section that detects a position indicating a predetermined object in the image of the object obtained by the image pickup section and a probability calculation section that calculates a probability value as a degree indicating accuracy of the position being the predetermined object using first information obtained from the image and second information on a condition of the object whose image is picked up by the image pickup section.
US08167781B2	Multi-spindle head exchangeable machine tool A multi-spindle head exchangeable machine tool is provided with a plurality of multi spindle heads movably mounted on an annular rail. When a workpiece is machined by driving a rotary tool by a machining unit, multi spindle heads of the plurality of multi spindle heads being out of use can be separated from the machining unit. Further, a connecting device is provided with an inner slider, ball bearings fitted to an outer periphery of the inner slider, an outer slider, and a coil spring to press the outer slider toward a stopper member.
US08167775B2	Method for clutch protection Method for protecting a clutch of a vehicle, said vehicle being provided with an engine, drive wheels and an automated manual transmission for transmitting drive power from said engine to said drive wheels. A controller can execute the steps of: sensing a power demand from the driver which results in a clutch control where the clutch is partly engaged and clutch slip occurs, measuring travelling distance(s) of the vehicle during a predetermined first time interval, initiating a first warning measure, in order to alert the driver of excessive clutch slip, if the vehicle has traveled less than a predetermined distance during said predetermined first time interval.
US08167774B2	Process for controlling a twin clutch A process for controlling a twin clutch transmission with two partial drive trains with respectively a friction clutch interposed between an internal combustion engine and the partial drive train is provided. If the transmission capacity of a friction clutch falls below the engine torque, engine intervention takes place. If the clutch temperature rises further above a default value, an emergency operation is initiated, in which the affected partial drive train is deactivated by opening the affected friction clutch, a preselection strategy used in the other partial drive train is changed and the other partial drive train is activated.
US08167773B2	Method and apparatus to control motor cooling in an electro-mechanical transmission A method for controlling a powertrain including an transmission coupled to an engine and an electric machine and a hydraulic control system providing hydraulic flow to a cooling circuit of the electric machine, wherein the transmission is adapted to selectively transmit mechanical power to an output member, includes monitoring a temperature of the electric machine, determining a cooling flow requirement for the cooling circuit based upon the temperature of the electric machine, comparing the cooling flow requirement to a threshold cooling flow, and requesting active electric machine cooling of the electric machine based upon the comparing.
US08167763B2	Block mounted lock-out mechanism A differential is provided that includes a first and second side gear and a reaction block disposed between the first and second side gear. The differential further includes an engagement mechanism configured to have at least a portion of the engagement mechanism that is moveable from a retracted position to an extended position and a lock-out mechanism that is configured to engage the portion of the engagement mechanism. The lock-out mechanism is mounted to the reaction block. A reaction block for a differential in which a lock-out mechanism is mounted on the reaction block is also provided.
US08167762B2	Drive axle assembly with wheel speed measurement system A wheel speed measurement system for a drive axle is provided within a differential assembly. The system includes a differential side bearing adjustment ring configured for adjusting the position of a differential carrier bearing assembly. A tone ring is provided having an inner bore to accommodate a coaxial axle shaft. A retainer ring member is snap-fit between the differential side bearing adjustment ring and the tone ring, permitting relative rotation of the tone ring. Sensors are provided in sensor mounts integrally formed on an exterior of a differential assembly housing.
US08167751B2	Conveyor belt A conveyor belt comprising a plurality of successive belt elements (2), each belt element (2) comprising at least one transverse rod (4) and two opposing side members (3) connected to each other by the at least one transverse rod (4), and a link (6) forming a joint intermediate the lateral edges (7a, 7b) of the conveyor belt between the adjoining transverse rods (4) of each pair of adjoining belt elements (2). Each link (6) comprises a plate (11) in which two successive rod receiving holes (12) are formed, wherein the rod receiving holes (12) have an offset (O) towards a first side (13) of said plate (11) and wherein a recess (16) is formed in said first side (13) of the plate (11), between said rod receiving holes (12).
US08167748B2	Fixed parallel-blade broadhead having modified H-shaped outline configuration A broadhead which is light in weight and which has surface area to decrease arrowhead weight, surface area and drag to increase performance of an arrow to which it is attached. The broadhead attaches to the arrow in one of the known ways, glue, screw, friction or interference fit. A broadhead wrench may need to be used to protect the user from sharp edges while handling the broadhead. The blade portion of the broadhead aids in the hemorrhaging of the target by creating a larger conduit for bleeding to occur, thus speeding death of a game animal.
US08167739B2	Extreme weighted hybrid and other wood-type golf clubs and golf club heads Wood-type golf club heads include: (a) a club head body member defining an interior chamber; (b) a weight system engaged with a rear perimeter portion of the club head body member; and (c) a connection system connecting the weight system with the club head body (e.g., with the rear of the ball striking face portion). The club heads further may include one or more damping members in the interior chamber to alter the sound and/or otherwise attenuate a vibrational response of the club head. The damping members may extend between the ball striking face and the weight system, and optionally may engage the connection system. The damping member(s) may constitute a foam material compressed within the interior chamber of the club head. Methods of making such golf club head structures also are described.
US08167735B2	Golf club with removable components A golf club having removable components includes a club head, a shaft, and a connection assembly. The club head includes a hosel having an upper treaded portion and a lower portion with a faceted cross-section. The connection assembly includes a sleeve mounted on the tip end of the shaft and a screw-cap. The sleeve, which has an aperture for receiving the tip end of the shaft, includes a lower section that has a multi-faceted surface for engaging the lower portion of the hosel. The screw-cap is mounted over the sleeve and includes a body having an upper area and a threaded area, the latter of which is capable of engaging the upper threaded portion of the hosel to removably secure the shaft to the club head.
US08167731B2	Artificial ski slope assembly The present invention relates to a collapsible artificial ski slope assembly (10) and, in particular, but not exclusively, to a collapsible artificial ski slope assembly which can be moved between deployed and storage positions.
US08167716B2	Gaming machine having a plurality of terminals and playing method thereof A gaming machine includes: a plurality of gaming terminals, a shared display, and a plurality of routs. Each of the gaming terminals has first light emitting portions which provide an effect to a game. Further, each of the gaming terminal runs a base game and a special game configured to award a special payout. Each of the routs is formed by arranging second light emitting portions from associated one of the gaming terminal to the shared display. The gaming machine thus structured executes a playing method including the steps of: every time a gaming terminal achieves a predetermined winning in the special game, (i) blinking a predetermined number of second light emitting portions forming a rout associated with that gaming terminal sequentially from the one closest to that gaming terminal, the predetermined number being determined based on the winning having been achieved, and (ii) blinking the first light emitting portions of that gaming terminal in sync with the second light emitting portions; and awarding a special payout to a gaming terminal whose associated rout has all its second light emitting portions being activated up to the shared display.
US08167712B2	Method and apparatus for player replacement in an on-line game Methods, apparatuses, and techniques for replacing players in an online game are described. Replacing players in an online game includes associating a first player with a first online identity and associating a second player with a second online identity. Then replacing the first player and associating the first online identity with a third player that is registered with the first online identity. Replacing players in an online game can also include associating a first player with a first online identity and associating a second player with a second online identity. Then replacing the first player and the second play so that the second player is associated with the first online identity and the first player is associated with the second online identity.
US08167704B2	Slot machine and associated methodology of linking symbols to provide a variable display function having feature in linking display contents of symbols with one another and variable display operations of symbols with one another A slot machine scrolls symbols on a plurality of defined areas provided on a display at a time of executing a slot game, and thereafter rearranges the symbols on the respective defied areas. In a case where a trigger symbol is rearranged on a defined area, the slot machine links display contents of symbols with one another and variable display operations of symbols with one another on a prescribed range of the defined areas.
US08167702B2	Prepaid wagering card A prepaid wagering card and a system and method for playing the lottery over a telephone line using the prepaid wagering card are provided. The prepaid wagering card includes information that makes it convenient to obtain the prepaid wagering card and use it to wager sets of numbers listed thereon, while also ensuring that the information remains secure. Participating in a lottery using the prepaid wagering card simply involves calling a wagering system from a telephone and providing requested information. Thus, a user can purchase a prepaid wagering card and decide on which scheduled lottery to actually wager using the prepaid wagering card.
US08167701B2	Systems and methods for lottery-style games Systems and methods for lottery-style games are disclosed. In one exemplary embodiment, a computer-implemented method may comprise: establishing a map-based game that is scheduled to have a number of lottery drawings associated with a plurality of grid units on a map; accepting enrollment of players in the map-based game, each player being associated with at least one grid unit on the map and being committed to participate in a plurality of the lottery drawings by contributing tokens of value; receiving, from each player, a designated number of tokens to be contributed, on behalf of each of the at least one grid unit, to each lottery drawing said player is committed to participate in; and executing the map-based game by pooling the contributed tokens to form a jackpot and conducting a drawing, from grid units participating in said drawing, to select at least one grid unit to win a first prize.
US08167693B2	Operation input device, operation evaluation method, recording medium, and program A target information storage unit (203) stores information regarding a group of targets (target panels) which are disposed dispersedly on a virtual race course and which each have an objective speed set therefor. An operation input reception unit (201) receives an operation input for a moving object (racing car) to be run on the course. Then, a running condition managing unit (204) manages the running condition of the moving object based on this operation input. Meanwhile, a passage determination unit (206a) sequentially determines whether or not the moving object has passed on the course by contacting the respective targets, based on the managed running condition. Further, a speed comparison unit (206b) compares the speed of the moving object at the time of the passage and the objective speed of each target. Then, an evaluation unit (206) evaluates the operation input from a user based on the determination result and comparison result.
US08167687B2	Method of thinning wafer and support plate A wafer can be thinned without occurrences of dimples. A support plate 1 has a number of through holes 10. A circuit forming surface of a wafer 2 is adhered to one surface of the support plate by an adhesive member 4, and a dimple prevention member 3 having a thickness of 100 μm or more and having an adhesive layer 30 on one face is adhered to the other surface, thus the openings at both ends of the through holes 10 are blocked. The support plate is vacuum adsorbed to a support table through the dimple prevention member, and a non circuit-forming face of the wafer is ground/polished to thin the wafer. The dimple prevention member is stripped off, and a solvent is penetrated into the adhesive member through the through holes to detach the wafer from the support plate.
US08167681B2	Slicing method The present invention provides a slicing method comprising winding a wire around a plurality of grooved rollers and pressing the wire against an ingot to be sliced into wafers while supplying a slurry for slicing to the grooved rollers and causing the wire to travel, wherein a supply temperature of the slurry for slicing is controlled, and slicing is performed in such a manner that the supply temperature of the slurry for slicing and a temperature of the ingot become at least 30° C. or above at end of slicing the ingot. As a result, there is provided the slicing method that can alleviate precipitous cooling of an ingot in the time close to end of slicing the ingot and thereby suppress production of a nano-topography when slicing the ingot by using a wire saw.
US08167677B2	Method of assembling an airtight LED light bulb A method of assembling an airtight LED light bulb has the steps of: connecting a stem device with an LED device, drying the LED device, connecting the stem device with a bulb envelope, extracting air in the bulb envelope via a pipe, filling the bulb envelope with nitrogen or inert gas via the pipe, sealing an opening of the pipe which is located outside the bulb envelope to make the bulb envelope completely airtight and connecting a cap with the bulb envelope. Because the bulb envelope is airtight, moisture in the environment can not damage the LED device, and the steps of extracting air in the bulb envelope via the pipe and filling the bulb envelope with nitrogen or inert gas via the pipe are feasible. Consequently, the LED device will not easily be oxidized or dampened, so the lifespan of the airtight LED light bulb can be prolonged.
US08167672B2	Buoyant cushion Buoyant cushions or the like are used and are adaptable for varied other uses, such cushions having physical properties that include buoyancy, weather-resistance, malleability, strength, and comfort to the user, and allows the cushion to be used dually as lounging floatations in bodies of water and as cushions adapted to compliment outdoor furniture or used as furniture. The chamber of each cushion is partially filled with polystyrene beads and the outer surface is defined primarily by a comfortable flexible fabric material to support a user and a flexible mesh fabric material to permit ingress and egress of water to the chamber, such materials being sewn together to form the cushion.
US08167669B1	Grip of oar An oar includes a retractable shaft with a blade and a grip connected to two ends thereof. A socket is connected to the shaft by a pin and includes a first toothed surface on the end surface of the socket. The grip includes a tubular portion which is mounted to the socket. A spring and a bolt are located in the socket, and the bolt is securely connected with the grip so that the spring is biased between the grip and the head of the bolt. The tubular portion of the grip includes a second toothed surface in an inner end thereof so as to be removably engaged with the first toothed surface of the socket.
US08167666B2	Terminal crimping method, terminal crimping structure, terminal crimping device, and electrical connector A terminal crimping method and a crimping tool are provided, thereby suppressing the generation of friction at an anvil and a crimper and also suppressing the generation of an upthrust portion at the upper part of a wire barrel to which a conductor of a covered electrical wire is crimped. The crimping tool includes an anvil having a placement groove on which a female-type terminal is mounted, and a crimper that crimps a conductor barrel of the female-type terminal mounted on the anvil. The placement groove includes a first pressing portion that presses the effective crimping portion and a second pressing portion that presses the extension, and the bottom surface of the second pressing portion is formed as an inclined surface expanding and opening toward a receptacle side.
US08167665B2	Electrical connector with collapsible coupler Disclosed herein is an electrical connector. The electrical connector includes a first electrical connector member, a second electrical connector member, and an electrical connector coupler. The first electrical connector member includes a flange portion and a shaft portion. The second electrical connector member includes a pad portion and a tube portion. The tube portion is adapted to receive the shaft portion. The tube portion is adapted to be attached to another portion of the electrical connector by a crimping operation. The electrical connector coupler includes a first end, a second end, and a corrugated portion between the first end and the second end. The first end is adapted to be disposed proximate the flange portion. The second end is adapted to be disposed proximate the pad portion. The coupler is adapted to be compressed from a first length to a second length in response to the crimping operation.
US08167659B2	Connector block feature A memory card connector, within a slot of a host device, for receiving a first memory card having a first row of contact fingers and a second row of contact fingers and a second memory card having only a single row of contact fingers. The memory card connector includes a first row of contact pins, a second row of contact pins and a protrusion. The first row of contact pins are configured to mate with the first row of contact fingers of the first memory card. The second row of contact pins are configured to mate with the second row of contact fingers of the first memory card. The protrusion is received within a contact finger in the second row of contact fingers of the first memory card to allow full insertion of the first memory card into the connector, and abuts against a distal end of one of the contact fingers of the second memory card to prevent full insertion of the second memory card into the connector.
US08167648B2	Low noise connector with cables having a center, middle and outer conductors An adapter conductively interconnects a chuck of a probe station and an instrument. The adapter includes a signal conductor conductively connected to the chuck and selectively connectable to a respective one of a ground potential, a bayonet connector output and a signal connection for the instrument. A guard potential conductor conductively connected to the chuck and selectively connectable to a one of a ground potential and a guard connection for the instrument; and a shield conductor connected to a ground potential.
US08167646B1	Connector having electrical continuity about an inner dielectric and method of use thereof A connector having a conductive member is provided, wherein the conductive member electrically couples a dielectric and a post, thereby establishing electrical continuity about an inner dielectric throughout the connector. Furthermore, the conductive member facilitates grounding through the connector, and renders an electromagnetic shield preventing ingress of unwanted environmental noise.
US08167645B2	Fastening device for detachable holding of an electrical distributor by latching A fastening device for detachable holding of an electrical distributor (2) by latching, with a base plate (3) and with two latch mechanisms (4) which project vertically away from the base plate (3). Several openings (5, 5′) for holding screws (6) are formed in the base plate (3), with which the base plate (3) can be fastened to the wall or other support (7), and free ends of the latch mechanisms (4) each having an elastic catch arm (8) with a catch hook (9) and a rigid contact arm (10) opposite the catch arm (8). The fastening device enables an electrical distributor to be fastened quickly and easily, but still reliably, to a wall or other support, with the possibility of also quickly and easily detaching the distributor, as necessary, from the wall without removing the fastening device.
US08167644B2	Electrical connector for an electronic module An electrical connector is provided for electrically connecting an electronic module to an electrical component. The electrical connector includes electrical contacts having mounting bases that are initially mechanically connected together by a connection strip. The connection strip extends along a connection path from the mounting base of one of the electrical contacts to the mounting base of the other electrical contact. The connection strip is broken along the connection path such that the electrical contacts are separated from each other. The electrical connector also includes a insulator having a module side and an opposite component side. The mounting bases of the electrical contacts are mechanically connected to the insulator on the module side of the insulator. The insulator includes a punch opening that extends into the module side of the insulator. The punch opening is aligned with the connection path of the connection strip and is configured to receive a punch tool for breaking the connection strip.
US08167643B2	Card connector The card connector in which a card receiving space for containing at least a part of a small card incorporating an integrated circuit is formed by a cover member having at least a top board and right and left side walls and a base member having at least a bottom wall, a front wall, and right and left side walls, the card connector includes: a plurality of contacts penetrating the front wall of the base member and being elastically deformably supported by the base member; and a heat dissipating mechanism located behind the plurality of contacts and elastically deformably supported by the base member. The heat dissipating mechanism includes at least one heat dissipating piece having a free end at one end. The heat dissipating mechanism is disposed at a cutoff portion formed at the bottom wall of the base member.
