Document	Document Title
US09109659B2	Underwater shackle An underwater shackle for heavy loads is described, comprising a shackle body (10) equipped with respective side plates (12a, 12b) and an upper, intermediate suspension (14) for connection to a lifting, strap, a lifting cable or the like, and also a lower locking bolt (20) for connection to the load. The locking bolt (20) is arranged to a hydraulically driven cylinder arrangement (30) so that it can move, where the cylinder arrangement (30) is placed adjoining one of the side plates (12a) and the cylinder arrangement (30) is arranged to be pressurized by a pressure medium to move the locking bolt (20) between a withdrawn position in the cylinder arrangement (30) and a locking position in the shackle body (10). A pressure distributor (40) is arranged with the cylinder arrangement (30) to receive and distribute the pressure medium, where the pressure distributor (40) comprises supply channels (44, 4) that run together with the first and the second inlet channels (34, 36) in the cylinder arrangement (30).
US09109656B2	Toothed power transmission belt A power transmission belt has a body with a length, a width, an inside and an outside. The body has at least one load carrying member embedded in rubber and extending in a lengthwise direction. The body defines a plurality of teeth spaced along the length of the belt on at least one of the inside and outside of the body. At least one of: (a) the at least one load carrying member has an occupying rate (R) that is not less than 75%, with R=n×Dc/B×100 where: n=number of load carrying members aligned along the width of the body; Dc=diameter of load carrying member(s); and B=width of the body; and (b) the at least one load carrying member has a cross-sectional area taken transversely to the length of the body that is in a range of 1.10 to 1.70 mm2 per 1 mm of belt width.
US09109655B2	Elements of drive power transfer belt of belt-drive continuously variable transmission for vehicle Provided are elements arranged along a ring of a drive power transfer belt wound on pulleys of a belt-drive continuously variable transmission. Each element has a recess at one side of the element and a projection projecting from the other side to fit into the recess of the adjacent element. The projection has a first engagement portion provided at its base side such that a predetermined engagement gap is created on the radially outer side when the projection fits in the recess of the adjacent element, and a second engagement portion provided at the tip side of the projection and decreasing in diameter toward the tip of the projection from the first engagement portion. The gradient with which the diameter of the second engagement portion decreases is larger than the gradient with which the diameter of the first engagement portion decreases toward the tip of the projection.
US09109654B2	Failsafe magnetorheological (MR) energy absorber A compact and failsafe magnetorheological energy absorber design including both a light weight piston (LWP) embodiment in which linear motion is subjected to a linear damping force, and a light weight rotary vane (LWRV) embodiment in which linear motion is converted into rotary motion and is subjected to a rotary damping force. Both embodiments allow increased damper stroke within a compact mechanical profile. A new lightweight Magnetorheological energy attenuation system (LMEAS) for a vehicle seat is also disclosed using the new LMRW MREA.
US09109652B2	Selection of components of a disc brake and disc brake The invention relates to a selection of components of a disc brake, in particular for commercial vehicles, having a brake caliper having an installation opening for installing a brake shaft, a first brake shaft and a second brake shaft, wherein the two brake shafts are coordinated with the brake caliper in such a manner that they can be used to apply the brake. According to the invention, the first brake shaft, but not the second, fits through the installation opening. The further invention relates to a disc brake, in particular for commercial vehicles, having a brake shaft and a brake caliper having an installation opening for installing the brake shaft, wherein the brake shaft is coordinated with the brake caliper in such a manner that said brake shaft can be used to apply the brake. According to the invention, the brake caliper and the brake shaft each have a coding, which allows installation of the brake shaft through the installation opening only if the two codings match.
US09109638B2	Switchable coupling, in particular for passenger vehicle auxiliary assemblies A switchable coupling, in particular for vehicle auxiliary assemblies, is provided. The coupling includes an actuating system actuated electrically, mechanically, pneumatically or hydraulically between a driving element and an output element, and a switching element movable between switching start and end positions counter to the force of one or more resetting elements upon actuation of the actuating system. In the end position, the switching element connects the driving and output elements such that the output element and an auxiliary coupling connected thereto rotate with the driving element. After deactuation, locking bodies located on the auxiliary coupling produce an connection between the driving and output elements which continues to conduct torque between the driving and output elements. The connection is interrupted only when the rotational speed of the driving element falls below a limit value. The coupling does not require a permanent supply of power in the open or closed state.
US09109630B2	Rolling bearing unit A rolling bearing unit includes: a rolling bearing having an inner ring, an outer ring arranged, multiple rolling elements, and a cage; and a cage guide member that is formed integrally with the outer ring or formed as a member different from the outer ring, and that is fixed to the housing side. The cage guide member has a guide projection projected into an annular space between the inner and outer rings and having an outer peripheral face a part of which serves as the guide face, and a grease supply portion having a grease reservoir portion in which the grease is reserved. A supply port through which the grease is supplied from the grease reservoir portion to the guide face is formed on the outer peripheral face of the guide projection, at a position closer to a base end portion of the guide projection than the guide face.
US09109629B2	Bearing cage with self-lubricating grease reservoirs A bearing cage, including an outer circumferential surface, an inner circumferential surface, a radial surface aligned in a direction orthogonal to the axis of rotation, at least one chamber located in material forming the bearing cage and one of at least one first channel connecting the at least one chamber to the radial surface and at least one second channel connecting the at least one chamber to one of the inner circumferential surface or the outer circumferential surface, or at least one first channel connecting the at least one chamber to the inner circumferential surface and at least one second channel connecting the at least one chamber to the outer circumferential surface.
US09109626B2	Bearing support A bearing support that includes a body through which a bore extends and a plurality of grooves formed in a wall of the bore. Each groove extends from a first end of the bore and terminates prior to a second end of the bore. A bearing can be secured within the bearing support by injecting adhesive into one or more of the grooves.
US09109619B2	Screw having a screw head, a screw shank and a corrugated conical flange The invention relates to a screw having a screw head (2), a screw shank (1) and a corrugated conical flange (4) which decreases in thickness toward the outside, which flange (4) will abut on a component part as the screw is being screwed into the latter. The two lateral surfaces (5, 6) of the flange (4) from the screw shank (1) to the outer edge (7) of the flange taper continuously toward the outside with the thickness of the flange (4) decreasing at the same time, with its corrugation (8) extending substantially over the entire radial width of the flange (4).
US09109618B2	Blind rivet with a plastic rivet body A blind rivet having a hollow rivet body made of plastic, an elongated shank with a bore, a head at one end of the shank and a foot end on the opposite end of the shank, and having, in the bore, a mandrel that has a mandrel shank with a drawing end and a mandrel head that acts on the foot end, the shank has a first region located between the head and the foot end, and has a second region with reduced cross-section and reduced wall thickness as compared to the first region. The regions arranged such that, as a result of a process in which the head is pressed against one side of a workpiece and the foot end is simultaneously drawn toward the other side of the workpiece with the aid of the mandrel, the wall of the shank forms a roll fold with an annular bead.
US09109615B2	Apparatus and method for associating the edge of a composite object with another object A method and apparatus for associating an edge of a first object with a second object. An insert comprising a structure holding a fastener element may be positioned within a hollow portion at the edge of the first object. The structure may be configured to span an entire thickness of the first object at the edge of the first object. The structure may be adhesively bonded to the first object. The second object may be attached to the edge of the first object using the fastener element.
US09109614B1	Compressed gas energy storage system Embodiments of the present invention use compressed air to store and deliver electrical, mechanical, and/or thermal power with high round-trip efficiency. Various embodiments may be scalable for use in a variety of environments—from wind farms to power plants to motor vehicles. An energy storage system according to the present invention can operate as a stand-alone storage system that connects electrically to the grid, it can be tightly integrated with a wind turbine, and/or it can be co-located with a thermal power generation facility and operate with even higher efficiency by scavenging low-grade waste heat.
US09109613B2	Braking-force generator In a braking-force generator: a master cylinder generates first braking force corresponding to an operational input through a manipulator; a hydraulic-pressure generator connected to the master cylinder through a shutoff valve generates second braking force corresponding to the operational input through the manipulator when the shutoff valve is closed; an abnormality detector repeatedly determines whether or not an operational state of the hydraulic-pressure generator is abnormal; and a controller prohibits generation of the second braking force, opens the shutoff valve, and transmits the first braking force to the hydraulic-pressure generator, when the operational state is abnormal. In the case where the abnormality detector determines that the operational state changes from an abnormal state to a normal state while manipulation with the manipulator is being performed, the controller keeps prohibition of the generation of the second braking force and keeps the shutoff valve open until the manipulation is terminated.
US09109609B2	Submersible pump motor cooling through external oil circulation An electrical submersible pump motor has motor oil flowing through external circulation tubes for cooling the motor. A substantial portion of the exterior of each tube is submerged in and exposed to wellbore fluid. Heat is transferred from the motor to the motor oil, and then circulated through the external circulation tubes to conduct heat to the wellbore fluid. Internal or external motor oil pumps may be used to propel the motor oil through the circulation tubes. Guards or baffles may be used to protect the circulation tubes and to influence the flow of production fluid over the circulation tubes.
US09109589B2	Electric compressor and assembly method thereof A main-bearing outer diameter of an electric motor is made smaller than a rotor outer diameter without causing a drop in production efficiency, and the ease of performing a shrink-fitting step is also enhanced by making it possible to mount a rotor to a main shaft in an early stage. A bearing journal portion (14b) of a main shaft (14) of an electric motor is formed in a shape into which an inner race (18b) of a main bearing (18) can be press-fitted from both sides in the axial direction thereof, and, in addition, an outer diameter of the bearing journal portion (14b) is made larger than an outer diameter of a rotor press-fitting portion (14a), whereas a bearing bore portion (5a) of a partition member (5) is formed in a shape into which an outer race (18a) can be press-fitted from both sides in the axial direction thereof. It is preferable that a space (S) into which a press-fitting tool for press-fitting the main bearing (18) can be inserted be provided between the rotor press-fitting portion (14a) of the main shaft (14) and the bearing journal portion (14b) thereof.
US09109581B2	Offshore wind turbine having a support system for interchangeable containers, the support system being combined with a wave run-up deflector and method of manufacturing same An offshore wind turbine comprising a tower, where said wind turbine at a level above sea level comprises at least one structure for storing at least one container, said container having the size and measures of a standard container, where said structure is arranged on the side of the tower, and a method of manufacturing such a concrete structure for an offshore wind turbine. The structure for storing one or more containers includes a deck, and at least one bed for supporting at least one container along the container's lower surface and/or edges, where the structure is a concrete structure. By manufacturing the structure from concrete, a very robust and strong structure is achieved.
US09109572B2	System and method to recapture energy of a hydraulic motor A system and method to recapture energy of a hydraulic motor is disclosed. The system includes a plurality of pistons disposed about a periphery of a flywheel, wherein each piston is compressed by a roller during each revolution of the flywheel. As each piston is engaged and pushes against the roller, the piston is biased inward and forces hydraulic fluid out of the cylinder recapturing energy as pressure to the system when the flywheel is rotating under its own rotational inertia. In addition, the piston pushing against the roller causes the flywheel to continue to rotate. As the force acting on the piston causes the flywheel to rotate, the next piston starts to approach the position of the prior piston. This action continues as long as the fluid is under pressure when it enters each cylinder.
US09109555B2	Structure for joining valve casing to manifold body of intake manifold A valve casing of a flow regulating valve is welded to an end of a downstream section of a manifold body. Two passages are formed in the valve casing of the flow regulating valve. The valve casing accommodates a valve plate for switching at least one of the passages selectively between an open state and a closed state. A joint portion between the manifold body and the valve casing has height difference such that the portion in the vicinity of the passage corresponding to the valve plate is located at a position higher than the portion in the vicinity of the other one of the passages.
US09109552B2	Canister purge valve with integrated vacuum generator and check valves An integrated canister purge valve for a turbocharged vehicle engine includes a valve member having a housing and being constructed and arranged to control vapor purge flow from a fuel tank and canister structure to an air intake manifold. A body is coupled to the housing. The body defines an interior space. Structure separating the interior space into a first chamber and a second chamber isolated from the first chamber. The first chamber has an inlet port and an outlet port. A vacuum generator is provided in the first chamber and in fluid communication with the inlet and outlet ports. A first check valve is in the first chamber between the vacuum generator and the valve member and a second check valve is in the second chamber between the valve member and a manifold outlet port.
US09109547B2	Exhaust gas recirculation cooler, system, and method thereof An exhaust gas recirculation (EGR) cooler for cooling exhaust gas includes at least one channel configured to allow the exhaust gas to flow through it, and a casing defining a cooling chamber around the at least one channel. The cooling chamber is configured to enable heat transfer between the exhaust gas and the coolant. The at least one channel has an interior surface and an exterior surface made of a first metal and a second metal, respectively, and configured to be in contact with the exhaust gas and the coolant, respectively. The second metal has a higher thermal conductivity than the first metal. The casing includes a coolant inlet and a coolant outlet configured to enable the coolant to enter and exit the cooling chamber, and an exhaust gas inlet and an exhaust gas outlet configured to enable the exhaust gas to enter and exit the at least one channel.
US09109542B2	Carburetor In a carburetor (1) including a choke valve (7) on the upstream side inside an aspiration passage (3) and a throttle valve (8) on the downstream side, the valves (7) and (8) are disposed at positions such that the valves adjacently oppose each other when having been turned to be in the fully open state, a bulging part (11) that bulges toward the region (A1) between the adjacently opposing valves (7) and (8) is integrally provided inside a venturi (9), and the aspiration passage (3) is divided into an air-fuel mixture passage (4) located on the side where a main jet (10) is provided and an air passage (5) through which leading air circulates by the bulging part and the valves (7) and (8), both of which are in the fully open condition.
US09109536B2	Engine thrust reverser lock In some aspects, an aircraft engine thrust reverser lock system includes a pin-capturing member. The pin-capturing member includes a body that is rotatable about an axis defined by a pivot extending through the body. The body includes an interior surface that defines a slot. The slot has an opening that is sized to receive a pin into the slot. One side of the slot includes a protruded sidewall surface that protrudes into the slot toward an another sidewall surface of the slot. The protruded sidewall surface defines an apex between the open and closed ends of the slot. Between the apex and the closed end of the slot, the protruded sidewall surface faces the rotational axis.
US09109530B2	Piston for an internal combustion engine The invention relates to a piston (10, 110, 210) for an internal combustion engine, comprising a piston head (11, 111, 211) and a piston skirt, the piston head (11, 111, 211) having a circumferential ring section (15, 115, 215) and a circumferential cooling channel (16, 116, 216) in the region of the ring section (15, 115, 215). The cooling channel has a cooling channel floor (17, 117, 217) and a cooling channel ceiling (18, 118, 218). According to the invention, the cooling channel (16, 116, 216) has a narrowing (20, 120, 220).
US09109523B2	Methods and systems for humidity and PCV flow detection via an exhaust gas sensor Methods and systems are provided for estimating a PCV flow to an engine based on the output of an exhaust gas oxygen sensor. During DFSO conditions, a reference voltage of the sensor is modulated initially with an intake throttle open and then with the intake throttle closed. PCV flow leaking past the piston valves in an aging engine, as well as an ambient humidity estimate, are inferred based on the outputs of the sensor during the modulating with the intake throttle open and closed.
US09109522B2	Method of controlling an EGR valve integrated in an EGR circuit of a combustion engine The invention relates to a method of controlling a combustion engine (1) comprising at least one cylinder (2) and a manifold (3) and an exhaust gas recirculation (EGR) circuit including an EGR valve. The EGR valve (6) is controlled by carrying out the following stages: a) measuring a pressure difference ΔP in a portion of the exhaust gas recirculation circuit including the EGR valve; b) selecting a burnt gas fraction set point BGRsp in the intake manifold (3); c) calculating an opening set point for the EGR valve (6) from a pressure drop relation applied in a portion of the exhaust gas recirculation circuit including the EGR valve, depending on difference ΔP at the EGR valve and on the burnt gas fraction set point BGRsp in the intake manifold; and d) controlling the EGR valve (6) as a function of the opening set point of EGR valve (6).
US09109519B2	Method for controlling air system states in an intake manifold of an internal combustion engine A method for controlling at least one air system state in an intake manifold of an internal combustion engine, at least one control variable which influences the at least one air system state being predefined with the aid of an actuator; at least one control variable limitation of the actuator is taken into account in the control.
US09109515B2	Gas seal for aerospace engines and the like A gas seal for aerospace engines has a stationary seal housing, a rotating seal plate mounted on the engine drive shaft and a carbon ring seal movably supported in the housing with a face which mates with the face of the seal plate to create a gas seal therebetween. A plurality of flexible pins have first ends supported on the housing and second ends slidably connected with the carbon ring seal to permit the latter to shift axially. A plurality of compression springs bias the two seal faces together. The housing has a first twist lock which selectively engages a second twist lock on the carbon ring seal to movably retain the latter in the housing. The second ends of the spring pins resiliently deflect during mutual rotation of the carbon ring seal and the housing to facilitate engagement and disengagement of the first and second twist locks.
US09109514B2	Air recovery system for precooler heat-exchanger A method for recovering air in an aircraft includes bleeding bypass air from an engine bypass, bleeding core air from an engine core, and placing the bypass air and the core air in a heat exchange relationship to produce heated bypass air and cooled core air. The method further includes directing the heated bypass air to one or more of: the engine bypass, a cowl de-icing system, and a wing anti-ice system.
US09109509B2	Unit for an aircraft thruster A unit for an aircraft thruster is provided that includes a first ferrule configured to be attached to a second ferrule and a first connection flange configured to be secured to a second corresponding connection flange secured to the second ferrule. The connection flange includes a portion forming a plane extending along a radial direction with respect to the first ferrule. A link between the first ferrule and the corresponding connection flange is offset to a distance from said plane corresponding to a length for damping a shear-generating flexural moment, generated by fluxes of forces passing through the first ferrule.
US09109506B2	Method for operating a pressure ignition engine Method and system for operating a compression engine on ether containing fuel obtained by conversion of a primary fuel based on alcohol comprising the steps and means for: (a) continuously withdrawing the primary fuel based on alcohol from a fuel tank and pressurising the primary fuel based on alcohol in its liquid form to a final engine injection pressure; (b) continuously introducing the pressurized primary fuel based on alcohol into a fuel accumulation chamber; (c) continuously distributing the pressurized primary fuel based on alcohol into pipes connecting the accumulation chamber with fuel injectors of the engine; (d) prior to the fuel injectors continuously converting the pressurised primary fuel based on alcohol to an ether containing fuel by contact with an alcohol dehydration catalyst being arranged in each of the pipes upstream the fuel injectors; (e) continuously injecting the ether containing fuel at injection pressure into the engine; and (f) continuously withdrawing a part of the introduced primary fuel based on alcohol from the accumulation chamber; and (g) depressurising and recycling the withdrawn primary fuel based on alcohol to the fuel tank.
US09109502B1	Control system for a supercharger with a variable transmission A supercharger assembly includes a centrifugal blower for delivering pressurized air to an engine air manifold of an engine; a variable transmission for driving the blower; a motor for adjusting a gear ratio of the variable transmission; and a control system for controlling operation of the motor to provide user selectable and/or programmable levels of supercharger boost. The control system may include a user input device for selecting a performance level of the supercharger assembly; at least one engine sensor for sensing an operating parameter of the engine; at least one environmental sensor for sensing a characteristic of the inlet air; and a programmable controller for controlling operation of the motor in accordance with the user selected performance level and outputs of the engine sensor and the environmental sensor.
US09109497B2	Vehicle cooling device A vehicle cooling device includes a pump, circulation paths connected to the pump for circulating coolant between a cooling object and a heat exchanger, a solenoid valve for opening and closing at least one of the circulation paths, and a control unit for controlling pump operation. The solenoid valve includes a valve body movable between a position separated from a valve seat and a position abutting the valve seat, the valve body being held in abutment with the valve seat, and a solenoid maintaining the abutment when energized. The valve body allows coolant fluid pressure to move the valve body separate from the valve seat when the solenoid is not energized and the pump is in operation, and the control unit performs controlling to stop the pump and start solenoid energization when conditions are ready for stopping coolant circulation through the circulation path in which the solenoid valve is disposed.
US09109492B2	Exhaust purification system of internal combustion engine An exhaust purification system of an internal combustion engine including an ammonia oxidation catalyst device and an ammonia holding device arranged immediately upstream of the ammonia oxidation catalyst device is provided. The ammonia holding device has a solid acid, holds ammonia to restrain the ammonia from flowing into the ammonia oxidation catalyst device when a temperature of the ammonia oxidation catalyst device is within a N2O producing temperature range, and releases the held ammonia to make the ammonia flow into the ammonia oxidation catalyst device when the temperature of the ammonia oxidation catalyst device is out of the N2O producing temperature range.
US09109490B2	Electric heating catalyst An electric heating catalyst (EHC) in which a short circuit between a heat generation element and a case in EHC is suppressed. The EHC includes a heat generation element (catalyst carrier) electrically energized to generate heat; a case receiving the heat generation element; an insulating support member between the heat generation element and the case; a tubular inner pipe inserted into the insulating support member and located between the heat generation element and the case. The inner pipe has an end protruding into an exhaust gas from the insulating support member's end face, and the inner pipe has an electrically insulating layer formed on an entire surface, or the inner pipe is formed of an electrically insulating material; and an inner pipe heater supplied with electricity through a path different from a path through which electricity is supplied to the heat generation element, thereby heating the inner pipe's protrusion portion.
US09109489B2	Vehicle In a vehicle including an EHC containing a catalyst base material and an insulator insulating the EHC from the outside, an ECU estimates a temperature of the catalyst base material and a temperature of the insulator immediately after a state of the vehicle is switched from a Ready-OFF state to a Ready-ON state, as a base material temperature for determination THcpost and an insulator temperature for determination THipost, respectively. Then, when base material temperature for determination THcpost is lower than a base material threshold temperature THcth and when insulator temperature for determination THipost is lower than an insulator threshold temperature THith, the ECU allows EHC power feed, and otherwise it does not allow but prohibits EHC power feed.
US09109484B2	Control system for DPF regeneration by exhaust pipe injection, and regeneration method The purpose of the present invention is to provide a DPF travel-time regeneration control system of stably raising the temperature even during travel and capable of decreasing the frequency of DPF regeneration when the vehicle is stopped. In this control system, if the DPF (5) needs to be regenerated, the vehicle is traveling on cruise control, and the exhaust temperature detected by an exhaust temperature sensor (11) is higher than a threshold value, then fuel is injected into the exhaust pipe by a fuel injection means (7), and if the exhaust temperature is lower than the threshold value, the exhaust temperature is raised by operating the exhaust brake without injecting fuel into the exhaust pipe.
US09109483B2	Exhaust system for an internal combustion engine An exhaust system for an internal combustion engine, having a first exhaust tract and a second exhaust tract, wherein a first silencer device is arranged in an end section of the first exhaust tract and a second silencer device is arranged in an end section of the second exhaust tract, and the two exhaust tracts are connected in an inter-communicating manner by a crosstalk point, and, in the first or second exhaust tract downstream of the crosstalk point, there is provided a valve for the selective closure of the respective exhaust tract, wherein a distance between the valve and the crosstalk point is dimensioned such that, at a particular rotational speed of the engine, an exhaust line path between the valve and the crosstalk point serves as a quarter lambda resonator such that, at the rotational speed of the internal combustion engine, disturbing noises of the exhaust system are reduced.
US09109481B2	Method to control and diagnose an exhaust gas heat exchanger A method for controlling an exhaust gas recovery system for an engine includes generating a signal to control exhaust gas flow through an exhaust gas heat exchanger, and generating a diagnostic code based on a difference between coolant temperature downstream of the exhaust gas heat exchanger and coolant temperature downstream of the engine. A vehicle has an engine, and an exhaust heat recovery system with an exhaust gas heat exchanger, a first temperature sensor downstream of the engine, and a second temperature sensor downstream of the exhaust gas heat exchanger. A controller for the vehicle is configured to: (i) generate a signal to control exhaust gas flow through the exhaust gas heat exchanger, and (ii) generate a diagnostic code based on a difference between coolant temperature measured by the first and second temperature sensors.
US09109473B2	Valve-timing control apparatus of internal combustion engine and cover member of valve-timing control apparatus A valve-timing control apparatus includes a phase change mechanism configured to change a valve timing, a cover member provided near a front end side of the phase change mechanism; slip rings provided to one of a front end portion of the phase change mechanism and a facing surface of the cover member which faces the phase change mechanism; a pair of brushes provided to another of the front end portion of the phase change mechanism and the facing surface of the cover member to be axially slidable. One end portion the pigtail harness is connected with the corresponding brush. Another end portion of the pigtail harness is connected with a connector terminal under a deflected state, at a location radially shifted from an axis of the corresponding brush. The another end portions of the pair of pigtail harnesses are separated from each other by a partition wall.
US09109471B2	Cam structure A cam structure driving a tappet having a crowning on a top face and connected to a base end section of an intake or exhaust valve of an engine, includes: a camshaft rotating in synchronization with a crankshaft of the engine; a cam lobe mounted on the camshaft, and including: a base cam including: a base circular section having a mounting hole for the camshaft; and a valve lift section having a cut-out section in a tip end portion; and a roller provided in the cut-out section and having a cylindrical section with a constant diameter. A center section in a width direction of the base cam makes contact with the tappet at a position deviated from a center of the top face of the tappet, and the cylindrical section makes contact with the center of the top face of the tappet.
US09109470B2	Timing belt pulley mounting and geometry for use in internal combustion engines Systems and methods for mounting a timing belt pulley to a crankshaft can include a crankshaft rotatable about a center longitudinal axis, the crankshaft including a pin assembly configured for connection to a reciprocating piston. A timing belt pulley can be positioned against the pin assembly and configured for engaging the pin assembly such that the timing belt pulley is coupled to the crankshaft for rotation about the center longitudinal axis. For example, the pin assembly can include a slot formed on an exterior surface thereof, and the timing belt pulley can include a key extending towards the pin assembly and configured for engaging the slot.