US08167637B1	Shock free bulb insert The inventive concept is directed to shock free bulb socket that is inserted in an existing light bulb socket to forego any possible electric shock when there is no light bulb in the existing bulb socket and the electric switch happens to be in an “on” status. The insert socket is a housing that is placed over the existing socket and fastened thereto. The insert socket consists of a lower threaded segment that is threaded into the existing socket. There is an upper threaded segment that will receive the light bulb. When the light bulb is threaded into the upper segment it will encounter a plate there below and will cause the upper threaded segment to slide upwardly together with a bracket to which it is attached. There is a sliding hot prong and a sliding neutral prong which will make contact when the bracket moves upwardly and will convey electric current to the light bulb. When the light bulb is removed, springs return the bracket to its original position and the contact between the prongs is discontinued and no shock can be experience when a finger is placed into the light socket.
US08167632B2	Bus bar A collecting rail system provides a bus bar with a floor part and a cover part made from an isolating material. The floor part features at least two chambers for the accommodation of respectively one terminal track, whereby between respectively two chambers a chamber separating wall is disposed, and whereby connector tabs are disposed on the terminal tracks such that the cover part can be placed on the floor part in such a manner that the terminal tracks are covered up and the connector tabs protrude through openings in the cover part. As a result of this arrangement, the floor part as well as the cover part are manufactured by means of an operative extrusion process and the openings are subsequently placed, in particular stamped, into the cover part, whereby an isolating element, which is insertable into an opening and which penetrates, in the inserted state, through the opening and which features a case. The case is disposed with which is at least one separating wall, preferably two separating walls, which are positioned between two neighboring connector tabs when the cover part is placed on the floor part and the isolating element is inserted into the opening.
US08167625B2	Integrated noise reduction connector An electrical connector comprising an insulative body, a plurality of pins carried by the body and a ferromagnetic element that rides on one of the plurality of the pins. The ferromagnetic element provides a low pass filter capability for signals transmitted over the one pin.
US08167620B1	Team roping training apparatus A team roping training apparatus that comprises a motor having a motor shaft, a spool having a spool shaft, and a switch to selectively energize the motor. The spool is selectively rotatable with the motor shaft such that when rotation of shaft is impeded through a roper's grasping of an attached rope, the spool is disengaged form the motor shaft. According to the preferred embodiment, such selective rotation is accomplished with a clutch mechanically coupling the spool shaft with the motor shaft.
US08167616B2	Dental handpiece system with replaceable treatment tips A dental hand piece with replaceable tips at either end of a tubular handle, each of the replaceable tips including a tip assembly having an instrument working tip end at a distal end of a main tip body and a shank extending from the instrument working tip end to a proximal end of the main tip body. The tip assembly may be provided with a flat-blade extension end at the proximal end of the main tip body. The flat-blade extension end passes through a keyway-shaped slot provided in a locking component, and engages locking structure provided on a cylindrical barrel member. Replaceable tips at the ends of the tubular handle may be secured in 180° orientation to one another. A spring arm member may additionally or alternatively engage notches along an interior wall of the cylindrical barrel member.
US08167613B2	Screw-type implant, particularly for orthodontics The description relates to a self-drilling threaded screw implant, particularly for orthodontics. According to the invention there is in at last one thread groove (15) of the thread (10), delimited by two flanks (13), a cutting edge (16) extending transversely to the two flanks (13) without traversing the two flanks (13).
US08167604B2	Fluid spring and molding apparatus A fluid spring is provided with a sleeve, a first chamber configured to accommodate a fluid and formed in the sleeve, a hollow piston rod, a second chamber configured to accommodate the fluid and formed in the hollow piston rod, and a communicating passage configured to make the first chamber and the second chamber communicate with each other and formed in an end portion of the hollow piston rod. A part of the hollow piston rod is displacably accommodated in the first chamber. The communicating passage only permits the fluid to flow in a direction from the first chamber to the second chamber.
US08167593B2	System and method for pump with deformable bearing surface Systems and methods for pumping fluid comprising a pumping chamber, a pump inlet, a pump outlet, a valving mechanism, and a drive piston or pumping chamber wall including a deformable surface configured to provide elastohydrodynamic lubrication during operation.
US08167585B2	Devices and/or systems for mounting an auxiliary blower Certain exemplary embodiments can comprise a system, which can comprise an electric motor cooling fan. The electric motor cooling fan can be driven by an auxiliary motor distinct from an electric motor adapted to be cooled by the electric motor cooling fan. The system can comprise a motor enclosure of the electric motor. The motor enclosure can be configured in a predetermined ventilation pattern.
US08167581B2	Device for delivering a liquid, the device comprising a pump and a valve A device for delivering a liquid including a pump, and an anti-siphon valve external to the pump is disclosed. The anti-siphon valve includes an inlet channel connected to the outlet duct of the pump, and an outlet channel, between which a seat and a moving member are disposed that are suitable for co-operating together and that define, between the inlet channel and the outlet channel, a leaktight liquid flow zone. The moving member is suitable for going from an opening position making it possible for liquid to flow through the flow zone, to a closure position in which the moving member comes into contact with the seat of the valve and prevents any flow through the flow zone, the moving member being subjected to the pressure of a reference chamber that is not in fluid communication with the outlet channel.
US08167572B2	Dynamically tuned turbine blade growth pocket A turbine blade growth pocket provides a feature to measure blade growth due to engine operation while maintaining dynamic characteristics of the turbine blade within acceptable limits by providing a variable radius fillet between the pocket and a side rail of the pocket.
US08167557B2	Gas turbine engine assemblies with vortex suppression and cooling film replenishment A gas turbine engine assembly has combustion gases flowing through a gas flow path. The gas turbine engine assembly includes a stator assembly comprising a stator vane that extends into the gas flow path; and a turbine rotor assembly downstream of the stator assembly and comprising a turbine platform and a turbine rotor blade extending from the turbine platform into the mainstream combustion gases flow path. The turbine rotor blade includes a pressure side and a suction side opposing the pressure side that extend from a leading edge to a trailing edge. The combustion gases form horseshoe vortices at a formation area adjacent the leading edge of the turbine rotor blade, and the turbine rotor assembly further includes a first set of holes in the turbine platform for directing first jets into the formation area of the horseshoe vortices.
US08167548B2	Steam turbine A steam turbine is provided having a rotor which rotates around a machine axis, and a stator which concentrically encompasses the rotor with clearance, between which an annular passage is formed which is exposed to throughflow by steam in the axial direction and in which a multiplicity of rotor blades, which are fastened on the rotor, and fixed stator blades are arranged in a plurality of stages, wherein the stator blades of the last stage have a sweep with a sweep angle which changes in sign over the relative blade height.
US08167546B2	Ceramic turbine shroud support A turbine shroud includes a ceramic shroud ring configured to surround a plurality of turbine rotor blades, a plurality of slots circumferentially distributed around the ceramic shroud ring, a forward metallic support ring, a plurality of tabs attached to a forward edge of the forward metallic support ring configured to engage a turbine support case, and a plurality of tabs attached to an aft edge of the forward metallic support ring received by the slots of the ceramic shroud ring. Only two axially extending radial surfaces of each of the tabs attached to the aft edge of the forward metallic support ring are configured to contact the slots of the ceramic shroud ring.
US08167542B1	Centrifugal fan with 360 degree continuous rotation This patent discloses a fan capable of 360 degree continuous rotation. The fan may include an impeller positioned within the impeller housing, an impeller motor fixed to the impeller housing, where a control knob may control the impeller motor. The fan further may include an impeller shaft connected between the impeller and the impeller motor to rotate the impeller and the impeller housing may reside on a base. A contact ring may be positioned within the base. The impeller motor and the impeller housing may rotate relative to the contact ring, which may provide power to the impeller motor through brushes. A housing motor may be positioned within the base and be connected to the impeller motor to rotate the impeller motor. A housing motor switch may control the housing motor.
US08167541B2	Vibration-absorbing device for blower motors Disclosed herein is a vibration-absorbing device for blower motors, which is provided between a blower motor and a motor housing surrounding the blower motor. The vibration-absorbing device includes a vibration-absorbing body, which may be spherical, and an engaging depression. The vibration-absorbing body is provided in the blower motor. The engaging depression is formed in the inner surface of the motor housing such that a vibration-absorbing body can be contained therein.
US08167537B1	Air cooled turbine airfoil with sequential impingement cooling An air cooled turbine airfoil such as a stator vane in which the airfoil is hollowed out and an insert is secured within the hollowed out section that produces sequential impingement cooling of the airfoil. The insert is formed from a plurality of plates bonded together outside of or inside of the airfoil to form a single piece insert with the cooling circuit. The plates are bonded together using TLP bonding process with sheets of boron placed between adjacent plates so that no excess material seeps out and into the cooling features formed with the plates. The cooling features of the plates are formed by photo-etching.
US08167535B2	System and method for providing supercritical cooling steam into a wheelspace of a turbine A system for cooling a high pressure section of a turbomachine includes a conduit configured to carry cooling steam from a boiler to a space upstream of a first stage nozzle of the turbomachine. The conduit extends through a housing of the turbomachine and a nozzle diaphragm of the first stage nozzle. The system further includes a control valve in the conduit configured to regulate the flow of cooling steam. A turbomachine includes a housing; a turbine shaft rotatably supported in the housing; and a plurality of turbine stages located along the turbine shaft and contained within the housing. Each turbine stage includes a diaphragm attached to the housing. The diaphragm comprises a plurality of nozzles. A hole is provided in the diaphragm upstream of a first stage of the plurality of stages for the introduction of cooling steam. A method of cooling a high pressure section of a turbomachine includes introducing cooling steam into the turbomachine through the at least one hole.
US08167533B2	Wind energy system Wind energy systems comprise a wind accelerator having a support assembly and an outer structure surrounding the support assembly. The wind accelerator has a front region and a rear region. The rear region is substantially wider than the front region, and the outer structure tapers from the rear region to the front region. One or more turbines are mounted on the support assembly at or near the rear region of the wind accelerator or at or near the widest point of the wind accelerator.
US08167526B2	Apparatus for automatically unloading agricultural material from a storage bag An unloading apparatus capable of automatically unloading agricultural materials from a storage bag is disclosed. The unloading apparatus includes a drive mechanism for advancing the apparatus along the direction of an elongate storage bag, a collection mechanism for withdrawing material from the bag, and mechanisms for both sensing resistance imposed on the advancing apparatus by material in the bag and controlling further advancement of the apparatus in accordance with the level of that resistance.
US08167518B2	Method and apparatus for a spindle with servo feed control A method and apparatus for a power feed drill. The power feed drill comprises a servo motor, a roller screw, a ball spline shaft, an air motor, and a collet chuck. The roller screw is rotatably mounted to the servo motor. The ball spline shaft has a first end connected to the roller screw, wherein rotation of the roller screw in a first direction moves the ball spline shaft in the first direction and wherein rotation of the roller screw in a second direction moves the ball spline shaft in an opposite direction to the first direction along an axis. The air motor is capable of transmitting rotation motion to the ball spline shaft to rotate around the axis. The collet chuck is fixably attached to a second end of the ball spline shaft, wherein the collet chuck is adapted to receive a tool.
US08167510B2	Surface scrubber with rotating pad A cleaning device includes an integral fluid dispenser therein that serves to dispense a fluid into the scrubbing pad of the device to improve the cleaning effectiveness of the device. The device includes a main body with a cleaning pad attached to one side thereof, an internal motorized assembly for rotating the cleaning pad upon depressing a button provided on a side of the main body and a fluid storage region that contains a cleaning fluid. A metered dosing pump is used to dispense a measured amount of fluid from the fluid storage region to cleaning pad upon actuation by the user. Further, the dispensing action and the rotation of the pad may be controlled by the same button or by separate buttons.
US08167507B2	Focal plane shutter device and imaging device A focal plane shutter device is disclosed that includes a shutter base plate, a front curtain, a first urging member, a rear curtain, a second urging member, and a charge mechanism. The shutter base plate defines an opening. The front curtain is moved between different positions by the first urging member to cover and uncover the opening. The rear curtain is moved between different positions by the second urging member to cover and uncover the opening. The charge mechanism applies a first force to resist an urging force by the first urging member and a second force to resist an urging force by the second urging member. The first force applied by the charge mechanism terminates at a different time than the second force applied by the charge mechanism.
US08167503B2	Taper roller bearing A taper roller bearing includes an inner race, an outer race, taper rollers arranged so as to be rollable between the inner and outer races, and a retainer for retaining the taper rollers, in which a flange portion is provided only on the radially larger side of the inner race. The retainer includes a radially-larger-side annular portion including a hook portion. The hook portion effects hooking so that the flange portion of the inner race is maintained in an assembled state. In a neutral state, the hook portion is kept out of contact with the flange portion. A guide surface portion for guiding the inner race to be incorporated is provided on a radially inner end portion of an outer surface of the hook portion.
US08167481B2	Timepiece wheel train and timepiece A timepiece wheel train includes a rotating body with a shaft unit, a bearing unit that rotatably supports the shaft unit of the rotating body, and a lubricating oil in which powder from a diamond-like carbon film is dispersed disposed between the shaft unit and the bearing unit.
US08167465B2	LED illumination module The present invention relates to an LED illumination module. The LED illumination module comprises an upper housing configured to have an accommodation unit upwardly protruding at a central portion of the upper housing and to have two or more LEDs mounted in an outer circumference direction of the accommodation unit, a lower housing disposed below the upper housing, a power supply device embedded in the accommodation unit formed in the upper housing and configured to supply a power source to the LEDs, and power source cables placed on sides of the upper housing and the lower housing and configured to supply an external power source to the power supply device.
US08167463B2	Power surface mount light emitting die package A light emitting die package includes a substrate, a reflector plate, and a lens. The substrate has traces for connecting an external electrical power source to a light emitting diode (LED) at a mounting pad. The reflector plate is coupled to the substrate and substantially surrounds the mounting pad, and includes a reflective surface to direct light from the LED in a desired direction. The lens is free to move relative to the reflector plate and is capable of being raised or lowered by the encapsulant that wets and adheres to it and is placed at an optimal distance from the LED chip(s). Heat generated by the LED during operation is drawn away from the LED by both the substrate (acting as a bottom heat sink) and the reflector plate (acting as a top heat sink).
US08167459B2	LED lighting fixture An LED lighting fixture compatible with existing incandescent lamp lighting fixtures. The heat produced by the LED light source is dissipated through a heat pipe into a ground hole to maintain an optimum operation temperature of the LED light source.
US08167457B1	Lighting system for use in motion picture and video production An illumination system suitable for lighting in connection with the production of film or video includes one or more lighting modules, wherein each module contains a light engine, a heat sink to which the light engine is affixed, and a control system electrically connected to the light engine, the control system capable of adjusting both the color and intensity of light engine by means of one or more rotary concentric control knobs and pushbuttons affixed to the control system, and wherein the control systems of each module are interconnected by a wireless data network, so that all of the modules may be controlled by using the rotary control unit on any individual module.
US08167454B2	Protective sheath for a LED band The protective sheath has a basis for attaching the LED band and an at least partially light-transmissive covering attachable thereto, wherein the basis and the covering form an accommodation space for the LED band in the attached state.
US08167452B2	Lighting apparatus A lighting apparatus includes a housing, a light source disposed in the housing and at least one adjustable assembly disposed at an end of the housing. The adjustable assembly includes a connection element fixed to the end of the housing, a cap capping the connection element, at least one electrical terminal and an adjusting mechanism. A part of the connection element is located in the cap. The electrical terminal is disposed at the cap and electrically connected to the light source. The adjusting mechanism includes a gear, a positioning element, a clasp and a track. The gear and the positioning element are respectively disposed at the connection element and the cap. Positions of the gear and the positioning element can be exchanged. The clasp and the track are respectively disposed at the connection element and the cap. Positions of the clasp and the track can be exchanged.
US08167450B2	Portable lighting device Disclosed is a portable light that can be secured to most any fixed object by use of an elastic band attachment mechanism. The elastic band securement device is form fitting and fully adjustable with the ends of the securement device placed beneath a cover of the light during installation, wherein the cover of the light conceals the attachment mechanism to prevent accidental disengagement of the light from the object of attachment. In operation, the base of the light has a cover which is secured by a latch, hook and loop, thumb screws or any other type of fastener which upon removal exposes the light and the two ends of the elastic cord. A portion of the elastic cord is secured around a fixed object and the bitter end of the cord is drawn tight and placed through a cord fastener so as to secure the cord in a secured and tensioned position. The cover is then replaced, thereby concealing the ends of the elastic band from disengagement. The light can then be operated in a usual manner by the use of an on/off switch.
US08167445B2	Backlight assembly A backlight assembly includes a light source assembly including a plurality of light source blocks arranged in a first direction, each light source block including a substrate including a reflecting surface and a plurality of point light sources arranged on the substrate, a lower housing accommodating the light source assembly, and a substrate fixing portion disposed at a boundary between adjacent substrates and fixing the light source assembly to the lower housing. The substrate fixing portion includes a head extending overlapping the boundary between the adjacent substrates of the light source blocks and pressing the substrates towards the lower housing, and an engaging protrusion protruding from the head and fixed to the lower housing.