US09109446B1	Continuously variable displacement engine A variable displacement engine comprises a block having one or more cylinders disposed in parallel around a rotating power shaft. A piston in each cylinder is connected to a connecting rod. A wobble plate, including a first ring, a second ring and a bearing assembly, is mounted on the shaft. The first ring rotates with the shaft and pivots about a pivot axis. The second ring is concentrically adjacent the first ring, has rod bearings connected to each connecting rod, and is connected to the block to prevent relative rotation. The bearing assembly is connected between the rings to allow relative rotation therebetween while constraining the rings to remain parallel. A displacement actuator connected to the wobble plate moves the pivot axis along the shaft to change the displacement, while a piston control linkage changes the wobble plate angle to maintain a constant compression ratio.
US09109441B2	Method and apparatus for controlling fluid flow into a wellbore An injection apparatus for use in a wellbore is disclosed wherein the apparatus includes a tubular housing and a shield housing disposed outside the tubular housing, the shield housing including a chamber in fluid communication with the tubular housing. The apparatus further includes a piston disposed within the shield housing, the piston coupled to a biasing member, wherein movement of the piston controls fluid communication between the chamber and the wellbore, and wherein the movement of the piston is caused by a pressure change of a fluid within the tubular housing.
US09109439B2	Wellbore telemetry system and method A hybrid telemetry system for passing signals between a surface control unit and a downhole tool is provided. The downhole tool is deployed via a drill string into a wellbore penetrating a subterranean formation. The hybrid telemetry system includes an uphole connector, a downhole connector, and a cable operatively connecting the uphole and downhole connectors. The uphole connector is operatively connectable to a drill string telemetry system for communication therewith. The downhole connector is operatively connectable to the downhole tool for communication therewith.
US09109434B2	System and method for estimating oil formation volume factor downhole A system includes a downhole formation fluid sampling tool and a processor. An optical spectrometer of the downhole formation fluid sampling tool is able to measure an optical characteristic of a formation fluid flowing through the downhole formation fluid sampling tool over a plurality of wavelengths. The optical spectrometer generates optical spectra data indicative of this optical characteristic. The processor is designed to receive the optical spectra data generated by the optical spectrometer and to estimate a formation volume factor of the formation fluid based on the optical spectra data.
US09109428B2	Configurable bridge plugs and methods for using same An insert for a downhole plug for use in a wellbore is provided, comprising a body having a bore at least partially formed therethrough, wherein one or more threads are disposed on an outer surface of the body for engaging the plug; and at least one interface is disposed on an end of the body for connecting to a tool to screw the insert into at least a portion of the plug.
US09109422B2	Ball injector system apparatus and method A ball launching system includes a ball launcher with a removable ball pod and sleeve assembly that retains balls prior to injection. An interchangeable ball pod with a chamber corresponding to the ball diameter, fits into a pod sleeve and comprise the ball pod and sleeve assembly. The ball launcher further includes a housing with a moveably disposed piston that engages with the ball thereby launching it. The housing also includes a thru hole through which the piston may travel to externally indicate its position within the housing. The ball launching system also includes a control system having control inputs, which may be located remote to the ball launcher. By applying a pre-determined sequence of control inputs, the piston may engage with the balls retained in the ball pod and sleeve assembly to force the balls to be launched from the ball launcher.
US09109418B1	Method and apparatus for improving the integrity of a pipeline A method and apparatus is provided which will improve the integrity of a pipeline by removing moisture and solid particulates that have been entrapped within a gas originating from an underground storage cavern following pressure reduction before introducing the gas into the pipeline.
US09109415B2	Automated diversion valve control for pump down operations A system for pump down operations includes a diversion valve unit that is adjustable between a pumping position and a diversion position and a controller coupled to the diversion valve unit. The system further includes a fluid reservoir, a downhole fluid path between the fluid reservoir and a tool downhole, a driving unit in the downhole fluid path for advancing the tool, and a diversion fluid path between a portion of the downhole fluid path downstream of the driving unit and the fluid reservoir or another fluid receptacle. The diversion valve is in the diversion fluid path and the controller automates the diversion valve position for the diversion valve unit based on a monitored wireline speed or a monitored wireline tension for a wireline unit.
US09109413B2	Methods of forming components and portions of earth-boring tools including sintered composite materials The present invention includes consolidated hard materials, methods for producing them, and industrial drilling and cutting applications for them. A consolidated hard material may be produced using hard particles such as B4C or carbides or borides of W, Ti, Mo, Nb, V, Hf, Ta, Zr, and Cr in combination with an iron-based, nickel-based, nickel and iron-based, iron and cobalt-based, aluminum-based, copper-based, magnesium-based, or titanium-based alloy for a binder material. Commercially pure elements such as aluminum, copper, magnesium, titanium, iron, or nickel may also be used for the binder material. The mixture of the hard particles and the binder material may be consolidated at a temperature below the liquidus temperature of the binder material using a technique such as rapid omnidirectional compaction (ROC), the CERACON® process, or hot isostatic pressing (HIP). After sintering, the consolidated hard material may be treated to alter its material properties.
US09109403B2	Drill bit assembly having electrically isolated gap joint for electromagnetic telemetry A drill bit assembly having an electrically isolated gap joint for electromagnetic telemetry comprises a drill bit, a pin body, an electrically insulating gap joint therebetween, and an electrical conductor extending across the gap joint. The bit head has a cutting end and an opposite connecting end with an engagement section. The pin body has a tubular body with an axial bore therethrough, and comprises a connecting end with an engagement section. The pin body connecting end is connected to the bit head connecting end such that the engagement sections overlap. The electrically insulating gap joint fills an annular gap between the bit head and pin body engagement sections such that the bit head and pin body are mechanically connected together at the connecting ends but are electrically separated. The electrical conductor has one end electrically contacting one of the bit head and pin body, and the other end communicable with electronics equipment.
US09109396B2	Ladder having narrow base A ladder includes a stair section having a plurality of steps, a vertical upright that connects to a top of the stair section, a base that connects a bottom of the stair section and a bottom of the vertical upright, and one or more wheels connected to the bottom of the vertical upright. The ladder may also include a front locking step and a rear wheel assembly. A narrow base extends between a step of the stair section above a bottom step or locking step and the vertical upright.
US09109394B2	Adjustable ladder support mechanism The disclosed adjustable ladder support mechanism solves the problem of unstable extension ladders with a mobile base that can be moved by one man, the base then expanded in both length and width. With the stable base set up, the ladder can be extended, the angle adjusted, and the operator can safely climb the ladder. Worries of the ladder slipping sideways off the ledge against which it is leaned are eliminated.The adjustable ladder support mechanism has two main sections: the base, which provides stability, and the tower, which raises the ladder above the ground.
US09109391B2	Method and branching determination device for determining a branching point within a hollow organ A method is disclosed for determining a branching point within a hollow organ in image data representing the spatial structure thereof. In at least one embodiment, the method includes setting a start point within the hollow organ; determining at least one local threshold which corresponds to the presence of a wall of the hollow organ; carrying out a region growing method using the threshold; analyzing the connectivity of a number of outer growth layers; and localizing a branching on the basis of the connectivity analysis. Moreover, at least one embodiment of the invention relates to a correspondingly designed branching determination unit.
US09109380B2	Motor vehicle door lock A motor vehicle door lock is provided with a catch with an actuating-lever mechanism which acts on the catch. There is also a locking lever which, together with the actuating lever, renders the actuating-lever mechanism inactive when accelerating forces of predetermined magnitude occur, for example in the event of a crash. The actuating lever and locking lever disable the actuating-lever mechanism mechanically, as a result of the accelerating forces occurring, by associated deflection. Following dissipation of the accelerating forces, the actuating lever and locking lever reconnect the actuating-lever mechanism.
US09109379B1	Keyless padlock, system and method of use A keyless padlock having a padlock body, a shackle, a locking mechanism located in the body and associated with the shackle to lock the shackle to the body in a locked condition and to release at least a part of the shackle in an unlocked condition, the locking mechanism including a signal receiver, at least one control assembly and at least one actuator, the locking mechanism being unlocked upon verification of a signal including an unlock code transmitted by a mobile computing device.
US09109370B2	Scaffolding post The invention relates to a scaffolding post (25) made of metal, including a tube (26) and a tubular tube connector (27) integrally molded therewith. In a transition region between the tube connector (27) and the tube (26) a stop (46) is formed, the stop being in the form of an annular post-supporting end face (50) running perpendicularly to the longitudinal axis of the scaffolding post (25) and circumferentially around the longitudinal axis. The slide-on area (37) of the tube (26) has a plurality of indentations (86), each extending in the direction of the longitudinal axis of the scaffolding post (25) and each being designed with a tube inner cross-section reduction. The indentations are arranged distributed in the circumferential direction around the longitudinal axis of the scaffolding post (25) at regular intervals or equidistant and each extends continuously for a length in the tube slide-on region (37), starting directly from a tube-supporting end face in the direction of the tube connector (27). The indentations (86) are each configured in an L-shape or T-shape with a longitudinal supporting indentation (90) and a transverse centering indentation (91). In the region of the post-supporting end face (50) the tube connector (27) includes a centering region (65) spanning a first tube connector outside diameter and further includes a supporting region (73) spanning a second tube connector outside diameter, wherein the first tube connector outside diameter is slightly larger than the second tube connector outside diameter. The tube (26) includes a substantially circular cylindrical tube portion (55), which merges in the direction of the free tube connector end directly, substantially sharp-edged via an annular edge or with a slight transitional radius, into the post-supporting surface (50).
US09109368B2	Rain screen siding system A rain-screen siding system for buildings, including clips to support siding boards parallel with a flat surface of a building wall structure but spaced apart from the building wall to allow air to circulate between the building wall structure and the siding boards. The clips include paired, opposed channels and the siding boards have tongues that fit into the channels. Drainage grooves are defined in the clips. Bottom support members may extend horizontally to support the siding boards at the bottom of the rain screen siding. Corner closing members are provided to protect end faces of siding boards at an exterior corner of a building wall.
US09109361B2	Bracing bridging member A building connection between a plurality of vertical wall studs made with a plurality of bridging members to brace the wall studs. The bridging members are formed with mounting sections that are received in openings of the wall studs and the mounting sections are bracketed by connecting sections that are used to join the bridging members to each other. The bridging members interface with the web of the wall studs to brace them.
US09109360B2	Insulating fire and blast resistant window and door buck An insulating fire and blast resistant window and door buck is described that is designed for use with an insulated concrete wall form. The window and door buck described provides a core of concrete for fire and blast protection while also providing structural concrete for attaching window and door elements. In some embodiments, the window and door buck comprises two pieces of insulation that are separated by a gap and held together by a tie piece. The insulation pieces are proportioned to so that an alignment element fits inside the cavity of the wall form. When the buck is placed in an insulated wall form and concrete is poured into the form a strip of concrete fills the gap, resulting in a fire and blast resistant wall.
US09109354B2	Rapid assembly of a modular structure A modular structure formed by panels is disclosed, having a center compartment and first and second side compartments coupled to the opposing sides of the center compartment. Each panel of the modular structure is joined to each respective adjacent panel via a panel joining assembly to substantially prevent moisture from entering the modular structure. An upper roof panel coupled to the center compartment is joined to first and second lower roof panels coupled to the first side compartment and the second side compartment, respectively, via first structural joining assemblies so that the upper roof panel is elevated relative to the first and second lower roof panels to substantially prevent moisture from entering the modular structure.
US09109350B2	Fluid delivery system with a housing and at least one fluid inlet and one fluid outlet The invention provides a fluid delivery assembly for use with a water discharge fixture, such as a faucet. The fluid delivery assembly includes a tube assembly, a cartridge housing and a retaining assembly. The fluid delivery assembly provides for water flow from hot and cold water inlets to the faucet. The fluid delivery assembly may be assembled by hand without the need for tools, allowing for easy replacement of the fluid delivery assembly without the need to disassemble the faucet assembly or to replace the entire faucet assembly.
US09109348B2	Monitor and working vehicle provided with the monitor A monitor includes a display in a form of a liquid crystal display, a rubber frame having a surrounding face that surrounds an outer circumferential surface of the liquid crystal display, and a front case having a housing that houses the liquid crystal display attached with the rubber frame. The rubber frame includes a projection that projects from a surface of the surrounding face and that is elastically deformed by contacting with an inner circumferential surface of the housing.
US09109341B1	Ground anchor body having rotation release structure Disclosed herein is a ground anchor body having a rotation release structure. The ground anchor body includes a waterproof cap, a head coupler, a wedge, a tubular guide, a movable body, and a compression spring. The head coupler is coupled to a lower end of the waterproof cap. A tapered hole is longitudinally formed in the head coupler. The wedge is disposed in a tapered hole of the head coupler to hold the PC strand. The guide is installed in the waterproof cap. A slide slot is longitudinally formed in the guide. The movable body is disposed in the guide and provided with a slide protrusion inserted into the slide slot. The wedge is coupled to the movable body, and a key depression is formed in the movable body so that an end of the PC strand is key-coupled to the movable body. The compression spring elastically compresses the movable body downward.