US08167443B2	Optical observation apparatus The apparatus includes a supporting member disposed at an outer circumference of the ocular optical system and an eyepiece cup. A first member thereof includes a cam follower and a second member thereof includes a cam groove to move the eyepiece cup in an optical axis direction with rotation of the eyepiece cup and an introducing groove through which the cam follower is introduced to the cam groove. One member of the first and second members includes an engaging portion, and another member thereof includes a stopper engaging with the engaging portion to prevent rotation of the eyepiece cup in a direction in which the cam follower is returned from the cam groove toward the introducing groove. The stopper formed integrally with another member is elastically movable so as to be located at and retreated from an engaging position to be engageable with the engaging portion.
US08167436B2	Display shelf with placing tables and transmission-type screens having projecting parts and laterally-facing displays A display shelf system includes a display shelf, which includes a plurality of placing tables which are adapted to have an article placed thereon. A plurality of transmission-type screens are arranged with the placing tables, respectively. A projector projects a projector image, and a light guide of the display shelf leads the projector image onto the rear sides of the transmission-type screens. The transmission-type screens have curved surfaces which are inclined to face toward a lateral direction with respect to a front of the display shelf, so that the transmission-type screens are easily viewable by viewers who are in the lateral directions of the display shelf.
US08167430B2	Unsupervised learning of temporal anomalies for a video surveillance system Techniques are described for analyzing a stream of video frames to identify temporal anomalies. A video surveillance system configured to identify when agents depicted in the video stream engage in anomalous behavior, relative to the time-of-day (TOD) or day-of-week (DOW) at which the behavior occurs. A machine-learning engine may establish the normalcy of a scene by observing the scene over a specified period of time. Once the observations of the scene have matured, the actions of agents in the scene may be evaluated and classified as normal or abnormal temporal behavior, relative to the past observations.
US08167423B2	Ink jet apparatus An ink jet textile printing apparatus includes a printing section having a recording head and performing printing on a recording medium by ejecting ink from the recording head, a transporting belt having an adhesive surface, and a lifting preventer disposed on an upstream side with respect to the printing section in a transporting direction in which the transporting belt is rotated. The lifting preventer includes a free roller that is provided over the recording medium adhered to and supported by the transporting belt and is movable in the transporting direction and in a direction opposite to the transporting direction.
US08167414B1	Printing apparatus, system and method A printing apparatus and system for printing is disclosed. The print apparatus includes a print head, an ink reservoir, and at least one conduit for supplying ink from the ink reservoir to the print head. In an embodiment, the ink reservoir is operatively connected to the print head such that the vertical movement of the ink reservoir substantially coincides with a similar vertical movement of the print head.
US08167403B2	Droplet ejector The droplet ejector includes: a head unit set composed of four head units arranged in a staggered manner in the arrangement direction; a head supporting member which supports the head unit set; a liquid supplier which supplies liquid to the head unit set; and a conveyor mechanism which conveys an ejection target. Each head unit has a passage structure having a liquid passage. At one edge of the passage structure in the arrangement direction, a liquid supply opening which is connected to the liquid passage and the liquid supplier is provided. Two passage structures neighboring in the arrangement direction are disposed so that the respective edges where the liquid supply openings are provided oppose each other in the arrangement direction.
US08167399B2	Ink supply devices An ink supply device includes a controller, a cartridge mounting portion, and an ink cartridge. The cartridge mounting portion includes first, second, and third detectors configured to detect first, second, and third detection target portions of the ink cartridge and to output first, second, and third detection information, respectively. The controller is configured to execute a first process if both the first detection information and the second detection information are output and execute a second process if at least one of the first detection information and the second detection information is not output when the third detection information is output during insertion of the ink cartridge into the cartridge mounting portion. It is determined that the ink cartridge has reached a predetermined mount position in the first process, and a type of the ink cartridge is determined in the second process.
US08167395B2	Apparatus and methods for servicing 3D printers The invention relates to apparatus and methods for producing three-dimensional objects and auxiliary systems used in conjunction with the aforementioned apparatus and methods. The apparatus and methods involve 3D printing and servicing of the equipment used in the associated 3D printer.
US08167385B2	Washing machine Provided is a washing machine. The washing machine includes a front portion that forms the front of the washing machine and a deco panel. The deco panel is installed around the perimeter of the front portion to cover the front portion.
US08167382B2	Brake system for a motorcycle, and motorcycle incorporating same A brake system for a motorcycle includes a pressure-regulating unit interposed between a fluid pressure-generating unit and a wheel brake. The operation of a pressure-regulating unit is controlled by a control unit on based on a value detected by an operating amount detector. The fluid pressure-generating unit is arranged between an engine body mounted on a body frame and an exhaust pipe extending from the engine body. The exhaust pipe is connected to the front surface of a cylinder head of the engine body, and is extended downwardly from the cylinder head. A support member for supporting the fluid pressure-generating unit is supported, through elastic members, by the engine body and frame members of a body frame of the motorcycle. The body frame extends rearwardly downwards from a head pipe connected to the body frame at a front end portion thereof.
US08167359B2	Assembly configuration An assembly configuration for a motor vehicle is provided that includes, but is not limited to a first assembly and a second assembly, a channel being at least partially implemented between the first assembly and the second assembly, a bulkhead plate being positioned transversely to the main direction of the channel and a gap being at least partially implemented between the lateral edge of the bulkhead plate and at least one of the assemblies.
US08167350B1	Liner apparatus and method of making a liner A liner for a cargo area of a vehicle, such as a car, truck, trailer, or the like, includes at least three layers, a base layer, an intermediate patterned layer, and a clear or transparent top layer so that the patterned layer may be viewed. The patterned layer may be monochromatic, where only a single color is used, or it may be polychromatic, where several colors are used. The patterned layer may be a color scape, a design or logo, a message, or any decorative item. Three embodiments of methods for making a liner are shown. The methods include the use of a female mold, a male mold, or a combination of male and female molds where the male mold is a ram applying pressure and heat to the several layers on the female mold.
US08167348B2	Cable activated latch pawl for floor console armrest An armrest assembly for pivotable attachment to a vehicle floor console includes a first sliding armrest having a latch, a second sliding armrest having a latch, a console pawl for engagement with a pawl receptacle formed in the console, a first cable connecting the latch of the first sliding armrest to the console pawl, and a second cable connecting the latch of the second sliding armrest to the console pawl. The assembly further includes a first ratchet rack and a first ratchet pawl connected to the latch of the first armrest and a second ratchet rack and a second ratchet pawl connected to the latch of the second armrest. Operation of a latch releases both the console pawl and the associated ratchet pawl simultaneously to allow sliding movement of the armrest or pivoting movement of the armrest assembly with respect to the floor console.
US08167347B2	Three panel heat stake structure A trim panel assembly which provides support for the interior panels during a heat staking process, even when the interior panels overlap an outer panel, is provided. The trim panel assembly includes a first support boss extending from an inner surface and an outer surface which is adjacent a weld horn backing plate during the heat staking process. A second panel includes an outwardly extending elongated stud extending from an inner surface, and a support boss extending from an outer surface. An accessory panel having an aperture is aligned with the second panel such that the elongated stud passes through the aperture. During the heat staking process pressure is applied to the stud of the second panel which is supported by the weld horn backing plate through the contact between the support boss of the first panel and the boss of the second panel.
US08167340B2	Drill stem tubular connection with internal stiffener ring A threaded pipe coupling is shown for a drill pipe used in horizontal boring operations utilizing a special form of a threaded connection with an internal stiffener ring which eliminates the need for hot forging operations. The pipe coupling is used for joining an upset region of a first tubular member to a further tubular member of lesser external diameter. The internal stiffener ring is received within the internal bore of the pin end of the coupling and underlies and extends along a portion of its length. The stiffener ring having an innermost extent terminating in an exposed end which is received upon an internal shoulder provided in the mating internally threaded box end. The stiffener ring also has an external shoulder formed at the innermost extent thereof which traps the pin face between the ring exterior and the box threaded interior.
US08167339B2	Resin tube-equipped quick connector There is provided a resin tube-equipped quick connector capable of connecting a fuel-transporting resin tube to a mating pipe without hindrance even if the resin tube has a small diameter. The quick connector is constructed such that it includes a connector body having a press-fitting portion, and a retainer. On the other hand, a press-fit undergoing portion of the resin tube into which the press-fitting portion is to be press-fitted is beforehand expanded in tube diameter prior to the press-fitting, and the press-fitting portion is press-fitted into the expanded press-fit undergoing portion in a withdrawal-preventing condition to provide the quick connector equipped with the resin tube.
US08167331B2	Spring cartridge for ski binding The present invention relates to a spring cartridge for a ski binding, wherein the ski binding has a rotatable front binding part for attachment of a ski boot, and is in particular a telemark ski binding. In the binding the spring cartridge provides tension to a biasing cable which biases the rotatable front binding part, so as to rotate the front binding part so that an attached ski boot would be brought into contact with the ski to which the ski binding is attached.The spring cartridge comprises an extended hollow housing open at both ends, a compression spring held within the extended hollow housing and a pressure stub held partly within the compression spring.The pressure stub is structured with an extended portion having a cross dimension smaller than the interior size of the compression spring and a head having a larger size than the interior size of the compression spring. The extended portion extends within the internal hollow of the compression spring and is also hollow and provided with an internal screw thread in the hollow section for threadable engagement with an external screw thread at the end of a biasing cable of a ski binding, the biasing cable being threadable through the center of the compression spring to the pressure stub.With rotation of the pressure stub this would thus lead to a change in the amount of the biasing cable held within the hollow section, when present, and thus change the amount of compressive force acting on the compression spring.
US08167325B2	Control arm of multilink suspension system for vehicle A control arm may be formed by assembling front and rear members respectively having upper and lower flanges so as to have a tubular cross-section, and a bending portion may be formed by bending the lower flange of the front member downwardly such that a drain hole is formed by the bending portion protruded downwardly when the front and rear members are assembled.
US08167324B2	Caster wheel suspension for a zero-turn mower A zero-turn mower comprising a zero-turn mower frame, a front axle coupled to the zero-turn mower frame, first and second caster wheel assemblies, and first and second front shock assemblies. The front shock assemblies rotatably and telescopically couple the caster wheel assemblies to the front axle, thereby providing vertical shock absorption. The front axle may be a floating axle that is pivotably coupled to the mower frame and/or the shock assemblies may define an internal spring-receiving chamber that is substantially isolated from the external environment. Such a zero-turn mower may provide a smoother ride and may require less maintenance and repair than conventional zero-turn mowers.
US08167321B2	Binding components for a gliding board A snowboard binding and hold-down device that may flex or move with the snowboard when ridden to minimize any impact on flex characteristics. The snowboard binding may be compatible with a variety of snowboard binding mount arrangements.
US08167320B2	Vehicle with carriage anti-tilting structure A vehicle with carriage anti-tilting structure, which comprises a frame and, a carriage of a cylindrical shape, with its central axis in parallel along the length of the vehicle and is connected with the frame in a free rotation state. The rotating axis of the carriage is the central axis of the carriage, and the gravity center of the carriage is lower than the rotating axis. An electrical locking mechanism for stopping the rotation of carriage is arranged between the carriage and frame, and is connected with a vehicle tilting angle detector which installed on the frame. The locking mechanism acts as an actuator of the vehicle tilting angle detector. In the event of tilting of the vehicle, the vehicle tilting angle detector detects the tilting condition, and then output signal to the electrical locking mechanism, which releases the locking of the carriage and enables it to stay leveled.
US08167318B2	Hydraulic anti-roll system A hydraulic anti-roll system for a vehicle includes a first hydraulic actuator, a second hydraulic actuator, an anti-roll control module, and an anti-roll bypass valve. The first hydraulic actuator is adapted to be connected between the suspension and frame of the vehicle on one side and the second hydraulic actuator is adapted to be connected between the suspension and frame of the vehicle on its other side. The anti-roll control module is connected between the fluid lines of the first and second hydraulic actuators. The anti-roll control module stiffens the compression of the first hydraulic actuator relative to the expansion of the second hydraulic actuator, and stiffens the compression of the second hydraulic actuator relative to the expansion of the first hydraulic actuator. The anti-roll bypass valve is adapted to activate and deactivate the stiffening of the anti-roll control module.
US08167316B2	Clamping head provided with floating clamping jaws A clamping device for fixing a machined part to a processing axis in a machine tool including the processing axis, a clamping head which is rotatable thereabout and with clamping elements floatably arranged thereon.
US08167314B2	Distortion resistant face seal counterface system According to the present invention, an annular face seal arrangement for a gas turbine engine is provided that includes a mounting ring, a mounting member, a rotor, and a stator. The mounting ring has a width extending between a first axial end and a second axial end. The mounting member has a clamp portion and a biasing portion. The clamp portion extends axially between a first clamping surface and a second clamping surface. The biasing portion includes a first segment and a second segment. The second segment has a width and a rotor contact surface. The rotor has a rotor seal surface and a clamp portion having a width. The stator has a stator seal surface that is aligned with the rotor seal surface. The mounting ring is disposed radially inside of the rotor and radially inside of at least part of the biasing portion, and is disposed in contact with the second clamping surface of the clamp portion. The rotor contact surface of the biasing portion is disposed in contact with the rotor.
US08167311B1	Game machine A game machine includes a cabinet-type main frame. A rack and a movement assembly respectively mounted in the main frame. The rack has multiple rooms defined therein for receiving prizes. An operational unit is mounted on a front panel of the main frame for user to operate the movement assembly. A drive device is mounted on the movement assembly and reciprocally moved relative to the rack. Multiple driven devices are mounted on the rack. Each driven device aligns with a corresponding one of the rooms. Each driven device has a shaft extending into the corresponding room and reciprocally moved to push a prized received in the room when the drive device is engaged to and pushes the shaft.
US08167310B2	Transportable washer tossing game retrieving pole For an accuracy scoring game having a target area towards which steel washers are tossed when playing, a telescopic retrieving pole of multiple sections capable of collapsing into one another for closure and storage and of extending from one another for opening, including a first end for player hand grasping and a second opposite end forming a first compartment of one or more embedded magnets for picking up steel washers from the ground, and in which the retrieving pole, when collapsed, is of a dimension to fit within a carry box for the target area and for the steel washers when the game is not being played.
US08167305B2	Transporting device and transporting method A transport device and a transporting method. The transporting device includes a transporting unit, a plurality of medium sensing units, an encoder, a paper management module, a determining unit, and a transport controller. When the determining unit determines that a transport error has occurred in a succession transport medium based on a count value for an encoder signal, the paper management module stops counting, and the transport controller controls the transporting unit such that the transporting unit continues transporting a previous transport medium.
US08167300B1	Method for determining the amount of media sheets in a media tray in an image forming device A method for determining the amount of media sheets in a media tray in an image forming device according to one embodiment includes raising a lift plate supporting a stack of media sheets toward a pick mechanism for feeding the media sheets by rotation of a motor in a first direction. An amount of rotation of the motor in the first direction is determined. An indication of an amount of media sheets remaining in the media tray is provided based on the determined amount of rotation of the motor in the first direction.
US08167298B2	Sheet feeding device and image forming apparatus provided therewith A sheet feeding device includes: a sheet feeding tray adapted to stack a sheet bundle including a plurality of sheets thereon; a blowing section which blows air against a leading edge of the sheet bundle in a sheet conveyance direction from a front side of the sheet conveyance direction; a sticking and conveying section which sticks an uppermost sheet stacked on the sheet feeding tray by air sucking, and feeds the uppermost sheet to a conveyance roller; a sucking duct provided inside the sticking and conveying section, which is divided into a plurality of ducts in the sheet conveyance direction; and an intercepting member which intercepts at least one of the plurality of divided ducts.
US08167288B2	Force multiplying handle mechanism for a bar clamp A force multiplying handle mechanism for a hand-operated bar clamp having a fixed handle and a movable handle is provided. The mechanism can comprise a pivotal attachment disposed on the end of the fixed handle, a handle having a pivot plate disposed on one end of the handle extending therefrom thereby substantially forming an L-shaped member, the pivot plate pivotally attached to the pivotal attachment and a pin extending substantially perpendicularly from the pivot plate, the pin configured to contact the movable handle. When force is applied to the handle to cause the pivot plate to pivot about the pivot attachment, the pin squeezes the movable handle towards the fixed handle.
US08167285B2	Spring latching connectors radially and axially mounted A spring latching connector includes a housing having a bore therethrough, a piston slidably received in said bore, circular groove formed in one of said bore and piston and a circular coil spring disposed in said groove for latching said piston and housing together. The groove is sized and shaped for controlling, in combination with a spring configuration, disconnect and connect forces of the spring latching connection.
US08167274B2	Corner assembly A corner assembly and manufacturing method comprising two cap rail components each having a channel and at least one receiver within the channel, the components connected or bonded to form a corner fitting having an angle and having a first end and a second end such that the first cap rail component channel and the second cap rail component channel form an angled channel within the corner fitting. At least one pin is disposed in a portion of the receiver within the first cap rail component channel, and at least one pin is disposed in a portion of the receiver within the second cap rail component channel. The assembly also may include a bracket disposed within the channels of the corner fitting.
US08167271B2	Staple extractor A staple extractor having a handle, a shank attached to the handle and having a conical pry tip, and a sliding member having a clamp head engageable with the pry tip and slidably attached to the shank so as to permit relative longitudinal movement between the shank and sliding member, wherein the clamp head has opposed wings that straddle the pry tip so as to releasably secure a staple bridge. The sliding member has a thumb knob located proximate the handle for moving the sliding member between a retracted position and a clamping position.
US08167270B2	Valve gear with a bearing having a sliding surface against a valve shaft The invention improves reliability of a valve gear in which a cobalt-based alloy is welded by plasma power building up. The valve gear includes a bearing 2 having a sliding surface against a valve shaft 1. The valve gear having a welded layer 12 made of heat-resistant cobalt-based alloy, based on plasma powder building up, formed on the sliding surface against the valve shaft 1. The welded layer 12 includes a first welded layer 12a formed on the surface of the bearing 2, having a dilution ratio of 5 to 25% and a second welded layer 12b formed on the first welded layer 12a, having a dilution ratio of 50% or less of the dilution ratio of the first welded layer 12a. The dilution ratio indicates the penetration amount of the welding metal into the base metal, and is a value obtained by B/A×100 (%) wherein A represents the total amount of the welded metal and B represents the amount of the welding metal penetrating into the base metal.
US08167269B2	Valve trim apparatus for use with valves A valve trim apparatus for use with valves is described. An example valve trim apparatus includes a cage having an upper portion removably coupled to a lower portion. A closure member is disposed within the cage and has a first seating surface and a second seating surface. A seal assembly is fixed between the upper and lower portions of the cage. The first sealing surface of the closure member sealingly engages the seal assembly when the closure member is in a closed position to prevent leakage between the closure member and the cage.
US08167265B2	Microvalve having magnetic wax plug and flux control method using magnetic wax Provided is a microvalve having a magnetic wax plug which includes a micro fluidic structure having an inlet portion and an outlet portion, a magnetic wax plug provided at a predetermined section where the inlet portion and the outlet portion meet, existing in a solid state, melted at a temperature higher than a predetermined temperature, and reversibly moving along a magnetic field, so as to control flux of a fluid through the micro fluidic structure, a heating portion provided corresponding to the section and heating the magnetic wax plug to be melted, and a magnetic field application portion selectively applying a magnetic field to a position where the melted magnetic wax plug arrives.
US08167263B1	Magnetically placeable strap A magnetically placeable strap, particularly adapted for use in pickup trucks having beds or panels of a ferrous content. The magnetically placeable strap includes a spool-like base having an elastic strap extending therefrom with a hook at an end of the strap. The base consists of a pair of parallel spaced apart disks, a bottom disk being cup-shaped and receiving a magnet therein. The top disk is provided with a plurality of kidney-shaped apertures for receipt of the hook at the end of the elastic strap, or for a user's fingers or tool that might be used in releasing the magnetic base from attachment to a ferrous surface. The magnetically placeable straps may be used singularly or in combination to secure any of various items in the bed of a pickup truck or the like.
US08167262B2	Power converter mounting assemblies The present disclosure relates mounting assemblies for a vehicle DC-to-DC power converter. The mounting assemblies can include a bracket having a first end configured to be fastened to a DC-to-DC power converter housing and a second end configured to be fastened to a vehicle structural member. The mounting assemblies can be utilized in hybrid, fuel cell and/or electric vehicles.
US08167253B2	Flat panel TV stand providing floating appearance A TV stand for a flat panel TV includes a base with plural shelves and a translucent frame on the top shelf. A rear support holds the TV juxtaposed with the translucent frame with the bottom of the TV above the top shelf, so that the TV appears as though it is floating above the top shelf.
US08167240B2	System and methods for buoyancy management in an airship An airship comprising a hull configured to be inflated with a first gas; a ballonet in the hull, the ballonet configured to be inflated with a second gas that is heavier than the first gas; a fan configured to draw the second gas into the ballonet; an inflatable landing system; a duct configured in the ballonet to allow access to components in the airship; and a valve coupled to the ballonet. The valve provides a pathway for air to flow between the ballonet and a plenum chamber, the plenum chamber is formed by the airship, a landing surface, and the inflatable landing system when the inflatable landing system is in contact with the landing surface.
US08167236B2	Hybrid lift air vehicle A hybrid lift air vehicle for lifting and transporting a payload to a delivery location, which comprises a helium or other lighter-than-air gas filled envelope mounted on an airframe. Variable and reversible vertical thrusters are positioned on the airframe, and at least two variable and reversible lateral thrusters are mounted on the envelope or mounted on truss arms attached and extending out from the airframe, wherein, when the vehicle is connected to the payload for transport, the helium or other lighter-than-air gas supports or substantially supports the weight of the vehicle and the vertical thrusters are then continuously engaged to support the weight of the payload and to provide lift to the payload, wherein the lateral thrusters are then engaged to effect lateral movement of the vehicle to the delivery location, whereby, once at the delivery location, the lift provided by the variable and reversible vertical thrusters is reduced or reversed so as to allow the air vehicle to descend and the payload to again engage the ground surface, and where necessary, the variable and reversible vertical thrusters may be reversed to facilitate the unloading of the payload from the vehicle, the vehicle continuing to be kept aloft, once unloaded, by the helium or other lighter than air gas. In this manner, the vehicle utilizes the helium or lighter than air gas to offset or substantially offset the weight of the vehicle, the vertical thrusters providing the power to lift the payload.
US08167235B2	Whirling wheel airborne vehicles A sliding-arm whirling wheel thruster includes first and second whirling wheels and a housing. The first whirling wheel is disposed about a first rotational axis, and the second whirling wheel about a second rotational axis parallel to the first rotational axis. The housing comprises an arc over an enclosed space into which the first and second whirling wheels fit. The air blown outward by each of the whirling wheels is amassed inside the housing so as to make a pressure difference between inside and outside of the housing. The relative position of the first rotational axis to the second rotational axis is configured to be controlled. The airborne vehicle is lifted by buoyant force caused by the pressure difference.
US08167225B2	Cutting tooth for brush cutter A cutting tooth is used on a brush cutter head. The cutting tooth includes a cutting portion having a first face and a second face. The first face and the second face cooperate to define a tapering profile terminating in a cutting edge. The first face of the cutting portion carries a plurality of ridges formed thereon to direct cutting debris away from the cutting edge and facilitate passage of the debris along the trailing face when the cutting tooth is in use.
US08167219B2	Device for improving tire traction A tire traction device which may improve or provide tire traction for various vehicles is described. The tire traction device includes a board having a first end and a second end, wherein the first end has a curved edge and the second end has a slanted edge. The board may include more than one section. The board includes a rough top surface, and a plurality of spikes extend from the bottom surface of the board. The tire traction device may also include a flexible component attached to the board. The flexible component is designed so that it may be drawn underneath a spinning tire.
US08167216B2	User setup for an HVAC remote control unit An HVAC remote controller for use in an HVAC system is described. In some instances, the HVAC remote controller may include a wirelessly interface for communicating with one or more HVAC controllers and/or other HVAC devices. The HVAC remote controller may be configured to execute a user setup routine for entering user setup information, where the user setup routine may cause the HVAC remote controller to display a sequence of two or more user setup screens, sometimes at a common menu level rather than a sub-menu. Some or all of the two or more user setup screens may include, for example, a message center indicating a parameter or function to be set, one or more buttons for adjusting or selecting the parameter or function, and a next button to advance the user setup routine to a next screen in the sequence of user setup screens.
US08167215B2	Thermostatic mixing valves utilizing wave springs A thermostatic mixing valve for hot and cold water has a valve member for controlling the relative proportions of hot and cold water admitted to a mixing chamber according to user selection of a desired water temperature and a thermostat responsive to the mixed water temperature to adjust the position of the valve member to maintain constant the selected water temperature. The valve member is biased by a return spring in the form of a wave spring having a plurality of turns with transverse waves configured such that adjacent turns sit peak to peak. The wave spring is strong in compression and weak in torsion allowing the ends of the spring to move laterally to accommodate any misalignment in the components of the valve.
US08167214B2	Method and device for visual code transaction verification A method and device for visual code transaction verification enables more secure electronic transactions. The method includes generating a window having a first pattern of elongated segments. A second pattern of elongated segments is then generated, wherein a dynamic visual code is produced when the window and the first pattern of elongated segments are superimposed with the second pattern of elongated segments. A transaction with a user is then verified by matching the dynamic visual code with a code string entered by the user.
US08167212B2	Radio frequency identification system and data reading method A system and method for reading an RFID data tag comprising a plurality of diffractive elements being indicative of machine-readable data carried by the tag are provided. The diffractive elements have such shape that the dimension of the diffractive elements along one axis is substantially different than the dimension of the elements along the perpendicular axis. Each diffractive element is oriented in a direction other than the direction of its neighboring elements. The system comprises a transmitting antenna configured for emitting an RF radiation signal at a predetermined polarization towards the tag; and a receiving antenna configured for collecting re-radiated RF radiation produced by the tag in response to the RF radiation signal at a polarization orthogonal to the polarization of the transmitting antenna and generating electromagnetic signals indicative of the data carried by the tag. The system also includes an interrogator unit configured for generating the transmitted RF radiation signal and processing the electromagnetic signals produced by the receiving antenna for determining the data carried by the tag.
US08167207B2	Integrated optical exit window A device including a housing, an imaging engine and a transparent exit window. The imaging engine is located within the housing. The exit window is in the housing allowing light to pass from an exterior of the device to the imaging engine within the housing. The exit window has a plurality of segments. Each of the segments has a corresponding optical property.
US08167197B2	Conversion system, terminal and method for paying with E-money A conversion system includes a terminal apparatus for paying with one of a plurality of different types of e-money, and an intermediate server which issues intermediate e-money to the terminal apparatus. The terminal apparatus has an algorithm storage unit which stores an algorithm to convert intermediate money into one of said plurality of different types of e-money, and an e-money conversion unit to convert the intermediate e-money, which is different from the plurality of different types of e-money, into one of the plurality of different types of e-money.
US08167181B2	Motorcycle saddlebag A motorcycle saddlebag is formed of a plurality of panels. The saddlebag includes an outer panel, an inner panel, a lid, and a hinge. Some embodiments may also include a bottom panel. The lid is coupled to the outer panel by the hinge. The inner panel includes flanges extending around at least some of its perimeter edges. The outer panel is generally U-shaped shaped and receives the inner panel such that the flanges engage inner surfaces of the outer panel. The flanges are joined to the inner surfaces of the outer panel such that the outer and inner panel (and, in some embodiments, a bottom panel) cooperate to define a storage chamber. In some embodiments, portions of the outer panel extend beyond the inner panel and may be trimmed after bonding of the inner and outer panels to customize an inner contour of the saddlebag for different motorcycle applications.
US08167172B2	Compressed gas / carbon dioxide / hydraulic fluid dispenser A fluid dispensing apparatus having a) a compressed gas or CO2 cartridge controller, b) a hydraulic pressure medium connected to the CO2 cartridge controller, c) a flow control valve connected to the hydraulic pressure medium; and d) a hydraulic piston connected to the hydraulic pressure medium, whereby a CO2 cartridge applies pressure to the hydraulic pressure medium controlled by the CO2 cartridge controller, the flow control valve is operated to precisely meter hydraulic fluid to the hydraulic piston, and the hydraulic piston provides the linear force to dispense a fluid product with similar and matching regulation under pressure. A rotary valve can be provided to use spent CO2 to retract the piston.
US08167171B2	Device for dispensing, by means of a pump, fluid substances contained under airtight conditions in a deformable bag housed in a rigid container A device for dispensing, by a manually operable pump, fluid substances contained in a deformable bag housed in a rigid container. The bag includes a mouth with a projecting flange with which the pump engages in coupling to the flange, and which causes the bag to be extracted from the container when the pump is separated from the container after the bag has been emptied.
US08167170B2	Adhesive dispenser system A dispenser system employs a packaging module for use with moisture sensitive materials. The packaging module comprises an outer carton and an inner bladder, which is substantially impermeable to moisture and is filled with one part of an adhesive. The carton is loaded on a mobile cart and the one part adhesive is supplied to a pump/mixer without exposure to moisture in the atmosphere. The packaging and dispensing system can be used in conjunction with mechanized adhesive application equipment for the construction trades.
US08167165B1	Thermal cover device for coffee press A thermal cover device for a coffee press featuring an elongated panel for wrapping around the coffee press, wherein a first attachment means is disposed on the panel for securing the panel around the coffee press and a first slot disposed in the side of the panel sized to accommodate a handle of the coffee press; and a circular top panel adapted to be attached to a top of the coffee press, wherein a second slot is disposed in the circular panel for accommodating a lid handle disposed the top of the coffee press; wherein the panel and top panel are constructed from a first batting layer and a second batting layer sandwiched between outer layers, wherein an insulation layer is sandwiched between the first batting layer and the second batting layer, the insulation layer is constructed from an EagleShield™ insulation component.
US08167161B2	Metallic container closure having internal pressure release function A metallic container closure comprising a shell of a thin metal sheet having a circular top panel wall 7 and a skirt wall 9, and a synthetic resin liner arranged in the shell, the skirt wall 9 having a thread-forming region and an annular groove 17 positioned at an upper end portion of the thread-forming region, wherein an internal pressure release line A extending in the circumferential direction is arranged in the skirt wall 9 at a portion over the annular groove 17, and annular bead 30 is arranged so as to pass through between the internal pressure release line A and the annular groove 17. The metallic container closure effectively releases the gas when the pressure in the container is elevated and effectively prevents the skirt wall from being deformed at a portion where the internal pressure release line A is formed when it is being wrap-seamed with the mouth-and-neck portion of the container.
US08167157B2	Assembly of panels foldable to form a container A box is collapsible in such a manner that it can form a flat stack of panels, each of which corresponds to one side of the box. When the box is configured as a flat stack of panels, it is relatively compact and, therefore, easy to store. When the collapsible box is configured as a box, it is sturdy and strong. The collapsible box has latching elements that can temporarily connect adjacent sides of the box to one another. Typically, a person can latch and unlatch the latching elements with his or her hand. The box is typically transparent and, therefore, well suited for displaying ornamental items, such as ornate hats.
US08167154B2	Electrohydraulic leak compensation The invention relates to an electro-hydraulic leak compensating device for a mobile crane lowering brake system in an open hydraulic circuit with a hydraulic motor (5) coupled with a lifting unit (6,7), a lowering brake valve (4) and a mechanical brake (9), with a pressure sensor (13) which measures the hydraulic pressure prevailing on the load side of the hydraulic motor (5) in the hydraulic circuit and on the side of the lifting conduit (3) before the mechanical brake (9) is closed, in particular immediately before it is closed, as well as a method of electro-hydraulically compensating for leaks of a mobile crane lowering brake system in an open hydraulic circuit with a hydraulic motor (5) coupled with a lifting unit (6,7), a lowering brake valve (4) and a mechanical brake (9), comprising the following method steps: measuring the hydraulic actual pressure prevailing on the load side of the hydraulic motor (5) before the mechanical brake (9) is closed, in particular immediately before it is closed; determining a desired pressure by setting off the measured actual pressure against a previously determined value depending on the load state; generating the desired pressure in the volume (12) before the mechanical brake (9) is opened.
US08167144B2	Water separation membrane Provided is a water separation membrane capable of effectively separating water from a water solution of ethanol, saccharide or the like. The water separation membrane is composed of polypyrrole doped with a sulfonate ion. The sulfonate ion may be an aromatic or aliphatic sulfonate ion.
US08167143B2	Desalination devices and systems using porous hydrophobic hollow fibers and hydrophobic porous coatings DCMD and VMD systems and methods for use in desalination applications are provided. The DCMD and VMD systems employ coated porous hydrophobic hollow fiber membranes. The coatings advantageously function to essentially eliminate pore wetting of the membrane, while permitting substantially unimpeded water vapor permeance through the fiber walls. The DCMD and VMD membranes are characterized by larger fiber bore diameters and wall thicknesses. The membranes substantially reduce the loss of brine sensible heat, e.g., heat loss via conductive heat flux through the membrane wall and the vapor space and, in exemplary embodiments, the brine-side heat transfer coefficient is dramatically enhanced by horizontal/vertical cross flow of brine over the outside surface of the coated fibers. Superior water vapor fluxes are achieved with the systems and methods.
US08167136B2	Device for discarding trims formed during the cutting of paper logs Device for discarding trims formed by cutting machines during the cutting of paper logs, comprising an advancing plane on which paper rolls (R) and trims (RT, RC) advance along a given direction (A), wherein the trims can fall through a discontinuity provided on said advancing plane. The said advancing plane is formed by a first extendible conveyor (1) and a second extendible conveyor (2). Each of said conveyors (1, 2) is connected with extension and retraction means. The said discontinuity on the advancing plane is realized or eliminated depending on the extended or not extended configuration of said conveyors (1, 2).
US08167133B2	Flotation cell An injector of a flotation cell, the injector comprising a feed pipe for feeding a fiber suspension flow into the flotation cell, a mixing apparatus for mixing air into the fiber suspension flow and at least one air feed connection arranged before the mixing apparatus for feeding air into the injector. The injector further comprises a nozzle section which is arranged before the mixing apparatus and comprises an aperture plate provided with apertures and nozzles fixed to the aperture plate substantially at the apertures after the aperture plate, there being open spaces between the nozzles. The air to be fed from the air feed connection is arranged to flow into the spaces between the nozzles and further into the mixing apparatus with the partial flows of the fiber suspension flow entering from the nozzles.