US09109324B2	Tumble drying device and method for operating a tumble drying device A tumble dryer with a fire-extinguishing facility includes a fire sensor for detecting a fire in a laundry drum of the tumble dryer, and an extinguishing medium supply device for introduction of an extinguishing medium into the laundry drum of the tumble dryer on actuation of a fire-extinguishing device. The extinguishing medium supply device includes a laundry freshening device.
US09109323B2	Washing machine A washing machine includes: a synchronous motor unit installed at the bottom of a tub; a drain valve housing installed at the bottom of the tub; a link unit disposed between the synchronous motor unit and the drain valve housing; a wire unit having one side connected to the synchronous motor unit and the other side connected to the link unit; a spring member having one side connected to the link unit and the other side connected to the drain valve housing; a clutch lever unit rotatably installed on a clutch base unit and rotated in connected with the movement of the link unit caused by the operation of the synchronous motor unit; a cam lever unit connected to the clutch lever unit; a lift lever unit contacted with the cam lever unit; and a coupling unit engaged with a rotor unit or clutch body unit.
US09109320B2	Method for sterilizing laundry, and washing-drying unit The method according to the invention for sterilizing temperature-sensitive laundry items comprises the following steps: in the dry state, the laundry items are exposed to a process air flow having a defined temperature Tp and over a specified time period, then the laundry items heated in such a way are cooled to a target temperature Tptarget significantly lower than the temperature Tp, and then the cooled laundry items are washed in a washing process. The washing-drying unit according to the invention has a control device (CTRL) for carrying out said method.
US09109317B2	Controlled moisture removal in a laundry treating appliance An automatic washing machine including a tub, a drum mounted for rotating within the tub, a treating chamber for receiving laundry to be treated, a door selectively moveable between opened and closed conditions to provide access to the treating chamber, a position sensor configured to sense the opened and closed conditions of the door and accordingly output a door condition signal, a humidity reduction device coupled to the treating chamber, and a controller configured to execute a treating cycle of operation and operably coupled with the position sensor to receive the door condition signal and the humidity reduction device to control its actuation, and further configured to operate the humidity reduction device and to rotate the drum to reduce the humidity in the treating chamber in response to the door being opened and subsequently closed after the completion of the treating cycle of operation.
US09109316B1	Portable washing apparatus This disclosure relates to the field of fabric (i.e. clothes) washing apparatus which are portable, and operable without a running source of water, and without a power source. The washing apparatus operates with a volume of liquid cleaner (water) and manual manipulation of a handle. The apparatus may also be dis-assembled by a user without tools for shipping or storage in a much smaller space.
US09109312B2	Application head for applying fiber strips The present invention relates to an application head for applying fiber strips made up of a structural assembly determining a path conveying multiple fiber strips (2) to an application area (3), each fiber strip (2) passing through a drive roller (5) and a tension regulator (6), whereas in the application area (3) the fiber strips (2) are pressed individually by a compactor system (8) comprising a series of independent partial rollers (9), each of which is arranged with a fastening comprising a system for height wise movement and a floating system.
US09109296B2	Method for etching conductive metal oxide layer using microelectrode A method for etching a selected area of a conductive metal oxide layer deposited on a support is provided. The method comprises removing the area via electrochemical route in the presence of a polarized microelectrode and an electrochemical solution. In addition, an etched layer obtained with the foregoing method is provided.
US09109293B2	Electrocatalyst for electrochemical conversion of carbon dioxide An electrocatalyst for the electrochemical conversion of carbon dioxide to hydrocarbons is provided. The electrocatalyst for the electrochemical conversion of carbon dioxide includes copper material supported on carbon nanotubes. The copper material may be pure copper, copper and ruthenium, copper and iron, or copper and palladium supported on the carbon nanotubes. The electrocatalyst is prepared by dissolving copper nitrate trihydrate in deionized water to form a salt solution. Carbon nanotubes are then added to the salt solution to form a suspension, which is then heated. A urea solution is added to the suspension to form the electrocatalyst in solution. The electrocatalyst is then removed from the solution. In addition to dissolving the copper nitrate trihydrate in the deionized water, either iron nitrate monohydrate, ruthenium chloride or palladium chloride may also be dissolved in the deionized water to form the salt solution.
US09109278B2	Method of forming self-assembly and uniform fullerene array on surface of substrate The present invention provides a method of forming a self-assembly fullerene array on the surface of a substrate, comprising the following steps: (1) providing a substrate; (2) pre-annealing the substrate at a temperature ranging from 200° C. to 1200° C. in a vacuum system; and (3) providing powdered fullerene nanoparticles and depositing them on the surface of the substrate by means of physical vapor deposition technology in the vacuum system, so as to form a self-assembly fullerene array on the surface of the substrate. The present invention also provides a fullerene embedded substrate prepared therefrom, which has excellent field emission properties and can be used as a field emitter for any field emission displays.Finally, the present invention provides a fullerene embedded substrate prepared therefrom, which can be used to substitute for semiconductor carbides as optoelectronic devices and high-temperature, high-power, or high-frequency electric devices.
US09109273B2	High strength steel sheet and hot dip galvanized steel sheet having high ductility and excellent delayed fracture resistance and method for manufacturing the same A cold rolled steel sheet and a hot dip galvanized steel sheet, which have high strength and elongation, such as a tensile strength of 980 MPa or more and an elongation of 28% or more, and excellent delayed fracture resistance, and manufacturing methods thereof. The cold rolled steel sheet has a composition including 0.05 to 0.3 weight percent C, 0.3 to 1.6 weight percent Si, 4.0 to 7.0 weight percent Mn, 0.5 to 2.0 weight percent Al, 0.01 to 0.1 weight percent Cr, 0.02 to 0.1 weight percent Ni and 0.005 to 0.03 weight percent Ti, 5 to 30 ppm B, 0.01 to 0.03 weight percent Sb, 0.008 weight percent or less S, balance Fe and impurities. The hot dip galvanized steel sheet has a hot dip galvanized layer or a hot dip galvannealed layer on the cold rolled steel sheet.
US09109266B2	Process of producing sugar composition comprising D-psicose and D-allose via strong alkaline isomerization of D-glucose/D-fructose or alkaline pre-treatment of D-glucose/D-fructose followed by isomerization in the presence of a basic ion exchange resin ProblemsDevelopment of a process of producing inexpensive and safe hexose and compositions of the same.Means for ResolutionA process of producing a sugar composition comprising a definite amount of an target hexose, comprising treating a starting liquid sugar material comprising a starting sugar material hexose or a mixture comprising hexose in a system in the presence of one or more types selected from the group consisting of basic ion exchange resins, alkalis and calcium salts to initiate an isomerization reaction as an equilibrium reaction to transform the starting sugar material hexose to the target hexose to prepare a sugar mixture comprising a definite amount of the target hexose and having a sugar constitution different from that of the starting sugar material, and hexose compositions containing D-allose and D-psicose and the use of the hexose compositions.
US09109260B1	Identification of bacteria by amplification and probing A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5′GCGATTTCYGAAYGGGGRAACCC (SEQ ID NO: 1), the other primer consisting of DNA having the sequence 5′TTCGCCTTTCCCTCACGGTACT (SEQ ID NO: 2) and testing the resulting amplicon by hybridization to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococeus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci, and coagulase-negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilized on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.
US09109259B2	Detection method for novel ROS1 fusions Polynucleotides which are novel causative genes for cancer are elucidated, and a detection method of the polynucleotides or polypeptides encoded by the polynucleotides, and a kit and a primer set for detection are provided, based on the knowledge gained by the elucidation. In the detection method, a fusion gene comprising part of an SDC4, CD74, EZR, SLC34A2, LRIG3, or TPM3 gene and part of a ROS1 gene, or a fusion protein encoded by the fusion gene is detected. The primer set or the detection kit comprises a sense primer designed based on a portion encoding SDC4, CD74, EZR, SLC34A2, LRIG3, or TPM3 and an antisense primer designed based on a portion encoding ROS1.
US09109253B2	Oligonucleotides and methods for detecting lavender foal syndrome A method for detecting a genetic polymorphism associated with Lavender Foal Syndrome or a predisposition thereto in a subject, the method including screening a genomic material sample from the subject for the presence of at least one polymorphism in a MYO5A gene.
US09109246B2	Enzymatic methods and enzymes Provided are methods to identify modulators and in particular inhibitors of body malodour formation employing peptidase enzymes, the peptidase enzymes and corresponding nucleotide sequences, expression vectors, transfected host cells, methods of forming the peptidase enzymes and methods to prevent body malodour.
US09109236B2	Microorganisms and methods for conversion of syngas and other carbon sources to useful products A non-naturally occurring microbial organism having an isopropanol, 4-hydroxybutryate, or 1,4-butanediol pathway includes at least one exogenous nucleic acid encoding an isopropanol, 4-hydroxybutryate, or 1,4-butanediol pathway enzyme expressed in a sufficient amount to produce isopropanol, 4-hydroxybutryate, or 1,4-butanediol. The aforementioned organisms are cultured to produce isopropanol, 4-hydroxybutryate, or 1,4-butanediol.
US09109235B2	Methods and compositions for degrading pectin The present invention provides enriched polynucleotides, and enriched polypeptides having pectinase activity. The present invention also includes methods of using the polynucleotides and polypeptides described herein. For instance, the methods include producing metabolic product, such as ethanol.
US09109229B2	Process for improved protein expression by strain engineering This invention is a process for improving the production levels of recombinant proteins or peptides or improving the level of active recombinant proteins or peptides expressed in host cells. The invention is a process of comparing two genetic profiles of a cell that expresses a recombinant protein and modifying the cell to change the expression of a gene product that is upregulated in response to the recombinant protein expression. The process can improve protein production or can improve protein quality, for example, by increasing solubility of a recombinant protein.
US09109228B2	Compositions and methods for regulating RNA translation via CD154 CA-dinucleotide repeat Compositions and methods for regulating CD154 gene expression are provided that rely on the interaction of hnRNP L with the CA-dinucleotide rich sequence of the 3′-untranslated region of CD154.
US09109227B2	FLT3 receptor antagonists for the treatment or the prevention of pain disorders The present invention relates to FLT3 receptor antagonists or inhibitors of FLT3 receptor gene expression for the treatment or the prevention of pain disorders.
US09109221B2	Particles containing organic catalytic materials and uses Semi-permeable particle can be used to facilitate chemical reactions such as catalytic reactions. The semi-permeable particles are permeable to molecules having a molar mass of 1000 Daltons or less and have a mode particle size of at least 1 μm. The semi-permeable particles have multiple discrete cavities containing an aqueous solution or suspension of an organic catalytic material. The semi-permeable particles are also impermeable to the organic catalytic materials so they are retained within the multiple discrete cavities, and the semi-permeable particles can be reused multiple times for the same or different chemical reaction.
US09109216B2	Bacterial host strain A recombinant gram-negative bacterial cell comprising one or more of the following mutated protease genes: a) a mutated Tsp gene, wherein the mutated Tsp gene encodes a Tsp protein having reduced protease activity or is a knockout mutated Tsp gene; b) a mutated ptr gene, wherein the mutated ptr gene encodes a Protease III protein having reduced protease activity or is a knockout mutated ptr gene; and c) a mutated DegP gene encoding a DegP protein having chaperone activity and reduced protease activity; wherein the cell is isogenic to a wild-type bacterial cell except for the mutated Tsp gene and/or mutated ptr gene and/or mutated DegP gene and optionally a polynucleotide sequence encoding a protein of interest.
US09109210B2	Enhanced phytase variants The present invention provides the field of enhancing proteins and in particular to that of proteins enhanced by molecular change. It provides a variant of a phytase that is termed enhanced in that is has better thermostability and/or activity than the original phytase. The invention also provides a nucleic acid coding for said variant, a cassette or an expression vector containing said variant, a host cell expressing said variant, a composition comprising said variant and uses thereof, principally in the preparation of food additives and animal feed.
US09109207B2	Construction of new variants of dextransucrase DSR-S by genetic engineering The present invention relates to a recombinant process for the production of truncated or mutated dextransucrases while conserving the enzymatic activity or their specificity in the synthesis of the α-1,6 bonds. The present invention relates to nucleic acid sequences of truncated or mutated dextransucrases, vectors containing the nucleic acid sequences and host cells transformed by sequences encoding truncated or mutated dextransucrases. In another aspect, the invention concerns a method for producing, in a recombinant manner, truncated or mutated dextransucrases which conserve their enzymatic activity or which conserve their specificity in the synthesis of α-1,6 bonds and can produce, from saccharose, dextrans with high molar mass and modified rheological properties compared with the properties of dextran obtained with the native enzyme and isomalto-oligosaccharides with a controlled molar mass and dextrans. The dextrans and isomalto-oligosaccharides of the invention can be used namely as texturing agents or as prebiotics.
US09109198B2	Automated systems and methods for isolating regenerative cells from adipose tissue A method of processing an adipose tissue to collect adipose derived regenerative cells is provided, wherein the method comprises providing a vessel comprising a fluid jet mixer; introducing the adipose tissue into the vessel; introducing a buffer solution into the vessel; washing the adipose tissue using the fluid jet mixer; introducing an enzyme solution into the vessel; initiating jet mixing into the vessel comprising the adipose tissue, the enzyme solution, and the buffer solution using the fluid jet mixer to digest the adipose tissue to form a digestion product; phase-separating the digestion product into a digested buoyant fat layer and a non-buoyant aqueous layer; and collecting the non-buoyant aqueous layer comprising the adipose derived regenerative cells. A system of processing an adipose tissue to collect adipose derived regenerative cells is also provided.
US09109195B2	Apparatus and method for the deposition of biological material in a target substrate Disclosed is a deposition apparatus (100) which is designed to deposit frozen biological material (1) in a target substrate (2) and includes a charging device (10) and a driving device (20). The charging device (10) is designed to supply the biological material (1) to the driving device (20) while the driving device (20) is designed to apply a driving force to the biological material (1). In order to apply the driving force, the driving device (20) is formed such that the biological material (1) can penetrate into the target substrate (2) under the effect of the driving force. Also disclosed are an injector cartridge which is designed to provide frozen biological material in a deposition apparatus as well as a method for depositing biological material (1) in a target substrate (2).
US09109194B2	Device for harvesting bacterial colony and method therefor When multiple kinds of bacterial colonies are present in a petri dish and, for example, a drug tolerance is to be measured, harvesting of mixed colonies of different types of bacteria makes it impossible to accurately determine the drug tolerance. Also, it is required to improve the throughput of a device for harvesting a bacterial colony. From images illuminated from multiple directions, isolating bacterial colonies are automatically extracted. Next, the image feature amounts are calculated from the multiple images that are illuminated from multiple directions and colonies are grouped depending on the feature amounts. Then, bacterial colonies to be harvested are determined based on the results of the grouping.
US09109186B2	Fragrance compounds and compositions Compounds of formula (I) wherein R is methyl or ethyl, having floral, green odor notes, their use as fragrance and perfumed products comprising them.
US09109185B2	Sliding member and sliding material composition An object of the present invention is to provide a sliding member capable of rapidly wrapping a mating member, and reducing the surface roughness of the mating member after wrapping. The present invention relates to a sliding member for sliding with a mating member subjected to hardening treatment, the sliding member including a coating layer containing a binder resin, molybdenum disulfide, and hard substance particles in massive form.
US09109180B2	Method for the hydrothermal carbonization of renewable raw materials and organic residues The present invention relates to a continuous method for the hydrothermal carbonization of renewable raw materials and organic residues, in which, in a first processing stage, a pressure increase essentially to the pressure level of the carbonization occurs, in the second processing stage, the carbonization, which is performed at a pressure of at least 5 bar and at most boiling temperature, the obtained carbonized product is at least partially settled as sediment, and the filling height of the water in the second processing stage is set by removing water, and the temperature of the sediment delivered from the second processing stage is reduced by the vaporization of water and it is supplied to the third processing stage, drying which is heated using steam, in which the drying is performed in steam atmosphere, and subsequently discharged from the process.
US09109176B2	Method for making marine bunker fuels This invention relates to low sulfur marine/bunker fuel compositions and methods of making same. Contrary to conventional marine/bunker fuel compositions/methods, the inventive lower sulfur compositions/methods focus on use of mostly uncracked components, such as (cat feed) hydrotreated gasoils, and/or can also have reduced contents of residual components.
US09109172B2	Low temperature gasification facility with a horizontally oriented gasifier A low-temperature gasification system comprising a horizontally oriented gasifier is provided that optimizes the extraction of gaseous molecules from carbonaceous feedstock while minimizing waste heat. The system comprises a plurality of integrated subsystems that work together to convert municipal solid waste (MSW) into electricity. The subsystems comprised by the low-temperature gasification system are: a Municipal Solid Waste Handling System; a Plastics Handling System; a Horizontally Oriented Gasifier with Lateral Transfer Units System; a Gas Reformulating System; a Heat Recycling System; a Gas Conditioning System; a Residue Conditioning System; a Gas Homogenization System and a Control System.
US09109171B2	System and method for gasification and cooling syngas A system includes an integrated gasification vessel including an enclosure including a first section and a second section that may enclose a gasifier, one or more injectors circumferentially disposed within the gasifier. The one or more injectors may supply the gasifier with a fuel. The system also includes a syngas cooler disposed within an annulus of the gasification vessel. The syngas cooler includes a shell that may flow a coolant and the syngas cooler includes a plurality of tubes surrounding the gasifier and that may flow a syngas from the gasifier. The system further includes a reinforcement system configured to reinforce at least a portion of the enclosure and the gasifier. The reinforcement system may include one or more reinforcement beams disposed within the annulus and that may couple the enclosure and the gasifier.
US09109170B2	Biodiesel cold filtration process An improved biodiesel production process includes the steps of processing a feedstock to produce biodiesel, cooling the biodiesel so as to form sediment, and filtering the biodiesel to remove the sediment. The resulting biodiesel from the cold filtration process avoids problems of sediment formation during storage and transportation.
US09109169B2	Maximizing aromatics production from hydrocracked naphtha A gasoline blending components production system useful for producing both aromatics and gasoline blending components from naphtha. The production system includes a light hydrocracked naphtha splitter, a medium hydrocracked naphtha splitter, a naphtha hydrotreater, an isomerization unit, a continuous catalytic reformer and aromatics complex. The production system is operable to produce both refined benzene and para-xylene products in addition to medium hydrocracked naphtha, isomerate, a C7s cut and a C9+ cut, which are useful for gasoline blending without additional treatment. A method for producing gasoline blending components while maximizing aromatic production includes introducing both stabilized hydrocracked naphtha to the light hydrocracked naphtha splitter and straight run naphtha to the naphtha hydrotreater. Operating the production system produces three types of hydrocracked naphtha: a light hydrocracked naphtha, a medium hydrocracked naphtha and a heavy hydrocracked naphtha. Light and heavy hydrocracked naphtha are directed to the naphtha hydrotreater.
US09109162B2	Narrow spectral line-width emission phosphors with broad band excitation edge up to and including the blue wavelength region Aspects of the present invention provide a family of phosphor compositions that may be used in the field of lighting applications. These phosphor compositions have crystal structures and chemical bond arrangements that enable broad band absorption and excitation using radiation up to and including the blue wavelength region. A preferred embodiment of the phosphor compositions has a general formula of (AxAy . . . Az)3−(1+q)m(W1−rMor)O6:Lnm,Dqm, wherein x+y+ . . . +z=1; 0≦r≦1; 0≦q≦1; 0
US09109143B2	Polypropylene-based adhesive compositions The present invention is related to adhesive compositions and their applications. In particular, the adhesive compositions described herein comprise a two or more propylene-based copolymers with varying comonomer content.
US09109137B2	Radiation curable (meth) acrylated compounds The present invention relates to (meth)acrylated compounds (A) prepared from (a) at least one cyclic ether polyol, (b) at least one linking compound (b1) and/or (b2), wherein the linking compound (b1) is selected from cyclic compounds (b11) containing at least one (I) group in the cycle where X=O or NH, from hydroxy acids (b12) and/or from alkylene oxides (b13) containing from 2 to 4 carbon atoms and the linking compound (b2) is selected from epihalohydrins or polyisocyanates, (c) a (meth)acrylating compound; and to their use in radiation curable compositions for the coatings, inks, overprint varnishes, adhesives and composites.
US09109136B2	Photopolymerizable inkjet ink, ink cartridge, and inkjet recording device A photopolymerizable inkjet ink including: at least one selected from the group consisting of (meth)acrylic acid esters negative for skin sensitization and (meth)acrylamides negative for skin sensitization; and at least one selected from the group consisting of vinyl ethers negative for skin sensitization, t-butyl methacrylate negative for skin sensitization, n-pentyl methacrylate negative for skin sensitization, and n-hexyl methacrylate negative for skin sensitization.
US09109133B2	Ink jet ink and recorded object The ink jet ink includes pigment, first resin which has a glass-transition temperature of less than 20° C. and a weight-average molecular weight of not more than 10000, second resin which has a glass-transition temperature of not less than 23° C., and specific polyoxyalkylene glycol monoalkyl ether.
US09109129B2	Inkjet ink, inkjet recording method, and inkjet recording apparatus An inkjet ink of the present invention including: water; an organic solvent; a surfactant; and a colorant, wherein the organic solvent comprises the following (1), (2) and (3): (1) at least one polyhydric alcohol having an equilibrium moisture content of 30% by mass or higher at a temperature of 23° C. and humidity of 80% RH; (2) an amide compound expressed by the Structural Formula (I); (3) a compound expressed by the Structural Formula (II); a compound expressed by the Structural Formula (III), or a compound represented by the General Formula (I), or any combination thereof.
US09109125B2	Ink composition for ultraviolet curable ink jets, ink jet recording apparatus using the same, ink jet recording method using the same, and ink set An ink composition for ultraviolet curable ink jets including monomer A represented by a general formula (I): CH2═CR1—COOR2—O—CH═CH—R3 (I) (in the formula, ‘R1’ represents a hydrogen atom or methyl group, ‘R2’ represents a divalent organic residue having a carbon number of 2 to 20, and ‘R3’ represents a hydrogen atom or a monovalent organic residue having a carbon number of 1 to 11), and a photopolymerization initiator containing an acylphosphine oxide-based photopolymerization initiator and a thioxanthone-based photopolymerization initiator, in which the total content of the acylphosphine oxide-based photopolymerization initiator and the thioxanthone-based photopolymerization initiator is 8% by mass to 16% by mass with respect to the total mass of the ink composition.
US09109115B2	Polyamide moulding compound and moulded articles produced herefrom The invention relates to a polyamide moulding compound made of a polyamide (PA MACM12) made of bis(3-methyl-4-aminocyclohexyl)methane (MACM) and dodecanedioic acid, a polyamide (PA PACM12) made of bis(4-aminocyclohexyl)methane (PACM) and dodecanedioic acid, a polyamide (PA MACM10) made of bis(3-methyl-4-aminocyclohexyl)methane and decanedioic acid, a polyamide (PA PACM10) made of bis(4-aminocyclohexyl)methane and decanedioic acid, a polyamide (PA MACM14) made of bis(3-methyl-4-aminocyclohexyl)methane and tetradecanedioic acid, a polyamide (PA PACM14) made of (bis(4-aminocyclohexyl)methane and tetradecanedioic acid and also mixtures and copolyamides thereof. Furthermore, the moulding compound comprises as impact modifier a functionalised styrene-ethylene/butylene-styrene block copolymer and also possibly further additives. Likewise, the invention relates to moulded articles produced from this polyamide moulding compound.
US09109106B2	Impact copolymer compositions for use in corrugated board The present invention relates to polymer compositions comprising a propylene impact copolymer and a processing aid, as well as corrugated boards made from such compositions. The impact copolymer has a melt flow range of from 1.5 to 3.5 g/10 min and a dispersed phase content of from 5 to 30% by weight. The dispersed phase of the impact copolymer has an ethylene content of from 30- to 70% by weight of the dispersed phase. The matrix phase of the impact copolymer is a propylene homopolymer or a random copolymer comprising units derived from propylene and a second copolymer selected from either ethylene or 1-butene wherein the units derived from the second copolymer comprise from 0 to 5% by weight of the dispersed phase.
US09109105B2	Process for preparing Ziegler-Natta produced polyethylene blends A process for preparing a multimodal polyethylene product with at least two different polyethylene resins can include producing a first polyethylene resin in the presence of a Ziegler-Natta catalyst in a reactor. The Ziegler-Natta catalyst used for the production of the first polyethylene resin has an average particle size (D50) of at most 15 μm. The HLMI of the first polyethylene resin is between 0.01 and 5 g/10 min. The process can include separately producing a second polyethylene resin in the presence of a Ziegler-Natta catalyst in a reactor. The MI2 of the second polyethylene resin is between 1 and 150 g/10 min. The process can include physically blending together the first and second polyethylene resins to produce a multimodal polyethylene product. The physical blending can be performed in a device for continuously melting and blending the first and second polyethylene resins.
US09109104B2	Resin composition and molded article thereof There is provided a resin composition affording a melt-molded article having excellent gas barrier properties and flex crack resistance. The present invention relates to a resin composition comprising a polyvinyl alcohol resin (A) having a 1,2-diol structural unit represented by the following general formula (1), a styrene-based thermoplastic elastomer (B), and a polyamide graft block copolymer (C) containing a polymer block of an aromatic vinyl compound and a polymer block of an olefinic compound in a main chain and having a graft chain composed of a polyamide: wherein each of R1, R2, and R3 independently represents a hydrogen atom or an organic group, X represents a single bond or a linking chain, and each of R4, R5, and R6 independently represents a hydrogen atom or an organic group.