US08167122B2	Apparatus and cartridge for storage of compressed hydrogen gas An apparatus for storage of compressed hydrogen gas is provided. The apparatus includes a sealed housing having an outlet pipe coupled to the housing and equipped with a controllable discharge valve. The sealed housing defines a chamber that includes a cartridge comprising an assembly of at least two different types of micro-containers configured for accumulating and storing said compressed hydrogen gas. The apparatus also includes a hydrogen liberating tool configured for controllable liberating the hydrogen gas from the cartridge into a volume of the chamber that is not occupied by the cartridge. The apparatus is controlled by a control system operatively coupled to the controllable discharge valve and the hydrogen liberating tool, and configured for controlling operation thereof.
US08167109B2	Medium processing apparatus The medium conveying mechanism includes a motor, a driving pulley adapted to be rotated by the motor, an endless belt wound around the driving pulley and adapted to be moved by the driving pulley in a belt moving direction, a first driven pulley around which the endless belt is wound and adapted to be rotated by the endless belt, a first conveying roller disposed on the medium conveying path and adapted to be rotated by the first driven pulley to convey the medium, and a first pressure roller disposed to correspond to the first conveying roller so as to press the medium against the first conveying roller. A distance in the medium conveying path between the information reading position and a nip portion between the first conveying roller and the first pressure roller is shorter than a distance between a leading end of the conveyed medium and back end of the recording area. The first driven pulley is disposed upstream from the driving pulley in the belt moving direction.
US08167102B2	Cable spool for carrying connectivity cable for mobile computing devices A cable spool that has a body including a perimeter façade. An opening extends a thickness of the body. A track structure is formed with the perimeter façade to retain a cable. The opening is dimensioned to retain a terminal that connects to one end of the cable.
US08167099B2	Vehicle damper A damper (1) is provided with a body (2) which surrounds an annular compression chamber (3), the damper (1) being furnished with at least one pneumatic compensation chamber (30, 40) and a control piston (4) that can move relative to the body (2), the control piston (4) having a rod (5) which protrudes from the body (2) and a head (6) which slides in the compression chamber (3). The damper is notable in that, the compression chamber (3) comprising a variable-section radial opening (8), the damper (1) is provided with a hydraulic compensation chamber (10) which receives a first fluid expelled from the annular compression chamber (3) via the variable-section radial opening (8) when the control piston (4) moves.
US08167094B2	Elevator apparatus Provided is an elevator apparatus including a first electromagnetic switch and a second electromagnetic switch provided between a first electromagnetic coil and a second electromagnetic coil of a first brake device and a second brake device and a power source. The brake control section includes: a first electromagnetic coil control switch provided between the first electromagnetic coil and a ground section; a second electromagnetic coil control switch provided between the second electromagnetic coil and the ground section; a first processing section for opening and closing the first electromagnetic switch and the first electromagnetic coil control switch in response to a braking operation command issued from an operation control section; and a second processing section for opening and closing the second electromagnetic switch and the second electromagnetic coil control switch in response to the braking operation command.
US08167089B2	Liftable scaffold A system for lifting a platform includes a frame attached to the platform. The invention has at least one upright member having equally spaced holes longitudinally aligned, with each of the holes having an upper surface and a lower surface. A motor is attached to the frame, and a pinion is driven by the motor. The frame carries the motor and pinion. The pinion has a plurality of equally spaced teeth that radially extend from the pinion. Each tooth has a roller that is freely rotatable about its axis. The rollers roll over the lower surface of the holes when the motor rotates the pinion in a direction to raise or lower the frame and platform. A safety dog is attached to the frame to prevent the platform from falling if a motor were to fail.
US08167085B2	Non-combustible sound-absorbing facing The present invention relates to a non-combustible, sound-absorbing facing (30) having an air flow resistivity of between 80 and 3,000 Rayls and a weight per unit area of between 20 and 1,000 g/m2 and to a laminate (10) comprising the facing (30) and a substrate (20) wherein superimposing the facing (30) on the substrate (20) forms the laminate (10) having good sound absorbing characteristics.
US08167078B2	Work vehicle An object is to provide a work vehicle whose drive portion can be downsized. An engine having an engine output shaft, an electric motor driven by a battery which is attached integrally to the engine output shaft so as to drive the engine output shaft, a traveling drive portion having a transmission connected to the engine output shaft and a traveling drive shaft which is rotated by the transmission and which moves the traveling wheels, a work drive portion selectively performing work by means of power from the engine output shaft, a generator charging the battery, a traveling regeneration portion transmitting regenerative energy of the traveling drive portion to the generator, a work regeneration portion transmitting regenerative energy of a fork drive portion to the generator, and a one-way clutch for traveling and a one-way clutch for work provided, respectively, to the traveling regeneration portion and the work regeneration portion, which suppress transmission of motive power from the generator, are included.
US08167076B2	Motor vehicle A motor vehicle has an actuator device for raising a bonnet in an accident to minimize injury to a pedestrian. The actuator device has at least two actuators for raising the bonnet. A control unit activates actuators with a time delay. Alternatively, the actuators differ in power. The time delay between activating the actuators or the differing power of the actuators reduces vibration while raising the bonnet, thereby ensuring proper raising of the bonnet and enhancing protection to the pedestrian.
US08167073B2	Snowmobile rear suspension system A suspension assembly for a snowmobile is provided that rotatably supports a closed-loop track in the rear tunnel of the snowmobile and also supports both vertical and horizontal travel of said closed-loop track during suspension system travel. The suspension assembly includes at least one elongated ground contact that supports rotational travel of the closed loop track and at least one swing arm angularly disposed in the closed-loop track and having a front end portion pivotably coupled to the rear tunnel and a rear end portion coupled to the at least one ground contact. In the preferred arrangement, a front resilient member is arranged to bias against displacement between the chassis and the at least one ground contact during suspension assembly travel and a rear resilient member arranged to bias against displacement between the chassis and the swing arm during suspension assembly travel. A tensioner couples the rear end portion of the swing arm to the at least one ground contact. The tensioner is extendable and retractable during movement of the suspension assembly to maintain the closed loop track at a generally uniform tension during assembly movement.
US08167062B2	Power generation system and method for assembling the same A power generation system is disclosed. The power generation system includes an electrical converting device and a repowered portion connected to the electrical converting device. The repowered portion includes a reciprocating internal combustion engine and a gearbox. The reciprocating internal combustion engine is connected to the gearbox by a first connecting structure. The gearbox is connected to the electrical converting device by a second connecting structure.
US08167055B2	Percussion device actuated by a pressurized non-compressible fluid According to the invention, the body of the apparatus includes a flow rate adjustment device including a calibrated opening provided on a high-pressure fluid supply circuit, a bore formed in the body and in which is mounted a slider having a first face located in a first chamber connected to a high-pressure fluid supply circuit upstream from the calibrated opening and a second face located in a second chamber connected to the high-pressure fluid supply circuit downstream from the calibrated opening, the bore receiving the slide including an annular groove connected to a low pressure feedback circuit. The slider is adapted for connecting the annular groove to the first chamber when the pressure difference on either side of the calibrated opening increases beyond a predetermined value in order to divert a portion of the fluid flow supplied by the high-pressure fluid supply circuit to the feedback circuit.
US08167040B2	In situ combustion in gas over bitumen formations The invention provides methods for natural gas and oil recovery, which include the use of air injection and in situ combustion in natural gas reservoirs to facilitate production of natural gas and heavy oil in gas over bitumen formations.
US08167036B2	Method for in-situ combustion of in-place oils A novel method is provided for in situ combustion and recovery of oil from underground reservoirs including injecting oxygen into the reservoir at a region near the reservoir floor, establishing a combustion front wherein hot combustion gases rise at the combustion front, withdrawing hot combustion gases from a region near the reservoir ceiling, and extracting oil from a horizontal production well near the reservoir floor.
US08167034B2	Device for centering a well casing A device (100, 200) is for centering a drill casing (7) within a wellbore (3). The device (100, 200) includes a generally tubular body (9) having an outer surface (11) facing the wellbore (3). A plurality of protrusions (4) is disposed on the outer surface (11) along a line (6). A gap region between the protrusions (4) along the line (4).
US08167032B2	Annulus sealing assembly An assembly arranged in a well bore and run in conjunction with a perforated or a non perforated liner has an inflatable packer section prepared for being expanded by fluid and a valve device for opening and closing of fluid communication into the inflatable packer section. The assembly also has a fluid section connected to the inflatable packer section. The fluid section holds a fluid that is delivered into and used to inflate the inflatable packer section. An energy section in the assembly contains an energy source for delivering the fluid from the fluid section into the inflatable packer section. A triggering section includes a control for the energy source and/or the valve device. The triggering section can control the delivery of the fluid into the inflatable packer section. The triggering section also includes a communicator that signals a triggering device for initiating the expanding of the inflatable packer section.
US08167031B2	Blowout preventer with shearing blades The disclosure provides a blowout preventer (BOP) system with a ram having a shear blade with a shear blade profile to shear a tubular member disposed in the BOP. The shear blade profile can include a stress concentrator and centering shaped surface. The stress concentrator and the centering shaped surface can be laterally offset from a centerline of ram travel and on opposite sides of the centerline. An opposing second shear blade can have a mirror image of the shear blade profile with the stress concentrator and centering shaped surface reversed to the orientation of the first shear blade. Further, the ram can include a mandrel with a mandrel profile for the tubular member to deform around during the shearing process and to reduce an overall lateral width of the sheared tubular member in the BOP through-bore to allow retrieval of the deformed sheared tubular member from the BOP.
US08167024B2	Method and associated electromagnetic apparatus for rotating molten metal in a slabs continuous casting ingot mould Four distinct polyphased inductors for a travelling magnetic field and mounted with two inductors per large side on the large sides of the ingot mold, the inductors placed side by side on a same large side of the ingot mold and producing driving forces that push the molten metal, along the width of the ingot mold, both in the same direction, which is a direction opposite to that of the driving forces produced by the two inductors placed opposite on the other large side.
US08167023B2	Apparatus for centrifugal casting under vacuum An apparatus for centrifugal casting under vacuum includes a rotor having a shaft extending in an essentially vertical direction and being rotatable around an axis defined by the shaft. The rotor has at least one mold, at least one crucible, and a gas-tight housing in which the mold and the crucible are accommodated. The apparatus also includes a vacuum source to create a vacuum in the housing, a heating device that melts a metal, a drive device that drives the shaft in order to rotate the rotor, and an auxiliary acceleration device configured to generate a force to further rotate the rotor to overcome a moment of inertia of the rotor. The auxiliary acceleration device includes a jet propulsion and/or at least one pushing actuator accelerating the resting rotor.
US08167021B2	Lever roll-up shade with stop damper A lever actuated roll-up shade assembly for motor vehicle windows having a stop brake for slowing down movement of actuating levers of the roll-up shade assembly during movement into a position corresponding to the retracted position of the roller shade so as to prevent loud impact noises.
US08167018B2	Device for separating labels stacked in a feeder A device for separating labels (4) or the like stacked in a feeder (2), includes a transport device (6) which draws the labels (4) individually from one end of a stack, and a cassette (1), which holds the extractable labels (4) and which can be removed from the feeder (2) or replaced.
US08167017B2	Multi-mode system for dispensing adhesive-backed labels A system for dispensing adhesive-backed labels includes a housing assembly defining a first dispensing outlet, a system for conveying a supply of label material along a feed path and a peeler bar, positionable from a first position to a second position, to effect an abrupt directional change in the feed path thereof, and cause the face material to separate from the liner material. A processor is employed to control the bi-directional displacement of the conveyance system and position the peeler bar within the housing such that the label material is: (i) conveyed downstream of the peeler bar when the peeler bar is in the first position, and (ii) drawn back across the peeler bar to cause a trailing edge of the face material to separate form the liner material when the peeler bar is in the second position.
US08167009B2	Adjustable refilling assembly A refilling system for a vehicle including a body panel having a fixed opening, an adjustable refilling assembly partially enclosed by the body panel, the adjustable refilling assembly including a first port and a second port, the adjustable refilling assembly movable between at least a first configuration in which the first port is aligned with the fixed opening and a second configuration in which the second port is aligned with the fixed opening.
US08167002B2	Flow restrictor The invention relates to a flow restrictor (1) for restricting a volume flow through a liquid line, said flow restrictor comprising a support (10) having a passage and a bent flat spring (11) attached to the support (10). The flat spring (11) comprises at least one spring tab (12) and the passage at least one opening (13), the spring tab (12) and the opening (13) having a substantially identical extension along a longitudinal direction. The spring tab (12) is designed and arranged above the opening (13) in such a manner that it increasingly rests against the support (10) with increasing differential pressure, thereby gradually making the opening (13) smaller and continuously reducing the passage within a defined pressure range. The dimensions of the opening (13) are adjusted corresponding to the size of the spring tab (12), thereby allowing a compact flow restrictor (1) which is less susceptible to dirt. The continuous reduction of the passage allows an increase in vibration resistance of the flow restrictor (1).
US08166999B2	Gas block device and gas block method A use condition of gas equipment is monitored. An abnormality determination unit 26 determines whether or not a use flow volume obtained by detecting a flow velocity obtained by measuring a signal transfer time in a medium using a flow velocity detection unit 17 and converting the detected flow velocity into a flow volume using a flow volume calculation unit 25. When the shutoff unit 27 shuts off a fluid path 1 when it is determined that there is abnormality, a return signal is output from a return unit 28 to a shutoff unit 27 in order to use the gas again by opening the fluid path. Simultaneously, when a return time-counting unit 29 starts the time-counting operation, and then, a predetermined time period has been elapsed, the flow volume calculation unit 25 determines whether or not a predetermined flow volume of greater flows in order to identify whether or not all of the gas plugs of the gas equipment connected to the downstream of the gas shutoff apparatus 27 are closed. The leakage determination unit 30 determines that there is leakage when a predetermined flow volume or greater is detected, and a driving signal is output to the shutoff unit 27 to close the fluid path 1.
US08166993B2	Method and systems for using a shim plate for increased strength Blowout preventer (BOP) and method for sealing a well. The BOP includes a body having first and second conduits, the first conduit being substantially perpendicular on the second conduit; a piston extending through the first conduit and being configured to reciprocate inside the first conduit, the piston having a body portion, a neck portion and a head portion in this order; a ram block disposed on the piston and configured to move with the piston inside the first conduit for closing the second conduit; and a shim configured to fill a gap between a back region of the ram block and the body portion of the piston.
US08166991B2	Rail skirt system The rail skirt system includes a top rail, a skirt that hangs from the top rail, formed from rail bar members connected together at their inner ends by a middle connector tube connectable to a locking support leg, to provide support for the top rail on a side of a shelter. The outer ends of the rail bar members are connected to legs of the shelter by fixed corner connecting brackets.
US08166986B2	Quick connector hub for shade structure An umbrella hub is provided which can comprise a central portion, a body, and an engagement section. The central portion can be configured to receive to an umbrella pole. The body can extend between the central portion and an outer periphery of the hub with the engagement section being located adjacent to the outer periphery thereof. The engagement section can be configured to receive and constrained the movement of an end portion of an umbrella structural member.
US08166977B2	Pelvic surgery drape A urological drape is provided defining a vaginal aperture and a finger cot for accessing the rectum of a patient without making contact therewith. The drape includes an adhesive backing for fixing the drape relative to the patient. Preferably, a pouch is provided which is constructed and arranged to catch any fluids which might be discharged from the vagina during an examination or surgical procedure.
US08166976B2	Mandibular advancement device with positive positioning hinge The invention is an oral appliance for prevention of sleeping problems including snoring, sleep apnea and bruxism. Specifically, the appliance alters the position of the user's mandible, which is known as a method for reducing the restriction of the flow of air through the pharyngeal passageway. The appliance is a one-piece device molded from a flexible polymer such as Kraton®. It includes an upper maxillary tray and a lower mandibulary tray. Both upper and lower trays include inner and outer walls which increase contact area with the teeth. The hinge mechanism of the device includes a positive positioning system comprised of opposed interlocking ridges. The ridges serve to create offset between the position of the upper tray and lower tray relative to each other, therefore advancing the user's mandible. Additional features include airflow posts to keep the mouthpiece from sealing completely, a cleft contour, and a tooth retention tab.
US08166971B2	End-tidal gas estimation system and method An apparatus and method of indicating the reliability of an end-tidal gas value that includes measuring a plurality of gas concentration values, measuring a plurality of ventilation values, determining an end-tidal gas value from the gas concentration values, determining the degree of ventilatory stability from the ventilation values, and providing an estimate of reliability of the end-tidal gas values using the degree of ventilatory stability.
US08166968B2	Scupper valve snorkel A conjoined tube within a tube located inside a lower section of a snorkel designed to steer water droplets away from the snorkel diver's breathing path. The lower section of the snorkel has two valves. One is the scupper valve positioned at the lowest point of the inside tube. The scupper valve is a light duty valve or a low resistance one-way watertight passage intended to allow droplets of water to drain into the main reservoir. The outer tube lower section contains a reservoir for holding residual water that travels down to the bottom of the snorkel and is contained therein. During the normal clearing operation, the reservoir can be emptied and water will exit out of the lower section and into the surrounding water.