US09109103B2	Functionalized polymer, rubber composition and pneumatic tire The present invention is directed to a functionalized elastomer comprising the reaction product of a living anionic elastomeric polymer and a polymerization terminator of formula I wherein R1 is C1 to C4 linear or branched alkanediyl; Z is R2, —OR3, or —R4—X; R2, R3 are independently C1 to C18 linear or branched alkyl; R4 is C1 to C18 alkanediyl; X is halogen or a group of structure II, III, IV, V or VI wherein R5, R6, R7, R8, and R9 are independently H or C1 to C8 alkyl; R10 is C2 to C8 alkanediyl; R11 and R12 are independently H, aryl or C1 to C8 alkyl; Q is N or a group of structure VII wherein R13 is C1 to C8 alkyl.
US09109098B2	Carbon black, rubber composition and pneumatic tire The present invention provides carbon black, the standard deviation σ of aggregate size distribution of which is obtained by alight scattering method using an ultraviolet ray, the standard deviation σ satisfying the expression (1): σ<−48.7×(24M4DBP/Dst)+161.8 (1). In the expression (1), 24M4DBP represents the dibutyl phthalate absorption number (cm3/100 g) of compressed sample, and Dst (nm) is a Stokes' equivalent diameter providing the mode in aggregate size distribution obtained by a centrifugal sedimentation method. The carbon black can improve both the abrasion resistance and the low rolling resistance of a tire. The present invention also provides a rubber composition mixed with this carbon black, and a pneumatic tire including a tread part formed by using this rubber composition.
US09109097B2	Method of preparing super absorbent polymer The present invention relates to a method of preparing a super absorbent polymer (SAP). The preparation method for SAP according to the present invention includes: preparing a first polymer by carrying out a thermal polymerization or photo polymerization of a monomer composition comprising a water-soluble ethylene-based unsaturated monomer and a polymerization initiator; preparing a second polymer by carrying out a thermal polymerization or photo polymerization of a monomer composition comprising a water-soluble ethylene-based unsaturated monomer and a polymerization initiator; drying the first polymer; milling the dried first polymer; and mixing the milled first polymer with the second polymer in the free swelling state using the crosslinking solution to cause a crosslinking reaction of the first and second polymers. According to the present invention, it is possible to obtain a super absorbent polymer (SAP) having high centrifuge retention capacity and high absorption under pressure.
US09109092B2	Method for preparing furanic copolyamide derived from biomass using solid-state polymerization Disclosed is a method for preparing a semi-furanic copolyamide containing at least one furanic dicarboxylic acid moiety and at least one aliphatic diamine moiety in the backbone. The method is based on solid-state polymerization. Particularly, the method uses a biomass-derived furanic dicarboxylic acid as a raw material. A semi-furanic copolyamide prepared by the method has molecular weight and color levels that are practically required in industrial applications. In addition, the semi-furanic copolyamide can replace fossil fuels due to its good thermal stability and is suitable for use as an environmentally friendly bioplastic.
US09109087B2	Low molecular weight branched polyamines for delivery of biologically active materials A branched polyamine comprises about 8 to about 12 backbone tertiary amine groups, about 18 to about 24 backbone secondary amine groups, a positive number n′ greater than 0 of backbone terminating primary amine groups, and a positive number q greater than 0 of backbone terminating carbamate groups of formula (2): wherein (n′+q) is a number equal to about 8 to about 12, the starred bond of formula (2) is linked to a backbone nitrogen of the branched polyamine, L′ is a divalent linking group comprising 3 to 30 carbons, and q/(n′+q)×100% equals about 9% to about 40%.
US09109084B1	Synthesis of polyepoxy succinic acid compounds using free radical initiators Methods of synthesizing polymers including repeat units of the formula comprise the step of polymerizing repeat units of the formula in the presence of a free radical catalyst, where each R and each M is separately and independently selected from the group consisting of H, C1-C12 straight or branched chain alkyl, aryl, amine, amide, and ester groups, halides, and mixtures thereof, and n ranges from about 2-15.
US09109077B2	Foamed polyurethanes having improved flexing endurance properties The present invention relates to foamed polyurethane obtainable by mixing a) polyisocyanates, b) relatively high molecular weight compounds having groups reactive toward isocyanate groups, c) solid particles, d) blowing agents, e) if appropriate, chain extender, crosslinking agent or mixtures thereof, f) if appropriate, catalyst and g) if appropriate, other additives to give a reaction mixture and allowing the reaction mixture to react to completion, the propotion of chain extender being less than 6% by weight, based on the total weight of the components a) to f), the content of solid particles being greater than 15% by weight, based on the total weight of the components a) to f), and the average functionality of the relatively high molecular weight compounds having groups reactive toward isocyanate groups being less 2.5. The present invention furthermore relates to a molding comprising a foamed polyurethane according to the invention, a process for the preparation of the foamed polyurethane according to the invention and the use of a molding according to the invention as a shoe sole.
US09109070B2	Nanoparticles with multiple attached polymer assemblies and use thereof in polymer composites Methods of synthesizing a binary polymer functionalized nanoparticle are generally provided. In one embodiment, a first anchoring compound is attached to a nanoparticle, and a first plurality of first monomers are polymerized on the first anchoring compound to form a first polymeric chain covalently bonded to the nanoparticle via the first anchoring compound. In another embodiment, a first polymeric chain can be attached to the nanoparticle, where the first polymeric chain has been polymerized prior to attachment to the nanoparticle. Thereafter, a second anchoring compound is attached to the nanoparticle, and a second plurality of second monomers are polymerized on the second anchoring compound to form a second polymeric chain covalently bonded to the nanoparticle via the second anchoring compound. Nanoparticles are also generally provided having multiple polymeric assemblies.
US09109069B2	Vinyl ester resin composition that contains minute polymer particles, process for production of same, and cured products of same The present invention provides a vinyl ester resin composition obtained by an improved production method and having improved quality, by providing a minute polymer particle-containing vinyl ester resin composition containing 100 parts by weight of a vinyl ester resin, 1 to 100 parts by weight of a minute polymer particle, and 0 to 100 parts by weight of a vinyl monomer, wherein the primary particle size of the minute polymer particle is 0.05 μm to 1 μm, and the minute polymer particles are dispersed in the form of primary particles in the minute polymer particle-containing vinyl ester resin composition.
US09109064B2	Ethylene polymerization process using an inhibitor The present invention relates to an ethylene homo- or copolymerization process, characterized in that an inhibitor is added to the reaction mixture or any of its components before the reaction mixture is fed to the reaction zone. The present invention further relates to the use of an inhibitor to reduce fouling in an ethylene homo- or copolymerization process.
US09109050B2	Process using hydrocyclones The present invention concerns a process for preparing of slurries containing suspended and dissolved particles and a solution as well as a slurry are provided onto a hydrocyclone equipment, disk centrifuge or nozzle centrifuge equipment. The dry matter concentration in the collected slurry is higher than the concentration of the mixture of the slurry and the solution as such. The use of a hydrocyclone stage for this specific purpose is disclosed as well.
US09109048B2	Inhibition of tumor growth The present invention provides a cytotoxic 7 to 25 mer peptide with three or more cationic residues which has one or more non-genetic bulky and lipophilic amino acids, as well as esters, amides, salts and cyclic derivatives thereof as well as methods of preparing the peptides, pharmaceutical compositions containing them and their use as medicaments, particularly as antibacterions or antitumoral agents. In a preferred aspect, the invention provides the use of said peptides in a method of inducing adaptive immunity against tumor growth or establishment in a subject, as well as the use of other lytic agents in a method of inducing adaptive immunity in a subject.
US09109047B2	High molecular ordered fibrilar structures, method for their preparation and uses thereof The present invention relates to methods for generation of high molecular ordered fibrilar structures. More particularly, the method of the invention utilizes CBD's (cellulose binding domain) ability to form dimers for directing ordered assembly of fibrous proteins such as silk proteins into super-molecular fibrilar structures. The invention further provides fibrilar structures such as fibers and articles comprising said fibrilar structures.
US09109041B2	Analog compounds of analgesic peptides derived from the venom of crotalus durissus terrificus snakes, their uses, compositions, methods of preparation and purification The present invention refers to analog compounds of peptides having the amino acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, including analgesic peptides derived from snakes of species such as Crotalus durissus terrificus; their uses in the treatment, diagnosis and prevention of painful conditions or mediated by opioid receptors, their pharmaceutical compositions and their methods of preparation and purification, including their uses in the identification of analgesic compounds.
US09109037B2	Anti-SOD1 antibodies and uses thereof The present invention features anti-SOD1 antibodies and methods of using the antibodies for the treatment of amyotrophic lateral sclerosis (ALS) or the amelioration of symptoms associated with ALS.
US09109030B1	Epsigam fusion protein Epsi-gam provides a novel fusion protein with the ability to cross-link either of the FcεRI or FcεRII cell surface receptors with an FcγRIIb cell surface receptor in order to block IgE-mediated biological responses.
US09109025B2	Anti-RSPO2 antibodies The present invention relates to RSPO-binding agents and methods of using the agents for treating diseases such as cancer. The present invention provides antibodies that specifically bind human RSPO proteins and modulate β-catenin activity. The present invention further provides methods of using agents that modulate the activity of RSPO proteins, such as antibodies that specifically bind RSPO1, RSPO2, and/or RSPO3 and inhibit tumor growth. Also described are methods of treating cancer comprising administering a therapeutically effect amount of an agent or antibody of the present invention to a patient having a tumor or cancer.
US09109022B2	Production of carrier-peptide conjugates using chemically reactive unnatural amino acids Provided are methods of making carrier polypeptide that include incorporating a first unnatural amino acid into a carrier polypeptide variant, incorporating a second unnatural amino acid into a target polypeptide variant, and reacting the first and second unnatural amino acids to produce the conjugate. Conjugates produced using the provided methods are also provided. In addition, orthogonal translation systems in methylotrophic yeast and methods of using these systems to produce carrier and target polypeptide variants comprising unnatural amino acids are provided.
US09109020B2	Use of ADCC-optimized antibodies for treating weak patients The invention concerns the use of human or humanized chimeric monoclonal antibodies which are produced in selected cell lines, said antibodies bringing about a high ADCC activity as well as a high secretion of cytokines and interleukins, for treating underpopulations of so-called weak-response patients exhibiting CD16 FCGR3A-158F homozygote or FCGR3A-158V/F heterozygote polymorphism.
US09109015B2	Method of isolating biomacromolecules using low pH and divalent cations The present invention is related to a method of isolating a biological macromolecule in a composition. Specifically, the present invention is directed to a method of isolating a biomacromolecule in a composition containing an impurity, the method comprising (a) lowering the pH of the composition, (b) adding a divalent cation to the composition, and (c) separating the biomacromolecule from the impurity.
US09109007B2	MHC-I restricted epitopes containing non-natural amino acid residues The invention provides for the synthesis of more effective generators of a T-cell immune response by providing peptide derivatives that are MHC class I-restricted antigens. The peptide derivatives of the present invention are prepared or derived from a parent peptide of 8 to 11 amino acid residues in length, wherein the peptide derivative contains a non-natural amino acid substituted in place of a naturally-occurring amino acid residue at one or more primary anchor positions in the parent peptide or at position 6, position 7, or the C-terminus. The exemplary polypeptides are derived from the survivin, hTERT, CYP1B1 and MART-1 antigens.
US09109004B2	Progesterone receptor antagonists The invention relates to 17-hydroxy-17-pentafluoroethyl-estra-4,9(10)-dien-11-aryl derivatives of formula I with progesterone-antagonizing action and methods of production thereof, use thereof for the treatment and/or prevention of diseases and use thereof for producing medicinal products for the treatment and/or prevention of diseases, in particular uterine fibroids (myomata, uterine leiomyomata), endometriosis, heavy menstrual bleeding, meningiomata, hormone-dependent breast cancers and menopause-associated complaints or for fertility control and emergency contraception.
US09109002B2	E-selectin antagonist compounds, compositions, and methods of use Methods and compositions using E-selectin antagonists are provided for the treatment and prevention of diseases and disorders treatable by inhibiting binding of E-selectin to an E-selectin ligand. Described herein are E-selectin antagonists including, for example, glycomimetic compounds, antibodies, aptamers and peptides that are useful in methods for treatment of cancers, and treatment and prevention of metastasis, inhibiting infiltration of the cancer cells into bone marrow, reducing or inhibiting adhesion of the cancer cells to endothelial cells including cells in bone marrow, and inhibiting thrombus formation.
US09108995B2	Spirobenzylamine-phosphine, preparation method therefor and use thereof The present invention relates to a spirobenzylamine-phosphine, preparation method therefor and use thereof. The compound has a structure represented by formula (I), wherein n=0 to 3; R1, R2, R3, R4, R5, R6, R7, R8 and R9 having a value as defined in claim 1. Starting from the substituted 7-trifluoromesyloxy-7′-diarylphosphino-1,1′-spiro-dihydroindene, the compound is synthesized in a two-step or three-step reactions. The new spirobenzylamine-phosphine is complexed with an iridium precursor and is subjected to ion exchange, to give an Iridium/spirobenzylamine-phosphine complex comprising various anions. The spiro benzyl amine-phosphine/Iridium complex according to the present invention may be used for catalyzing asymmetry hydrogenation of a variety of alpha-substituted acrylic acids, has high activity and enantio-selectivity, and has a good prospect of industrialization.
US09108993B2	Pyrazole derivatives as sphingosine 1-phosphate (S1P) receptor modulators The present invention relates to pyrazole derivatives, processes for preparing them, pharmaceutical compositions containing them and their use as pharmaceuticals as modulators of sphingosine-1-phosphate receptors.
US09108992B2	Carboxyl-functionalized silicon-containing precursor compound of various organic carboxylic acids The invention relates to a composition of a carboxyl-functionalized silicon-containing precursor compound of at least two different organic acids, said composition having two, three, or four carboxyl groups functionalized with various hydrocarbon groups according to formula I and/or II. Said carboxyl groups can be released as carboxylic acids and can be used as silane hydrolysis catalysts and/or silane condensation catalysts. The invention further relates to methods for producing the composition, to the use of the composition for cross-linking polymers, and to a formulation of the composition in the form of a masterbatch.
US09108971B2	6-cycloamino-3-(pyridazin-4-yl)imidazo[1,2-b]-pyridazine and derivatives thereof preparation and therapeutic application thereof The invention relates to the 6-cycloamino-3-(pyridazin-4-yl)imidazo[1,2-b]pyridazine derivatives corresponding to general formula (I): Wherein R2, R7, R8, A, L and B are as defined herein. Also disclosed are the preparative methods and therapeutic use thereof.
US09108969B2	Substituted tricyclic acid derivatives as S1P1 receptor agonists useful in the treatment of autoimmune and inflammatory disorders The present invention relates to certain substituted tricyclic acid derivatives of Formula (I) and pharmaceutically acceptable salts thereof, which exhibit useful pharmacological properties, for example, as agonists of the S1P1 receptor. Also provided by the present invention are pharmaceutical compositions containing compounds of the invention, and methods of using the compounds and compositions of the invention in the treatment of S1P1 -associated disorders, for example, psoriasis, rheumatoid arthritis, Crohn's disease, transplant rejection, multiple sclerosis, systemic lupus erythematosus, ulcerative colitis, type I diabetes, acne, myocardial ischemia-reperfusion injury, hypertensive nephropathy, glomerulosclerosis, gastritis, polymyositis, thyroiditis, vitiligo, hepatitis, biliary cirrhosis, microbial infections and associated diseases, viral infections and associated diseases, diseases and disorders mediated by lymphocytes, auto immune diseases, inflammatory diseases, and cancer.
US09108967B2	Process for the preparation of morphine analogs via metal catalyzed N-demethylation/functionalization and intramolecular group transfer The present application is directed to an efficient conversion of C-14 hydroxylated morphine alkaloids to various morphine analogs, such as naltrexone, naloxone and nalbuphone. One feature of this process is an intramolecular functional group transfer from the C-14 hydroxyl to the N-17 nitrogen atom following a palladium-catalyzed N-demethylation.
US09108966B2	Beta-lactamase inhibitors Aryl substituted diazabicyclooctanes (DBO) compounds that inhibit β-lactamases of class A, class C or class D and potentiate β-lactam antibiotics are disclosed. In particular, this disclosure provides DBO compounds that, when used in the disclosed Synergy MIC Assay with a β-lactam antibiotic at a fixed concentration have an MIC of 8 μg/mL or less against one or more isogenic β-lactamase expressing bacterial strains.
US09108960B2	Nitrofurfuryl substituted phenyl linked piperidino-oxadiazoline conjugates as anti-tubercular agents and process for the preparation thereof The present invention provides nitrofurfuryl substituted phenyl linked piperidino-oxadiazolone compounds of general formula (A) as anti-tubercular agents; wherein G=formula (B); X═H, F; R═H, CH3, C2H5, Benzyl.
US09108952B2	Processes to produce certain 2-(pyridine-3-yl)thiazoles The invention disclosed in this document is related to the field of processes to produce certain 2-(pyridine-3-yl)thiazoles as intermediates for the synthesis of pesticidal thiazole amides.
US09108939B2	(1, 1, 1,3,3,3-hexafluoro-2 hydroxypropan-2-yl) phenyl derivative, pharmaceutical compositions thereof and their use for the treatment of atherosclerosis The present invention relates to (1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)phenyl derivatives having the general formula (I) to pharmaceutical compositions comprising the same and to the use of these (1,1,1,3,3,3-hexafluoro-2-hydroxy-propan-2-yl)phenyl derivatives in the treatment of atherosclerosis.
US09108937B2	Positive allosteric modulators of mGluR2 The present invention is directed to 5-substituted 1,3-dihydro-2,1,3-benzothiadiazole 2,2-dioxide and 1,3-dihydro[1,2,5]thiadiazolo[3,4-b]pyridine 2,2,-dioxide derivatives which are potentiators of metabotropic glutamate receptors, particularly the mGluR2 receptor, and which are useful in the treatment or prevention of neurological and psychiatric disorders associated with glutamate dysfunction and diseases in which metabotropic glutamate receptors are involved. The invention is also directed to pharmaceutical compositions comprising these compounds and the use of these compounds and compositions in the prevention or treatment of such diseases in which metabotropic glutamate receptors are involved.
US09108930B2	N1- and N2-carbamoyl-1,2,3-triazole serine hydrolase inhibitors and methods The present invention provides inhibitors of a wide variety of serine hydrolase enzymes. The inhibitors of the present invention are N1- and N2-carbamoyl-1,2,3-triazole compounds such as those of Formula (I): in which N1, N2, and N3 are the nitrogen atoms at positions 1, 2, and 3, respectively, of the triazole ring, and R4, R5, R6 and R7 in Formula (I) are as described herein. Methods of inhibiting serine hydrolase enzymes and methods of preparing carbamoyl-1,2,3-triazole compounds also are described.
US09108924B2	Process for the preparation of bendamustine hydrochloride The present invention relates to an improved process for the synthesis of bendamustine, in particular, bendamustine hydrochloride of the formula (VI) and its intermediate 1-methyl-5-[bis(2-chloroethyl)amino]-1H-benzimidazol-2-yl]lithium butanoate of formula (V), both having a purity of ≧99%, which is simple, convenient, economical, does not use hazardous chemicals and is industrially viable.
US09108921B2	Therapeutic compounds and compositions Compounds of general formula I: and compositions comprising compounds of general formula I that modulate pyruvate kinase are described herein. Also described herein are methods of using the compounds that modulate pyruvate kinase in the treatment of diseases.
US09108916B2	Carbazole compounds and therapeutic uses of the compounds Compounds of the general structural formula (I) and (II) and use of the compounds and salts and hydrates thereof, as therapeutic agents are disclosed. Treatable diseases and conditions include cancers, inflammatory diseases and conditions, and immunodeficiency diseases. (I), (II).
US09108900B2	Method of treating diseases that respond to therapy by dopamine or dopamine agonists The invention relates to a medicament containing (S)-2-N-propylamino-5-hydroxytetralin, the salts or prodrugs thereof. As a D3 agonist, (S)-2-N-propylamino-5-hydroxytetralin is suitable particularly for the treatment of dopa-sensitive movement disorders.
US09108887B2	Method for producing ceramic for heat-radiating members, ceramic for heat-radiating members, and solar cell module and LED light-emitting module using said ceramic Provided is a process for producing a ceramic for a heat-radiating member. The process includes providing as a raw material an alumina powder having an alumina (Al2O3) content of at least 99.5 mass % and an average particle size of from 0.2 to 1 μm, and granulating the powder into a granular form ranging from 50 to 100 μm, pressing the raw material which has been obtained in the granulation step and which includes granular alumina, and heating a green compact in an air atmosphere at a firing temperature of from 1,480 to 1,600° C. to obtain a sintered body. Also provided is a process for producing a ceramic for a heat-radiating member, the ceramic being a sintered alumina body which has high thermal conductivity, efficient heat dissipation, excellent mechanical strength and thermal shock resistance and which is usable for cooling applications at heat generating areas of electronic devices and equipment.
US09108882B2	Solar-protection glazing having an improved light transmission coefficient The invention relates to a transparent glass substrate including at least one glass sheet provided with a thin-film multilayer coating acting on solar radiation, having a light transmission of greater than 10% and an emissivity of less than 50% after a heat treatment, such as a bending or toughening treatment, characterized in that said multilayer coating includes: a niobium Nb functional layer with a thickness of between about 5 nm and about 35 nm; and at least one layer of another material, chosen from the group formed by Ti, Mo, B, Al or an alloy comprising at least one of these elements, which is placed relative to the glass substrate above the functional layer, said layer having a thickness of between about 1 nm and about 5 nm. The invention also relates to monolithic glazing or double glazing incorporating such a substrate.
US09108878B2	Plate glass and manufacturing process thereof Provided is the plate glass having high annealing temperature, high strength, excellent flatness and low viscosity, and manufacturing process thereof, which can be used for display and photovoltaic solar device. The plate glass contains (in mass %) boron oxide 0-3.9%, sodium oxide 0.01-14%, iron oxide 0.01-5%, fluorine oxide 0%, magnesia 7-22.2%, alumina 0.01-39%, wherein the content of silica is 1.9-4.1 times that of calcium oxide, the content of calcium oxide is 1.0-1.8 times that of magnesia.
US09108877B2	Glass base material elongation method Provided is a glass base material elongation method for elongating a glass base material with a large diameter to manufacture a glass rod with a smaller diameter, the method comprising, when elongating a glass base material that has a transparent glass tapered portion at one end of a trunk portion and a glass tapered portion including a non-transparent glass portion at the other end of the trunk portion, prior to the elongation, fusing a hanging dummy to an end of the transparent glass tapered portion, setting the hanging dummy in communication with a feeding mechanism, inserting the glass base material into a heating furnace beginning with the other end, and performing elongation.
US09108874B2	Method of making inorganic, metal oxide spheres using microstructured molds A process for making inorganic, metal oxide spheres that includes exposing solidified, molded microparticles that include a glass precursor composition to a temperature sufficient to transform the molded microparticles into molten glass and cooling the molten glass to form inorganic, metal oxide spheres.
US09108873B2	Glass-substrate manufacturing method and glass-substrate manufacturing device A glass-substrate manufacturing method according to an aspect of the invention is a method for manufacturing glass substrates by employing a down-draw process. In down-draw processing, a molten glass is made to overflow from a forming member and formed into a sheet glass and the sheet glass is then cooled while being drawn in a downward-flow direction. In this glass-substrate manufacturing method, after the sheet glass has separated from the forming member and when the temperature of the sheet glass is within a temperature region ranging from a temperature higher than the softening point to a temperature near the annealing point, the sheet glass is cooled by maintaining the viscosity of side sections of the sheet glass within a range of 109.0-1014.5 poise while applying a tension toward the side sections.
US09108869B2	pH adjustment within gasification system A gasification system includes a water source, a downstream system configured to receive a first stream having water from the water source, and a carbon a carbon dioxide injector configured to adjust a pH of the water using a second stream having carbon dioxide to form pH-adjusted water.
US09108857B2	Process for ammonia saturation of solid materials, and corresponding assembly A process for ammonia saturation of a solid material capable of absorbing and desorbing ammonia, the solid material being composed of solid particles and includes placing the solid material in contact with a cooled surface, with the solid material being disposed against the cooled surface in a thin layer having a thickness of less than 100 mm. The process further includes injecting a stream of gaseous ammonia to be in contact with the solid material, while the solid material is in contact with the cooled surface.
US09108852B1	Amorphous activated carbon materials and methods for producing the same A method for producing an amorphous activated carbon material includes heating a carbon precursor to a temperature effective to form a partially-dense amorphous carbon, and activating the partially-dense amorphous carbon to produce an amorphous activated carbon. To facilitate efficient activation of the amorphous carbon, the carbonization is controlled to produce an amorphous carbon material that, prior to activation, has a density of from 85% to 99% of a maximum density for the amorphous carbon.
US09108836B2	Method and filling element for the pressure-filling of containers with a liquid filling material A method for filling containers with a filling material under pressure using a filling system comprising a filling element, which has a liquid channel having a liquid valve in a filling element housing, wherein the liquid channel is connected to a liquid chamber of a filling material vessel, which is partially filled with filling material and under pre-stress or filling pressure, upstream of the liquid valve in the flow direction of the filling material and forms at least one discharge opening downstream of the liquid valve in the flow direction of the filling material, at which discharge opening the particular container is arranged with a container opening in a sealed position at least during the filling process, and wherein a probe is arranged in a return gas pipe.
US09108828B2	Lift mechanism A lift mechanism is provided. The lift mechanism includes a frame having a base, a spine extending from the base and a table, adjustment units configured to permit table adjustments, an attachment mechanism by which the table is attachable to a rack frame and a driving unit configured to drive a load relative to the rack frame.