US08166966B2	Dish reflector concentrator structure In a reflector dish, a small quantity of elongate mirror-surfaced reflector panels are structurally integrated with a support framework that is configured to enable convenient shipping and on-site assembly and erection of a reflector dish assembly with an effective reflecting surface that closely approximates a desired parabolic dish shape with short focal length, synthesized from combination of the reflector panels originally procured as flat rectangular sheet metal panels and formed to provide the desired dish curvature. The panels can be conveniently shipped to location along with a corresponding quantity of reinforced crescent-shaped support frames to which the panels are made to attach as structural elements, by novel attachment hardware, for erection at the operational site.
US08166963B2	Accessory platform for archery bows An accessory platform for archery bows is provided. The accessory platform includes a substantially disk-shaped portion provided with a hole in the center thereof, a plurality of holes are provided around a periphery of the disk-shaped portion and a base cushion is provided in the hole and includes means to couple the disk-shaped portion directly or indirectly to an archery bow. The accessory platform is utilized to absorb vibration when an arrow is shot from the archery bow and to balance the weight of the archery bow.
US08166958B2	Positive crankcase ventilation system for an internal combustion engine A positive crankcase ventilation (PCV) system is provided for an internal combustion engine. The PCV system includes a centrifugal separator disposed within a shaft member, for example a balance shaft, of the internal combustion engine. The centrifugal separator is operable to impart rotational motion on the gases flowing through the shaft member such that the centrifugal forces urge the separation of oil particle entrained within the gases.
US08166949B2	Cylinder head dry valley drain An engine comprises a cylinder head at least partially defining a dry valley and a cover secured to the cylinder head. The cover defines a first aperture. A boss extends from the cylinder head toward the cover. The boss defines a second aperture. A fastener extends through the first aperture and at least partially through the second aperture to secure the cover to the cylinder head. The fastener defines a passage to fluidly connect the dry valley to an exterior of the engine.
US08166948B2	Throttle-less engine with improved variable valve system To improve the precision of the control of the charge of a cylinder during idling and low revs/light load operation, a bypass feeding path of low flow capacity provides the cylinder with air or mixture while the high flow capacity intake valves stay closed.
US08166945B2	Starter and accessory drive system and method for hybrid drive vehicles A starter and accessory drive system and method for hybrid drive vehicles is provided. The invention isolates the accessory drive system from the transfer of torque between a starter motor and the crankshaft of the engine. In one embodiment, a dedicated flexible drive member transfers torque from the starter motor to the crankshaft to re-start the engine. In another embodiment, a torque transfer control is employed to selectively apply torque from the starter motor to the accessory drive, to drive the accessories when the engine is stopped, and/or to the engine crankshaft to re-start the engine. In another embodiment of the invention, the accessory drive is isolated from the engine crankshaft and is instead driven by a drive motor on the accessory drive while the engine crankshaft is connected to a starter motor and/or generator which can be energized to re-start the engine.
US08166943B2	Fuel system control Methods and systems are provided for operating a fuel system in an engine, the fuel system including a supply pump for delivering fuel to the fuel system and pressurizing fuel received from a feed pump, a fuel tank, a fuel filter for filtering fuel, a fuel rail, and a fuel injector. One example method comprises, during an engine cold-start, operating the supply pump, and adjusting a supply pump operation mode between at least a pressure-controlled mode and a volume-controlled mode based on a fuel temperature and pressure.
US08166939B2	Cam bearing surface of an engine cylinder head that includes an axially extending oil passage A method of forming a cylinder head may include machining an upper surface of a cam tower of the cylinder head to form a generally planar surface. An oil passage may be drilled in the upper surface to provide an oil feed. A bearing bore may be formed in the upper surface of the cam tower. The bearing bore may include a recess having first and second circumferential ends. The oil passage may intersect the first circumferential end.
US08166929B2	Variable compression ratio engine To control the compression ratio of an internal combustion engine, the cylinder block is slidably fitted to the crankcase, projections from the crankcase extend into the cylinder head to support a control shaft bearing the cylinder head. The angular displacement of the control shaft varies the compression ratio by displacing the cylinder head relative to the crankcase.
US08166920B2	Self-cleaning litter box A self-cleaning litter box (50) provides various advantages over the prior art. In particular, in one embodiment, the self-cleaning litter box (50) is configured to use a one piece litter cartridge (20) having a litter compartment (26) and a waste compartment 24. In another embodiment, the cartridge (20) is non-compartmentalized. In another embodiment, the system includes a rake assembly (56) configured with a drive assembly (58) that is protected from waste contamination. In accordance with the invention, the self-cleaning litter box (50) is configured to be used with all types of litter including crystal type litter.
US08166915B2	Device for removing at least one teat cup from a teat of an animal A device for removing at least one teat cup (1a) from a teat of an animal includes i) a cylinder (2) provided with a movable piston (3) dividing an inner space of the cylinder in a first compartment (4) and a second compartment (5), ii) a valve mechanism (9) adapted to connect a vacuum source (8) to the first compartment (4) when it is in a first position and to break this connection when it is in a second position, iii) a passage (15) leading into the first chamber (4), and iv) a valve member (16) adapted to allow a flow through the passage (15) to the first compartment (4) during occasions when an operator moves the teat cup (1a) from a storing position to a teat attaching position.
US08166912B2	Powder spray coating discharge assembly A powder spray coating discharge assembly (230, 260, 216, 228, 232) for connection to an electrostatic spray coating gun (210), the gun (210) having a gun body (212), means for connecting to a supply of coating powder and means for supplying a voltage (20) at first and second potentials respectively to first (292) and second electrical connections (294) each for connection to a respective one of a discharge electrode (232) and a counter electrode (260), the means for supplying the voltage (20) comprising: a variable voltage power supply (114) having an input connected to an electrical power source (110), an output connected to each of the first and second electrical connections (292, 294), a control circuit (128) for controlling the variable voltage power supply (20) and means (120) for sensing an output load, wherein the control circuit (128) is adapted to adjust the variable voltage power supply (20) to reduce the voltage and current in proportion to a sensed increase in load, or vice-versa.
US08166908B2	Powder spray coating device and powder feeding device therefor Powder spraycoating equipment and powder supply system for same. The powder supply system comprises a closed or closable powder receptacle which is fitted with a cleaning fixture to remove residual powder from a powder chamber of the powder receptacle using compressed cleaning air.
US08166904B2	Delivery systems for pressure protecting and delivering a submerged payload and methods for using the same A payload delivery unit for protecting and delivering a payload submerged in a submersion medium comprises a container including a pressure resistant shell and a resilient seal device. The shell defines a containment chamber and includes first and second shell members having opposed first and second sealing faces, respectively. The seal device engages and is interposed between the first and second sealing faces. The container is configured and constructed such that: when the submersion medium applies an exterior pressure to the first and second shell members such that a shell pressure differential, defined as the exterior pressure less an interior pressure of the containment chamber, exceeds a prescribed pressure, the first and second shell members compressively load and deform the seal device to effect a seal between the first and second shell members that prevents ingress of the submersion medium into the containment chamber; and when the shell pressure differential is less than the prescribed pressure, the seal device elastically rebounds to separate the first and second shell members to permit ingress of the submersion medium into the containment chamber.
US08166902B2	Barge system An improved barge system comprises a barge with a connecting system built into the barge. The connecting system includes several recessed areas about the periphery of the barge with upper and lower tubes about the peripheral edges of the barge. A connecting system with a vertical post having a lower connecting member and an upper connecting member is attached within each recessed area. The vertical post and upper connecting member are separated hinged within the recess for rotation into position to connect an adjacent barge by connecting the upper and lower connecting members to adjacent upper and lower tubes on the adjacent barges. An adjustable hinge and wedged lower end of the connecting member is provided for alignment of the upper connecting member with the vertical post. A liner on the upper connecting member provides load absorption and noise abatement, and torsion bars on the barge provide structural control.
US08166901B2	Dock system There is provided a dock having a pair of primary frame members and a pair of secondary frame members. A plurality of cross members extends between the pair of primary frame members. The dock includes a plurality of cross member connectors for connecting the cross members to the primary frame members. Each cross member connector includes a frame contact portion and a cross member engagement portion extending from the frame contact portion. The frame contact portion is connected to a respective one of the plurality of primary frame members. The cross member engagement portion defines a channel sized and configured to receive the alignment plate of a respective one of the plurality of cross members. A roller assembly may also be included for stabilizing the dock relative to an adjacent piling.
US08166900B2	Deceleration device of a personal watercraft A personal watercraft configured to eject water rearward from a body thereof to generate a propulsive force, includes a pair of right and left resistive elements which are attached to the body and configured to be able to receive water resistance during travel of the watercraft. The resistive elements are configured to move between an operating position and a non-operating position, the water resistance being larger in the operating position than in the non-operating position. Each of the resistive elements includes a pressure receiving section configured to receive the water resistance in the operating position, and wherein in the operating position, at least a portion of the pressure receiving section is located outward relative to a coupling portion where the resistive element is coupled to the body, in a width direction of the body.
US08166887B2	Sound systems for model railroad locomotives On-board model railroad speaker enclosure designs are presented that isolate back and front speaker waves. In one example, a first speaker may be disposed inside of a model steam locomotive tender, and a second speaker disposed inside of the model steam locomotive. Bass sounds and mid-range sounds may be separately directed to the first and second speakers, and isolated from mixing with one another.
US08166885B2	Suspended cable amusement ride An suspended cable amusement ride is disclosed. The cable is supported by turning beam assemblies and moved by turning beam drive assemblies. The turning beam assemblies and turning beam drive assemblies each have multiple sheave wheels supported in brackets along a turning beam. In the turning beam drive assembly the sheave wheels are driven by motors operably attached to the sheave wheels.
US08166883B1	Slide rail for a high-rail vehicle A tie plate slide structure comprises a tie plate slide frame having a first frame member and a second opposed frame member, the first frame member and the second frame member extending substantially parallel from a first upper end to a second lower end, a substantially central support structure extending from the first upper end to the second lower end, the substantially central support disposed between the first frame member and the second frame member, a support assembly having first and second rail wheels depending from a lower side of the tie plate frame, a gate assembly disposed near the lower end of the tie plate slide frame to discharge tie plates slidably moving downwardly along the first and second frame members and the central support structure.
US08166879B2	Detonator ignition protection circuit An ignition circuit for a detonator is disclosed. The circuit includes an igniter, a transient voltage suppressor (TVS), an energy source and a switch, all electrically connected in series with each other. Current flow through the igniter sufficient to ignite the igniter is prevented until an ignition voltage is applied across the TVS that is equal to or greater than the breakdown voltage of the TVS.
US08166873B2	Automated juice extractor An automatic juicer turns and pushes an upward facing juicing cone into a fruit for releasing and collecting juice. The juicer includes a base containing a motor, gear and shaft assembly which rises as a unit with the juicing cone. A fixed guide extends upward from the base and inner and outer shafts reside inside the fixed guide and are driven by the motor and gear assembly to rotate and advance the juicing cone into the fruit. The juicing cone, strainer and a bowl release and catch the juice. The outer shaft includes threads to vertically advance and retreat the outer and inner shafts when the outer shaft turns. The inner shaft rises with the outer shaft and lifts and rotates the juicing cone, thereby releasing juice from the fruit. The bowl is fixed to the base.
US08166871B2	Food product steamer A steamer for sandwich buns, bagels, croissants, cakes, vegetables, pastas, and other foods delivers fixed amounts of water onto a hot, dry platen through a vertically-oriented water conduit which is also thermally insulated from the hot platen and made from thermally insulating materials. The vertically-oriented water conduit retains water after a water supply is shut off at the beginning or end of a steam generating cycle. Orienting the conduit vertically reduces the surface area of liquid water exposed to air. Insulating the water conduit from the hot platen reduces the rate at which water standing in the conduit evaporates. Tubes used in the water conduit are insulating and easily removed from the water conduit assembly and flexible. Minerals that precipitate out of solution and become deposited onto the flexible tube are easily removed by flexing the flexible tube.
US08166866B2	Pneumatic brake booster A pneumatic brake booster with a booster housing is subdivided into at least one working chamber and at least one vacuum chamber by means of at least one axially movable wall capable of being acted upon with a pneumatic differential pressure. An actuable input member includes a valve piston, with an output member for acting upon a brake master cylinder with an output force. A control valve is arranged in a control housing and can be actuated by the valve piston for controlling the differential pressure. An elastic reaction element is arranged in a control housing recess and against which the output member bears. Means for setting a distance z between the valve piston and the reaction element are provided on the output member.
US08166864B2	Kit and method for converting a gas-operated gas-driven firearm to a gas-operated operating rod driven firearm A kit for modifying a bolt carrier group actuating apparatus of a firearm configured by its original manufacturer to have a gas-driven bolt carrier has a gas expansion assembly and an operating rod. The gas expansion assembly is configured for receiving combustion gases from an as-manufactured OEM gas block of a firearm and for facilitating expansion of the gases for generating a bolt carrier driving force. The operating rod is engagable between the gas expansion assembly and an operating rod engaging lug of a bolt carrier. The operating rod is configured to mechanically transmit the bolt carrier driving force to the operating rod engaging lug.
US08166862B2	Firing pin assembly A firing pin assembly with a firing pin having a shaft with a distal bearing thereon. The firing pin has a standby position, a load position, and a fire position. A cam engages the bearing and is configured to drive the shaft between the standby position and the load position. A spring about the shaft is compressed when the shaft is driven into the load position. A driver turns the cam when energized to drive the shaft from the standby position to the load position and then to turn the cam further whereupon the compressed spring urges the firing pin to fire.
US08166860B2	System for forming a miter joint The present invention is directed toward a system for forming miter joints including a miter saw and an angle gauge. The miter saw includes a platform with a kerf slot and a pair of arcuate slots. Each arcuate slot includes an associated rail located on the underside of the platform. A fence is coupled to each of the rails such that the fence may be pivoted with respect to the platform. The angle measurement tool is a one-handed tool including spring loaded paddles that measure the angle between intersecting surfaces. The angle measurement tool connects to the miter saw to permit the transfer of the measured angle to the fences.
US08166859B2	Paper trimmer Methods, systems and components for paper trimmers cut paper placed on a planar base using a blade that is moved transversely across the paper. A recessed cutting track containing a desired cutting pattern is inserted into the planar base and a counterpart guide track suspended thereover. A blade assembly is inserted through a channel in the guide track with the cutting blade residing in the counterpart channel in the cutting track. Material to be trimmed is placed between the recessed cutting track and the guide track. As the blade assembly is directed along the length of the counterpart channels, guides on the blade assembly interact with the channel and cause the cutting blade to rotate, cutting along the path of the channel. Desired cuts are made by selecting appropriate interchangeable cutting tracks and counterpart guide tracks.
US08166858B2	Trim ejector for ejecting the trim produced by a rule of a rotary steel rule die apparatus or the like A trim ejector for ejecting the trim produced by a steel rule of a rotary steel rule die apparatus includes a die cylinder having a die board provided with the rule and an anvil roll positioned parallel to the die cylinder to define a sheet receiving gap therebetween. The trim ejector has a flexible body defining a trim-ejecting surface extending between an ejecting edge and a stem portion, an anchor portion connected to the stem portion of the flexible body for securing the flexible body to the die board to position the ejecting edge of the flexible body adjacent and parallel to the rule, and a compressible biasing member secured to the flexible body on a side opposite the trim-ejecting surface. The compressible biasing member forces the flexible body to a neutral position, corresponding to no tension being applied to the stem portion, when the flexible body is moved away from the neutral position under passage of a sheet in a sheet receiving gap.
US08166854B2	Shearing device In a shearing device (10), a plate-like work piece (50) is seated on a die (20) positioned on a lower side thereof is clamped by a pad (30), so that a predetermined portion of the work piece (50) is processed into a predetermined shape by a punch positioned on an upper side thereof. The punch (40) integrally has a heel portion (41). The heel portion is so as to broadly contact an outer peripheral face (51) of the predetermined portion to be processed of the work piece (50), thereby restraining the outer peripheral face (51) from moving in an outward direction perpendicular to a thickness direction.
US08166847B2	Multi-group transmission A multi-group transmission (1) is proposed, comprising a gearbox actuator, in which an exhaust channel (3) is provided in the gearbox housing (2), said channel extending from a gearbox compartment (4) provided on the gearbox housing (2) for the installation of the gearbox actuator, to the output sensor (5), whereby the gearbox compartment (4) also serves as a collecting chamber for exhaust air.
US08166832B2	Oil sampling device having a flexible piston and chamber A device, system, and method for retrieving a sample of oil from an engine, comprising, a chamber having an inside wall and at least one oil inlet, a piston head received in said chamber and slidable between an empty position in which it is disposed substantially at said inlet and a filled position in which it is a first distance from said inlet, a handle affixed to said chamber, and a piston member extending between said handle and said piston head, said piston member comprising a flexible member having a proximal end and a distal end, said distal end being affixed to said piston head.
US08166828B2	Fluid flow meter Fluid flow meters and methods for measuring different aspects of fluid flow with a non-contact sensor are provided. In some cases a fluid flow gear meter is provided with a fluid chamber that is sealed with a cover portion carrying the non-contact sensor. An optional separation member may be located between the cover portion and the chamber to seal the chamber. In some cases the cover portion and/or separation member are configured to transmit visible light to allow viewing of the fluid chamber, through material selection and/or the presence of viewing cavities within the material. The flow meter is optionally configured to prevent or reduce the transmission of ambient environmental radiation into the flow meter to lessen the likelihood that it may adversely affect an optical non-contact sensor used to detect movement of gears within the chamber.
US08166823B2	Membrane-coupled ultrasonic probe system for detecting flaws in a tubular An ultrasonic probe apparatus for detecting flaws in a tubular includes a probe housing. The probe housing has an axial axis, a central cavity lying along the axial axis, and a bottom face adapted for placement on the tubular. The bottom face of the probe housing has an opening in the middle. A probe support is disposed within the central cavity and rotatable about the axial axis of the probe housing. An ultrasonic probe is mounted on the probe support and has a scanning face exposed to the opening of the bottom face of the probe housing, and may be coupled to the pipe with a liquid acoustic couplant medium.
US08166820B2	Method for detecting a sonic imprint of a three-dimensional object and related apparatus Non invasive method used to detect a “sonic imprint” of three-dimensional objects, particularly suitable for the identification and monitoring of artworks, consisting in acquiring the vibrations caused by a source of elastic waves and using a set of detectors fixed in various predetermined points of the external surface of the object. An apparatus, cheap and simple to utilize, suitable to execute this method, is also described.
US08166812B2	Vibrating wire viscometers Vibrating wire viscometers are disclosed. An example apparatus to determine the viscosity of a downhole fluid is described, the apparatus including a wire to be immersed in a downhole fluid, to vibrate when an alternating current is applied to the wire within a magnetic field, and to generate an electromotive force when vibrating within the magnetic field, the wire comprising a first resistance. The apparatus further includes a nulling circuit coupled to the wire, wherein the nulling circuit comprises a second resistance that is selectable to be substantially equal to the first resistance, and an analyzer coupled to the wire and the nulling circuit to determine the first resistance, the second resistance, and a viscosity of the downhole fluid based on the first and second resistances, at least one characteristic of the wire, and the electromotive force.
US08166799B2	Gas concentration distribution measuring apparatus A gas concentration distribution measuring apparatus includes a gas detection part, a gas detector position information measuring part, and a gas concentration distribution display unit. The detection part includes gas detectors provided at mutually different positions to measure a concentration of a predetermined gas, and moves while maintaining relative positions of the detectors. The position information measuring part measures position information of the detectors of the detection part. And, measured values of gas concentrations measured by the detectors of the detection part and position information of the detectors measured by the position information measuring part when the detectors finish measurement of gas concentrations are inputted in the display unit, then the display unit displays a distribution of concentrations of the predetermined gas in a space in which the detection part moves, based on the measured values of the gas concentrations and the position information of the detectors.
US08166793B2	Method and device for the technique of cold microforging any freely formed 3-D surfaces An electromechanical knocking activated device and method for working and cold-hardening the surface of tools, machine parts, etc. is disclosed. The electromechanical apparatus may include: an impact head which is secured to a support, wherein at least one part of the support is composed of a ferromagnetic material; and at least one coil which is also secured to the support. A magnetic field holds the impact head in a defined position of rest. The coil is may be positioned in the same magnetic field or a second magnetic field, through which an alternating or pulsed current may flow. As a result, the impact head is made to oscillate with a defined impact frequency, impact altitude and zero crossing. The device may be used in combination with a computer aided manufacturing system.
US08166783B2	Anti-tampering arrangements for pin tumbler cylinder locks A pin tumbler cylinder lock includes a shell, a plug, and at least first and second tumbler pins and first and second driver pins. At least the first driver pin extends into a corresponding plug channel when the plug is in a locked condition, such that rotation of the plug with respect to the shell is blocked. The lock is configured such that at least the first driver pin is separated from the first tumbler pin by a gap when the plug is in the locked condition. When the first and second tumbler pins are raised without the proper key and the gap between the first tumbler pin and the first driver pin is eliminated, the second tumbler pin extends across the shear line and into the corresponding shell channel.
US08166779B2	Baffle system for blank molds of a glassware forming machine A baffle system for blank molds of a glassware forming machine, in accordance with an exemplary embodiment of the present disclosure, includes a first shaft mounted for movement in the direction of its axis and for rotation around its axis. A baffle arm is mounted to the first shaft and a manifold is suspended from the baffle arm. A plurality of baffle holders are suspended from the manifold, and rocker arms interconnect the baffle holders for equalizing forces applied by the baffle holders to the blank molds of a glassware forming machine. A second shaft is adjacent to the first shaft and a link arm extends between the second shaft and the manifold. The baffle arm, the manifold and the link arm form a linkage that moves the baffle holders between a first position overlying the blank molds and a second position spaced from the blank molds. Disposition of the rocker arms between the manifold and the baffle holders permits the manifold to be folded under the baffle arm in the second position of the baffle arm, the manifold and the baffle holders. The link arm preferably is coupled to the second shaft for longitudinal and pivotal movement on the second shaft, and a wear block preferably is carried by the baffle arm and engages the link arm adjacent to the second shaft for supporting the link arm during movement of the link arm on the second shaft.
US08166776B2	Multichannel heat exchanger A heating, ventilation, air conditioning and refrigeration (HVAC&R) system having a compressor, a heat exchanger, an expansion valve, and a multichannel heat exchanger connected in a closed refrigerant loop. The multichannel heat exchanger has at least two fluid flow paths cooled by a flow of air from an air-moving device through the multichannel heat exchanger. Each of the at least two fluid flow paths have an inlet and an outlet in communication there between. The multichannel heat exchanger also has at least one flow regulator disposed in at least one outlet to regulate through at least one fluid flow path in response to the air flow through the heat exchanger to achieve a substantially equal temperature of a fluid flowing in the at least two flow paths.
US08166775B2	Noise attenuating device for a heating-ventilation-cooling system of a motor vehicle A system and method for reducing noise in an automotive heating, ventilation, and cooling system is described. A noise attenuation device using radial vanes upstream of a flow discontinuity, such as a bend in the ducting, and downstream of a blower fan is used to reduce noise.
US08166770B2	Apparatus and method for cooling electrical equipment An HV_ECU executes a program, which includes a step of receiving route information; a step of acquiring a duty command value of a battery cooling blower; a step of calculating a cooling airflow; steps for acquiring a battery temperature and an intake temperature; a step of calculating a value TB−TC; a step of calculating a cooling performance; a step of estimating a battery temperature; and a step of performing fail safe processing when in an abnormal state.
US08166768B2	Systems and methods for passively directing aircraft engine nozzle flows Systems and methods for passively directing aircraft engine nozzle flow are disclosed. One system includes an aircraft nozzle attachable to an aircraft turbofan engine, with the nozzle including a first flow path wall bounding a first flow path and being positioned to receive engine exhaust products, and a second flow path wall bounding a second flow path and being positioned to receive engine bypass air. The first flow path wall is positioned between the first and second flow paths, and the second flow path wall is positioned between the second flow path and an ambient air flow path. Multiple flow passages can be positioned in at least one of the first and second flow path walls to passively direct gas from a corresponding flow path within the flow path wall through the flow path wall to a corresponding flow path external to the flow path wall. Neighboring flow passages can have neighboring circumferentially-extending and circumferentially-spaced exit openings positioned at an interface with the corresponding flow path external to the flow path wall.
US08166767B2	Gas turbine combustor exit duct and hp vane interface An assembly for a gas turbine engine includes a combustor and a vane assembly disposed downstream thereof. A portion of an outer platform of the vane assembly defines an axial sliding joint connection with the combustor, and includes a plurality of depressions located in an outer circumferential surface thereof opposite the combustor. The depressions are disposed in regions of expected higher thermal growth about the circumference of the outer platform such that thermal growth of the entire outer platform is substantially uniform circumferentially therearound.
US08166764B2	Flow sleeve impingement cooling using a plenum ring A combustor assembly for a turbine engine includes a combustor liner, a flow sleeve and a plenum ring. The flow sleeve surrounds the combustor liner to form an annulus radially between the combustor liner and the flow sleeve. The flow sleeve has a plurality of rows of cooling holes. The plenum ring radially surrounds the combustor liner in the annulus. The plenum ring has a plurality of bypass tubes for directing axial air flow and radial flow chambers for directing radial air flow.
US08166760B2	System and method for storing energy A system includes at least one body, a link for suspending the body for movement with gravity from a first elevation position to a second elevation position, and an electrical energy generator coupled with the body through the link to drive the generator to generate electricity upon movement of the body with gravity from the first to the second elevation position. The at least one body has a mass of at least approximately 100 tonnes; the first and the second elevation positions define a distance therebetween of at least approximately 200 meters; and/or the system further includes an operator configured to operate the link to controllably move the at least one body against gravity from the second to the first elevation position to increase a gravitational potential energy of the at least one body, and to maintain the gravitational potential energy of the at least one body.
US08166756B2	Turbine intake pressure release structure A turbine intake pressure release structure to control pressure release between a throttle and a first turbine boosted pressure outlet includes a pressure release valve which has a first pressure orifice, a second pressure orifice and a housing chamber, at least one controller which has a pressure detection end and a driven portion and a switch duct which has a first end opening, a second end opening and a third end opening. The first end opening is connected to a third turbine boosted pressure outlet. The second end opening leads to the atmosphere. The third end opening is connected to the second pressure orifice. The driven portion runs through the switch duct to close the second end opening through the driven portion drive a membrane to a first position or closes the first end opening through the driven portion to drive the membrane to a second position.
US08166755B2	Turbocharger system with turbine bypass valve actuated by multiple-rate fluid pressure actuator A fluid pressure actuator for a turbocharger system's turbine bypass valve comprises a piston slidable in a cylinder so as to define a chamber containing a compression spring assembly operable to exert a spring force on the piston. The cylinder can be selectively subjected to a vacuum or pressure for exerting a fluid pressure force on the piston in a direction opposite from the spring force. The spring assembly comprises a first spring arranged to be compressed by the piston throughout a first range of motion of the piston in a compression direction, and at least a second spring arranged to be compressed by the piston throughout a second range of motion that is smaller than and co-terminal with the first range of motion but to be uncompressed during an initial part of the first range of motion of the piston in the compression direction.
US08166753B2	Accumulator system and method of monitoring same An accumulator system includes an accumulator containing working fluid and gas, an isolation valve through which working fluid selectively flows to and from the accumulator, an actuator operably coupled to the isolation valve, and a passageway fluidly communicating the actuator with gas in the accumulator. The actuator maintains the isolation valve in an open configuration at a first gas pressure to allow working fluid to flow to and from the accumulator. The actuator also allows the isolation valve to close at a second gas pressure less than the first gas pressure.
US08166751B2	Particulate filter A filter includes a housing including an inlet and an outlet, and the housing includes a first section and a second section. The filter also includes a plurality of parallel channels defined by a plurality of porous walls within the first and second sections of the housing. The plurality of channels extend between the inlet and the outlet. The plurality of channels in the first section of the housing includes at least one first channel including an inlet stopper and at least one second channel including an outlet stopper. The plurality of channels in the second section of the housing including at least one open channel.
US08166743B2	Spun staple yarns made from blends of rigid-rod fibers and fibers derived from diamino diphenyl sulfone and fabrics and garments made therefrom and methods for making same This invention relates to a flame-resistant spun staple yarns and fabrics and garments comprising these yarns and methods of making the same. The yarns have 20 to 50 parts by weight of a polymeric staple fiber containing a structure derived from a monomer selected from the group consisting of 4,4′diaminodiphenyl sulfone, 3,3′diaminodiphenyl sulfone, and mixtures thereof; and 50 to 80 parts by weight of a rigid-rod staple fiber, based on 100 parts by weight of the polymeric fiber and the rigid-rod fiber in the yarn.
US08166742B2	Uncured composite rope including a plurality of different fiber materials An uncured, composite rope includes at least one inner tow of structural fibers of a first material and a plurality of outer tows of structural fibers disposed about the at least one inner tow, the structural fibers of at least one of the plurality of outer tows being made from a second material that is different from the first material. The uncured, composite rope further includes an uncured polymeric resin impregnated into the at least one inner tow and the plurality of outer tows.
US08166736B2	Crop-conditioning apparatus having hydraulic tension mechanism As crop materials are severed from the field, they pass through two successive pairs of counter-rotating conditioning rolls before being returned to the ground. The front rolls are preferably ribbed, metal rolls wherein the ribs of one roll are intermeshed with those of the other roll so as to crimp the stems of the crop materials as they pass between the rolls. The hard metal ribs also aggressively feed the materials rearwardly into the second set of rolls, which are preferably compressive surface rolls made of rubber or the like and provided with wide, intermeshed bars about their periphery. The tension mechanism for the rolls includes single-acting hydraulic cylinders that squeeze the rolls together to the extent permitted by adjustable stop structure used to set gaps between the rolls. An accumulator is hydraulically connected to the hydraulic cylinders for cushioning the tension mechanism.
US08166733B2	Method for making tamper evident card carrier Techniques for providing cost effective and tamper evident prepaid card packaging are described. By forming a cutout in a panel of the prepaid card packaging, covering the cutout with a material such as red glassine, and aligning an activation bar code or other indicia on the card with the cutout when mounting the card within the packaging, the security of the activation indicia can be better maintained. After purchase, the bar code can be scanned through the red glassine but prior to purchase, the red glassine prevents photocopying.
US08166731B2	Method and apparatus for supplying gas to an area Embodiments of the present invention are directed to various designs and packaging methods for a gas delivery device and materials for supplying one or more predetermined gases to a target area as well as to application specific opthamological embodiments. With regard to the gas delivery device, the device may include a reservoir, a gas diffusion portion for communicating gas from the reservoir and one or more predetermined gases at concentrations greater than atmospheric contained within the reservoir, wherein the device does not generate gas and may be packaged prior to use with the one or more predetermined gases.
US08166728B1	Protective shield assembly and method A method of protecting an existing surface includes providing a surface to be protected; providing at least one shield section including a plurality of protective shield assemblies, each of the protective shield assemblies including a corrugated panel and a protective shield base carried by the corrugated panel; and attaching the corrugated panel to the surface with the protective shield assembly facing away from the surface.
US08166727B2	Automated brick laying system for constructing a building from a plurality of bricks An automated brick laying system (10) for constructing a building from a plurality of bricks (16) comprises a robot (12) provided with a brick laying and adhesive applying head (18), a measuring system (13), and a controller (14) that provides control data to the robot (12) to lay the bricks (16) at predetermined locations. The measuring system (13) measures in real time the position of the head (18) and produces position data for the controller (14). The controller (14) produces control data on the basis of a comparison between the position data and a predetermined or pre-programmed position of the head (18) to lay a brick (16) at a predetermined position for the building under construction. The controller (14) can control the robot (12) to construct the building in a course by course manner where the bricks (16) are laid sequentially at their respective predetermined positions and where a complete course of bricks for the entire building is laid prior to laying of the brick for the next course.
US08166718B2	Horizontally engineered hardwood floor and method of installation Horizontally engineered floor boards are provided by this invention. The floor board includes a top decorative layer placed on a plurality of strips. The plurality of strips are arranged to have some in X-axis orientation and some in Y-axis orientation. The plurality of strips also has characteristics that allow the wood floor board to be installed as a tile.
US08166708B2	Integrated glass run and upper reveal with film An integrated reveal molding is provided for a motor vehicle door frame having a header section defining a window opening. The integrated reveal molding includes an upper reveal adapted to be mounted to the header section. The upper reveal includes a reveal surface disposed outboard of the header section. A reveal is secured along the reveal surface. The integrated reveal molding also includes a glass run co-extruded with the upper reveal. The glass run includes a window receiving channel for engagement with a window pane. The integrated reveal molding is formed as an extruded member from thermoplastic vulcanisate (TPV) of different durometer values to meet varying flexibility and durability requirements.
US08166706B2	Multipositional vault door The present invention relates to a vault door mechanism that assists a user in opening or closing the door. A hold-open arm and hinge plate pivotally interconnect the door to a surrounding frame and are fixed in place by an associated locking mechanism. The locking mechanism stops the door in the partially opened position prior to being fully opened or closed, thereby assisting the user in handling the door. The details of the present invention, and the manner in which they interrelate, will be described in greater detail hereinafter.
US08166700B2	Indoor greenhouse Described herein is an indoor greenhouse that includes a rack unit, an outer layer that surrounds the rack unit and defines a greenhouse interior, at least one light surrounded by a light enclosure, a cooling system, and a ventilation system all disposed in the greenhouse interior. The ventilation system includes a fan, a filter and at least one duct that cooperate to exhaust air out of the exhaust vent opening. The rack unit includes a top, a bottom, and an intermediate portion extending therebetween. The outer layer includes a top, a bottom, and an intermediate portion extending therebetween that correspond to the similar portions of the rack unit. The outer layer also has intake and exhaust vent and light cooling openings defined therein. The cooling system includes at least one duct that cooperates with the light enclosure to define an air path between the intake and exhaust light cooling openings.
US08166698B2	Reflex sight for weapon A weapons reflex sight including a display substrate mounted on a weapon, and an optics module, disposed in a housing, the optics module including a computer-generated imagery (CGI) system and optical elements for generating images and projecting a beam of the images on the display substrate, the images including an aimpoint for aiming at a target and information related to use of the weapon.
US08166697B1	Rifle scope indicia system A rifle scope indicia system preferably includes a mounting base, a marker turret and a plurality of marker pins. The mounting base is attached to a top of an elevation turret of a rifle scope. The marker turret includes a plurality of marker openings formed at a perimeter thereof for receiving the plurality of marker pins. The marker turret is preferably removably attachable to the mounting base. The plurality of marker pins may be illuminated with an illumination circuit. A light emitting device of the illumination circuit is retained in an internal cavity of the marker turret. An illumination conduction ring is placed below the marker turret to illuminate any translucent marker pins. A reference marker pin inserted into the marker turret may be coordinated with a marker applied to the parallax wheel or the parallax bell of a rifle scope.
US08166696B2	Rifle scope with adjustment stop Rifle scopes with adjustment stops include a scope body, a movable optical element defining an optical axis enclosed by the scope body, and a turret having a screw operably connected to the optical element for adjusting the optical axis in response to rotation of the screw. The turret has a stop element selectably engaged to the screw. The body defines a stop surface positioned for engagement by the turret stop element to limit rotation of the screw, such that the relative position at which the stop element is secured to the screw defines a zero position of the screw and the movable optical element. The stop element is held against the stop surface by an indexing portion while the relative position at which the stop element is secured to the screw to define the zero position is determined.
US08166694B2	Firearm securing device and method Embodiments include a method and apparatus for removably connecting a firearm, accessory, or tool to a surface, material, object, belt, vehicle, pocket, or tactical equipment. The apparatus may include a first connecting member operatively connectible to the firearm, accessory, or tool and a second connecting member operatively connectible to the surface, material, object, belt, vehicle, pocket, or tactical equipment. The first connecting member and second connecting member are capable of connection to one another to connect the firearm, accessory, or tool to the surface, material, object, belt, vehicle, pocket, or tactical equipment.
US08166691B1	Ambidextrous magazine catch An ambidextrous magazine catch mechanism for a pistol includes a button in the pistol frame. The button has a W-shaped camming surface. A magazine has a catch aperture. A catch includes two upwardly disposed legs connected to one another. A first leg has a tooth to mate with the catch aperture. The first and second legs form a spring having an equilibrium position. When the first leg is pressed toward the second leg, an outward force on the first leg biases the catch toward the equilibrium position. The first leg has a W-shaped camming surface to mate with the camming surface of the button. The button has a neutral position, and a first and second depressed position. In the neutral position, the camming surface of the button mates with the camming surface of the first leg and the tooth is engaged in the aperture to secure the magazine. In the first depressed position, a first side of the button is depressed such that the camming surface of the button moves against the camming surface of the first leg such that the first leg is urged toward the second leg to disengage the tooth from the magazine.
US08166688B1	Device for securing identification A device for securing identification to a mounting surface includes an elongated mounting device having a front surface and a rear surface and at least one opening between the surfaces wherein an identification means may be inserted or removed and an adhesive applied to the rear surface of tile mounting device for adhering the mounting device to the mounting surface where the opening is a sleeve formed by a laminate of plastic film adhering to a predetermined pattern of applied adhesive to a rear surface. The device may be economically created in multiples using adhesive label stock in either roll or sheet form.
US08166687B2	Electric fireplace with flame curtain The invention relates to a An electric fireplace with a flame curtain comprises a housing, a light source, a flame curtain with integral structure being disposed on the electric fireplace and in front of an electric fireplace flame generator, an imaging mechanism and a charcoal bed being disposed on the flame curtain, and a number of light-holding charcoal with a plurality of transparent surfaces being disposed on the charcoal bed. The essential effect of the present invention is to solve the problems of constant charcoal flame brightness, the lacking of reality and the bad charcoal flame simulation effect in conventional electric fireplaces. Meanwhile, the problems of constant charcoal flame shape, dull appearance and poor visual effect in conventional electric fireplace are solved as well. The present invention is of simple structure and easy assembly process, while the charcoal flame structure can be arbitrarily changed, the light-spots of the flame are sparkling intermittently with bright and shade, and the flame is of light-holding effect. The visual effect and the authenticity are both perfect.
US08166686B2	Cup labeling system An apparatus and a system for affixing a label to a cup, bottle and/or container is provided. The apparatus and system may allow for affixing a pre-printed label having a plurality of colors and indicia thereon to a cup whereby the label may be viewed as integral part to the cup itself. The preprinting of the labeling prior to the affixation of the cup insures consistency and uniformity of the indicia thereon. Additionally, the printing of the label prior to affixing it to the cup may allow the printer to ensure proper angles of the indica prior to the application of the label onto the desired cup apparatus. Moreover, the present invention may allow for the peeling away of a portion if the label to review the outside edge of the receiving cup/container.
US08166677B1	Manual snow plow A manual snow plow with ergonomic features comprises a snow scoop, two (2) articulating struts extending upward from the scoop and two (2) hinged rounded braces placed against a user's shoulders during use. The struts are provided with cross bracing which provide size adjustability and stability to the plow. A set of position adjustable hand grips extend from each strut in a rearward fashion to control the device during use. A pair of casters provided on a rear of the snow scoop allows the device to ride over cracks and other uneven surface variations. The snow plow becomes an extension of the user's body and thus enables the user to use the force of their entire body to move snow.
US08166676B2	Post-puller and method A method of removing a T-type fence post from the earth with a powered, mobile piece of equipment controlled by a human operator includes attaching a substantially flat plate to a lift arm of the powered, mobile piece of equipment such that the plate hangs substantially vertically from the lift arm and can move in an arc, the plate having an opening with a top wall and a bottom wall, moving the powered, mobile piece of equipment in a first direction to pull the plate over the fence post such that an upper portion of the post enters the opening with the bottom and upper walls of the opening engaging the post with sufficient force to retain the post in the opening when the post is pulled from the earth and raising the lift arm to pull the post from the earth in a substantially vertical direction.
US08166675B2	Shoe tongue centralizer The shoe tongue centralizer assembly includes a binding post and a centralizer band which, together prevent the tongue of any type of laced shoe, boot, or other footwear from significant movement either laterally or longitudinally in the footwear.
US08166673B2	Air bladder footbed A sole system for an article of footwear comprising: an outsole layer and an insole layer, each of which include a vertically extending opening, a midsole layer disposed between the outsole and insole layers and including a bottom surface, a top surface, and an opening that extends vertically through the midsole layer to define a cavity therein, the cavity opening having a first dimension at the bottom surface substantially corresponding to the outsole layer opening and a second dimension at the top surface substantially corresponding to the insole layer opening; and a bladder element having a top and a base, wherein a portion of the bladder element is secured within the midsole cavity such that the top extends into at least a portion of the insole layer opening and the base extends into the outsole layer opening, wherein the bladder element and the midsole cavity include corresponding shapes and dimensions.
US08166668B2	Method for the preparation of fluoropolymer powdered materials A method for the preparation of fluoropolymer powdered materials is disclosed. A suspension of solid fluoropolymer particles in a liquid carrier, preferably water, is frozen and the frozen carrier is then removed by sublimation at sub-atmospheric pressure to produce a dry powder of fluoropolymers particles.
US08166666B2	Compact gas dryer and method for manufacturing the same A compact gas dryer (100) comprises a primary heat exchanger (200) exchanging heat between hot, incoming, contaminated gaseous medium and outgoing dry, cool gaseous 5 medium, a secondary heat exchanger (300) exchanging heat between incoming cold gaseous medium from the primary heat exchanger (200) and a refrigerant, and a condense trap (400) trapping condensable matter in the cooled gaseous medium exiting the secondary heat exchanger (300). 10 Afterwards, the dry, cool gaseous medium exchanges heat with the incoming contaminated gaseous medium in the primary heat exchanger. The primary heat exchanger (200), the secondary heat exchanger (300) and the condense trap (400) are combined into a single unit (100).
US08166663B2	Evidence preservation items The kit described herein may include a first measurement element capable of measuring in at least the x and y planes without substantially moving the element. The kit may further include a second measurement element capable of measuring in at least the x and y planes without substantially moving the second element. In one embodiment, the measuring element is substantially rectangular, has an internal opening and it includes at least a first axis along the x-axis and a second axis along the y-axis. In another embodiment, the measuring element comprises an “L” shape having a first axis along the x-axis and a second axis along the y-axis, wherein each axis has a length of more than 150 cm.
US08166658B2	Razor A shaving aid member pivots in a predetermined range from an initial position to a pivot position with respect to a razor head against elastic force of leaf springs. In the shaving aid member, a mounting portion of a base member is aligned with the razor head and two arm portions of the base member are invisible from the front side of the razor head. This reduces the space occupied by the arm portions outside the outer peripheral portion of the razor head. As a result, in a razor with a shaving aid, comfort in use is enhanced. Further, the razor is compact-sized since the surface area of the front side of the portion outlined by the razor head and the shaving aid member is decreased.
US08166655B2	System for component positioning during assembly of scroll-type fluid machine A positioning system used in assembling a scroll-type fluid machine exerts a horizontal thrust on a stationary scroll in a direction opposite to a direction in which an eccentric shaft end portion formed at one end of a rotary shaft is oriented while turning the rotary shaft, and determines an orbital path of the stationary scroll by measuring horizontal displacements thereof. While exerting the horizontal thrust, the positioning system incrementally presses the stationary scroll against a guide frame until a stable orbital path of the stationary scroll is obtained. When the orbital path is judged to be stable, the positioning system determines a fixing point on which the stationary scroll should be fixedly centered with respect to the guide frame, so that a scroll wrap of the stationary scroll and a scroll wrap of an orbiting scroll are correctly intermeshed, forming a series of pockets therebetween.
US08166654B2	Method for component positioning during assembly of scroll-type fluid machine A positioning system used in assembling a scroll-type fluid machine exerts a horizontal thrust on a stationary scroll in a direction opposite to a direction in which an eccentric shaft end portion formed at one end of a rotary shaft is oriented while turning the rotary shaft, and determines an orbital path of the stationary scroll by measuring horizontal displacements thereof. While exerting the horizontal thrust, the positioning system incrementally presses the stationary scroll against a guide frame until a stable orbital path of the stationary scroll is obtained. When the orbital path is judged to be stable, the positioning system determines a fixing point on which the stationary scroll should be fixedly centered with respect to the guide frame, so that a scroll wrap of the stationary scroll and a scroll wrap of an orbiting scroll are correctly intermeshed, forming a series of pockets therebetween.
US08166652B2	Method of making a circuit structure of a circuit board A circuit structure of a circuit board includes a dielectric layer, a number of first circuits, and a number of second circuits. The dielectric layer has a surface and an intaglio pattern. The first circuits are disposed on the surface of the dielectric layer. The second circuits are disposed in the intaglio pattern of the dielectric layer. Line widths of the second circuits are smaller than line widths of the first circuits, and a distance between every two of the adjacent second circuits is shorter than a distance between every two of the adjacent first circuits.
US08166651B2	Through wafer vias with dishing correction methods A method of forming a through wafer via including forming the through wafer via (TWV) into a substrate and through a first dielectric layer over the substrate; planarizing the first dielectric layer using a chemical mechanical polish before forming a second dielectric layer; forming the second dielectric layer over the substrate and the TWV; forming at least one first contact through the second dielectric layer and to the TWV; forming at least one second contact through the second dielectric layer and the first dielectric layer directly and electrically connected to another structure upon the substrate; and forming a first metal wiring layer directly over the second dielectric layer, the first metal wiring layer directly and physically contacting the at least one first contact and the at least one second contact.
US08166647B2	Method of manufacturing a printed circuit board A printed circuit board and a method for manufacturing the printed circuit board are disclosed. The method can include; providing an insulated layer, in which a first metal layer is formed on one side of the insulated layer; forming a groove on the insulated layer; forming a metallic substance on an inner side of the groove and on another side of the insulated layer; and forming a first circuit pattern on at least one of one side of the insulated layer and the metallic substance formed on the groove by removing a portion of the first metal layer. The present invention provides the printed circuit board having a high efficiency of heat emission by disposing a heat sink in direct contact with a board and the method of manufacturing the printed circuit board.
US08166646B2	Method for connecting two objects electrically A groove, and a recess which communicates with the groove, are formed in a substrate. Next, a through hole which communicates with the groove is formed. Thereafter, a wire is formed on an upper surface of the substrate, and an individual electrode is arranged on a lower surface of the substrate. Further, a droplet of an electroconductive liquid is made to land on the recess, and the liquid is filled in the through hole via the groove. Next, the liquid filled in the groove, the recess, and the through hole is heated to harden. Further, the recess and the groove of the substrate are removed by cutting up to an area near the through hole. Accordingly, it is possible to connect electrically the connecting bodies arranged on both surfaces of the substrate by filling an electroconductive material in the through holes easily.
US08166639B2	Coaxial cable connector attaching tool having connector magazine A connector attaching tool is for attaching a coaxial cable connector to a coaxial cable by longitudinal compression of the coaxial cable connector. The tool includes a tool body defining therein a connector compression chamber and a plunger receiving chamber longitudinally adjacent thereto. A plunger having a plunger head is within the plunger receiving chamber and a plunger shaft extends outwardly therefrom. A handle is carried by the tool body and is movable from a retracted position to a compressed position for advancing the plunger shaft to drive the plunger head to longitudinally compress the coaxial cable connector within the connector compression chamber to thereby attach the coaxial cable connector to the coaxial cable. The tool body defines a connector magazine chamber for storing a plurality of coaxial cable connectors. A biasing member is within the connector magazine chamber for urging the coaxial cable connectors toward the connector compression chamber.
US08166622B2	Machine for machining optical workpieces, in particular plastic spectacle lenses A machine for machining workpieces, for example plastic spectacle lenses, has a workpiece spindle which rotates the workpiece about a workpiece rotation axis, and a fast tool arrangement which moves a turning tool in the direction to and from the workpiece, wherein the workpiece spindle and the fast tool arrangement can moreover be moved relative to one another in a direction transverse to the workpiece rotation axis. A tool holder is connected to the fast tool arrangement and carries the turning tool. An engraving tool is spaced from the workpiece rotation axis and has an essentially point-shaped end facing towards the workpiece. The engraving tool can be moved in the direction of the workpiece and away therefrom in a highly dynamic manner via the tool holder, so that a marking can be produced on the workpiece in particular by a needling engagement of the engraving tool with the workpiece.
US08166614B2	Auxiliary handle for hand-held power tool An auxiliary handle for a hand-held power tool (7) includes a lockable lag hinge (46) provided between the clamping section (21) and the gripping member (34) and having a pivot pin (47), a tensioning member (51) for tightening and loosening the clamping section (21) and arranged on an end (48) of the pivot pin (47) of the lag hinge (46), a locking device (41) for locking and releasing the lag hinge (46), and an independent from the tensioning member (51), unlocking device (56) for releasing the locking device (41) and having an actuation member (62) upon actuation of which, the locking device (41) is displaced from its locking position in which the lag hinge (46) is locked to its release position in which the lag hinge (46) is released.
US08166607B2	Upright vacuum cleaner Several embodiments of an upright surface cleaning apparatus are disclosed. The surface cleaning apparatus has a first cyclonic cleaning stage and comprises a surface cleaning head having a dirty fluid inlet. A fluid flow path extends from the dirty fluid inlet to a clean air outlet of the upright surface cleaning apparatus. A support member is mounted to the surface cleaning head. A mounting member mounted to the support member. At least one of a first cleaning stage of the upright surface cleaning apparatus and a suction motor is mounted directly or indirectly to the mounting member. A suction motor is provided in the fluid flow path.
US08166606B2	Squeegee assembly A squeegee assembly (10, 10′) includes a flexible wiper blade (30) sandwiched between a mounting bracket (32, 32′) and a retaining strap (34, 34′). A retainer (94) has a head (98) which is positionable between aligned and misaligned positions with mounting apertures (82, 92) to allow disassembly, assembly and retention of the squeegee assembly (10, 10′). Arcuate portions (36, 36′, 66, 66′) formed in the mounting bracket (32, 32′) and the retaining straps (34, 34′) have different radiuses. Linear portions (68, 68′, 70, 70′) of the retaining straps (34, 34′) have upper and lower edges (72, 74) bent from center portions thereof. The mounting brackets (32, 32′) include L-shaped slots (46) for slideably receiving vertical bolts (56) of the floor maintenance machine (12).
US08166597B2	Flat mop with abrasive pad A cleaning device that includes a first component, a second component and a handle. The first component is configured to hold a first portion of the cleaning device. The second component is configured to hold a second portion of the cleaning device. The first and second components are connected and are configured so that the first portion and the second portion on the respective first and second components are independently replaceable. The handle is coupled to the second component to control an application of at least one of the first portion and the second portion of the cleaning device on a surface to be cleaned.
US08166596B2	Construction method for girder in bridge, crane for pulling up girder, vehicle for carring girder, and girder used for the same A construction method for a girder in a bridge in which a plurality of piers are installed in an interval in a longitudinal direction of the bridge, a plurality of copings are installed on the piers, and a plurality of girders respectively installed between the piers are installed on the copings. The method comprises the steps of: installing at least one temporary girder on a front coping of the copings and a rear coping adjacent to the rear coping of the copings; installing a crane for pulling up a girder having a girder pulling up space therein guided by the temporary girder; and providing with a girder by a pre-cast method so as to install a girder on the front coping and the rear coping.
US08166593B1	Stabilizing system The stabilizing system has a ramp having a first end mounted within a vehicle and a second end positioned on a base surface external to the vehicle. The stabilizing system further includes a tension mechanism having a first end section, a second end section, and a tension member positioned therebetween. The first end section of the tension mechanism is releasably coupled to the vehicle and the second end section of the tension mechanism is releasably coupled to the first end of said ramp. The ramp is maintained in fixed location with respect to said vehicle and said base surface.

1 2 3 4 5 6 7 8 9 10