US09108825B2	Rig supply handler A method of controlling a crane and a manipulator including determining the relative motion between a first platform including the crane and a second platform, determining the current position of the manipulator, and repositioning the manipulator to compensate for the relative motion between the first platform and the second platform and in accordance with operator commands.
US09108819B2	Folding apparatus and a folding method for a combined body of a continuous sheet related to an absorbent article A folding apparatus for a combined body of a continuous sheet includes a standing guide member disposed at a predetermined position in a conveying direction, and standing an one end section of the combined body in a width direction by bending a predetermined section of the combined body in the width direction and forming a bent section; a folding guide member corresponding to the stood one end section in the conveying direction for folding the stood one end section by laying the one end section towards a section located closer to another side than the one end section in the combined body; and a shift-regulating guide member for regulating shifting of the combined body towards the one side in the width direction by coming into contact, from the one side, with the combined body when laying the one end section towards the section located closer to the other side.
US09108817B1	Web guiding structure with continuous smooth recesses A web-guiding system for guiding a web of media travelling from upstream to downstream along a transport path in an in-track direction. A web-guiding structure includes an exterior surface having a pattern of alternating ridges and recesses formed into the exterior surface. The web of media travels past the web-guiding structure with the first side of the web of media contacting at least some of the ridges on the exterior surface of the web-guiding structure. The ridges and recesses are formed into the exterior surface of the web-guiding structure such that the exterior surface has a continuous and smooth surface profile in the cross-track direction having a specified maximum slope magnitude and a specified minimum radius of curvature magnitude.
US09108813B2	Image forming apparatus and recording-material-transporting device An image forming apparatus includes an image forming section that forms an image, a transport path section along which a recording material that is yet to undergo or has undergone image formation performed by the image forming section is transported, a transport unit that is provided in the transport path section and transports the recording material while nipping the recording material, an operated portion that is operated by a user and activates the transport unit such that the recording material is removed from the transport unit, and a notification unit that notifies a completion of the operation of the operated portion on the basis of a position of the recording material that is removed from the transport unit by the user's operation of the operated portion.
US09108812B2	Sheet feeder cassette A sheet feeder cassette that can be fitted in and drawn from in a direction perpendicular to a sheet feeding direction, the sheet feeder cassette having: a bottom for receiving a stack of sheets thereon; a pair of side stopper plates provided on the bottom in such a manner to be movable in a sheet-widthwise direction so as to determine a widthwise position of the stack of sheets; and at least one displacement preventive device that is located on the bottom, at a position according to a widthwise position of a loadable maximum size sheet, and that is capable of coming into contact with one of the side stopper plates, wherein when the one of the side stopper plates receives force from a stack of the maximum size sheets placed on the bottom, the displacement preventive device pushes back and supports the side stopper plate due to reaction.
US09108799B2	Conveyor chain The purpose of the present invention is to provide a conveyor chain conveying a conveyance object such as a bucket while the conveyance object is mounted thereon, wherein the conveyance object can be conveyed to a predetermined position while both the conveyance object and the receiving member are not damaged by “biting” or “hooking” at upstream or downstream end in a conveying direction. An upstream tapered surface and a downstream tapered surface, which reduce the thickness of the receiving member gradually along the extended direction, are formed respectively at sides in the extended direction of a mounting surface of the receiving member. A locus of the mounting surface in a case in which the conveyor chain is meshed with and wound onto a sprocket is within a circle which is coaxial to the sprocket and whose tangent is a straight locus of the mounting surface in a case of conveying a bucket (conveyance object).
US09108793B2	Ice cream container and method of manufacturing same Embodiments of the present invention provide cartons that they are designed and shaped to hold product, such as ice cream, that are made from a single, one-piece blank. The one-piece blank can be folded by the food product manufacturer on-site to create a container or carton, without having to be shipped in a pre-glued configuration. The cartons generally do not require polyethylene in order to maintain their shape. Some embodiments are designed so as to have a slight outward taper of the left and right side walls and the back wall, which provides a pleasing shape to consumers, potentially increasing marketing opportunities and sales.
US09108790B2	Divider and cutting board A system (and method) for use with a cooler having a plurality of interior, opposed vertical channels comprises a cutting board and a cutting board holding assembly. The cutting board holding assembly comprises a first vertical side wall coupled to and positioned opposite a second vertical side wall, the first and second side walls defining a receptacle configured to receive the cutting board. Further, the first and second side walls are configured to slidingly engage two opposed vertical channels of a cooler.
US09108789B2	Method for adding a fusible material to a container wall A method for adhering a shaped fusible material (6) to a portion of a metallic container wall (2) comprising applying the shaped material to said wall portion in a contacting relationship, heating said wall portion with an induction heater to melt the contacting surface of the shaped fusible material, and cooling the assembly to re-solidify the melted surface of the fusible material; and products of the foregoing method.
US09108788B2	Apparatus for cooking an egg using microwave radiation The invention relates to an apparatus for boiling an egg, comprising a device for providing microwave radiation in a confined space, comprising a holder with at least one cavity adapted to the shape of an egg with an eggshell, said cavity provided with a first layer surrounding the eggshell, said first layer: —is in heat exchanging contact with the shell of the egg; —has a dielectric constant with an imaginary part, ∈″, between 20-500 at a temperature between 0° C.-100° C. and at a microwave frequency of 2.45 GHz, and —having a layer thickness d of 1-6 millimeter and varying less than 30% over the egg, or said holder for holding at least one egg assembly adapted for cooking an egg using microwave radiation.
US09108786B2	Transport device and transport means therewith A device for the transportation of vehicles, at a prescribed maximum height of the system, transports an increased possible number of vehicles on a given surface area. The device is suitable for transportation by air, sea, and land. In this context, the vehicles are not unloaded from the device, even in the case of combined land, sea, or air transportation. The device consists of a lower pallet and an upper pallet. The upper pallet is supported on booms which, in turn, rest on the lower pallet. The booms are individually height-adjustable so that the upper pallet can be tilted relative to the lower pallet in the longitudinal direction. At the second end, there is a support element on which the device can be moved in the lengthwise direction, at least if it has been slightly lifted at the opposite first end.
US09108780B2	Cardboard container for bottles and a blank for obtaining the container The cardboard container has a base wall (10), a first lateral wall (11) and a second lateral wall (12), at two opposite longitudinal sides of the base wall (10), and which are foldable. A first series of tabs (2) each exhibit a first portion (21) exhibiting a through-hole (210) for inserting a bottle (F) and which is connected with the first lateral wall (11). A second series of tabs (3) each exhibit a first portion (31) exhibiting a through-hole (310) for insertion of a bottle (F) and which is connected in a single body with the second lateral wall (12) and with a second portion (33) fixed to the base wall (10). All the tabs are foldable, together with the first lateral wall (11) and the second lateral wall (12), such as to enable the container to take on a flattened configuration (I) and an opened-out volume (O).
US09108770B2	Re-sealable packaging A re-sealable package and method which includes roll stock, a pressure sensitive label and a release member. The re-sealable package includes an outer layer laminated to an inner sealant layer. The pressure sensitive label has a first preselected shape and includes a pressure sensitive adhesive on one side. The side having the pressure sensitive layer is adhered to the inner sealant layer of the roll stock. The release member is formed in the outer layer, the release member having a second preselected shape which is smaller than the first preselected shape of the pressure sensitive label. As the release member is lifted from the pressure sensitive label, an area of the pressure sensitive adhesive is exposed to allow portions of the package to be removably adhered to the area of pressure sensitive adhesive.
US09108767B2	Device for the individual transport of fruit A device for the individual transport of fruit, comprising a single integral part, which comprises a central base (13) which is the starting point for a series of concentric sections (4) all of which are arranged in a single circumferential direction, and end in short end portions (6-6′) which connect to two handle structures (7) which comprise a hooking device in order to stabilize the position for use of the integral part in which is defined a shell space which houses the fruit, such as a watermelon (1), the surface of which closely matches the various elements of the integral part. Thus, in the operative position for use, the device according to the invention has a basket-type structure which closely matches the outer surface of the fruit.
US09108759B2	Interlocking crating batten system An interlocking crating batten system may include a middle section that has a top portion, a top edge, a bottom portion, a first end portion and a second end portion. The first end portion has a concave area and the second end portion has a convex area. The first end portion has a least one tab extended out from the bottom portion of the middle section. A base section may have a least one slot along a primary end. The base section may lay between the middle section and a crate, with at least one slot removably engaged with at least one tab. An attachment device may connect the middle section and the base section to the crate.
US09108755B2	Package, container, assembly, and method for containing a food product A package includes a support member and a second support member coupled to a base member. The support members may be configurable between a heating position and a storage position. When in the heating position a recess is positioned below the support members. The package may be part of an assembly further including a flexible container. The flexible container may include a first portion with a food product and a second portion configured to receive liquid byproducts given off by the food product. The second portion of the flexible container may be received in the recess when the assembly is in the heating position.
US09108754B2	Horizontal plastic stretch wrapping apparatus A horizontal plastic stretch wrapping apparatus includes a main frame, a plurality of control components, an electrical enclosure, a plurality of control buttons, a slip ring, a wrapping arm, and a wrap dispenser. The electrical enclosure and the plurality of control components are positioned within the main frame, and the plurality of control buttons is positioned on the main frame. The plurality of control buttons controls the plurality of control components and the electrical enclosure. The wrap dispenser is connected to the wrapping arm, and the wrapping arm is connected to the main frame. The slip ring is positioned in between the main frame and the wrapping arm and provides electrical power from the electrical enclosure to the wrap dispenser. Once the horizontal plastic stretch wrapping apparatus is powered, a skid can be horizontally wrapped with a wrapping material by the rotating wrapping arm.
US09108750B2	Modular device for multi-axial insulation against vibration and impacts, based on elastomer The invention related to a device comprising at least three insulation modules distributed around vibration equipment. Each module comprises at least two rigid parts, at least one of said parts being an outer part fixed to the carrier structure and at least one of said parts being an inner part fixed to the equipment or the stand (3) thereof. At least one elastomer insulating plug connects an inner part and an outer part and at least one of said parts carries two longitudinal flexible abutments and two tangential flexible abutments which each have a free end facing another respectively outer or inner rigid part, said free end being at a distance from the inner part in an idle position. The invention can be applied to satellite equipment.
US09108742B2	Ram air turbine stow abort assembly An example ram air turbine stow abort assembly includes a release pin movable between an engaged position that prevents rotation of a drive shaft and a released position that allows rotation of the drive shaft. A release lever is rotatable about an axis in response to the release pin being in the engaged position or the released position. A pawl has a link to the release lever. The link causes the pawl to move toward the axis from a locking position to a clearance position. The pawl is positioned to engage a lock when in the locking position to prevent movement of the ram air turbine assembly to a stowed position when the turbine blades are misaligned.
US09108739B2	Taxiing aircraft vicinity visualization system and method According to an embodiment, a method provides information regarding the vicinity of a vehicle. The method includes, in the vehicle, providing a sensor signal representative of an environmental condition in a vicinity of the vehicle, transmitting the sensor signal over a power line in the vehicle, receiving the sensor signal transmitted over the power line and transmitting a corresponding wireless sensor signal in the vehicle, receiving the wireless sensor signal and recovering the sensor signal, and presenting the recovered sensor signal in a human-perceivable form.
US09108738B1	Apparatus for refueling aircraft An apparatus comprises a refueling system for a number of fuel tanks, a primary valve, and a secondary valve. The refueling system has branches capable of distributing fuel into the number of fuel tanks. The primary valve is associated with a primary branch in the branches. The primary valve and the secondary valve are independently controlled to change a distribution of the fuel through the branches into the number of fuel tanks.
US09108729B2	Autonomous control of unmanned aerial vehicles A control module for an unmanned aerial vehicle is provided. In one example, the control module includes a plurality of control modes, wherein each control mode represents a different autonomy setting, a command generator configured to generate a command causing a selection of a first of the plurality of control modes for the unmanned aerial vehicle, and an intelligence synthesizer that automatically switches the unmanned aerial vehicle between the selected first of the plurality of control modes and a second of the plurality of control mode upon detection of a trigger event.
US09108716B2	Aircraft having a recessed cavity in an aft pressure bulkhead wall surface and a galley moved rearwardly into the recessed cavity increasing floor space in front of the galley An aircraft cabin has been reconfigured with a rear fuselage galley and a modified aft pressure bulkhead that enables the galley to be moved rearwardly to provide additional floor space in the aircraft cabin.
US09108713B2	Elevon control system A system comprising an aerial vehicle or an unmanned aerial vehicle (UAV) (100, 400, 1000, 1500) configured to control pitch, roll, and/or yaw via airfoils (141, 142, 1345, 1346) having resiliently mounted trailing edges opposed by fuselage-house deflecting actuator horns (621, 622). Embodiments include one or more rudder elements (1045, 1046, 1145, 1146, 1245, 1345, 1346, 1445, 1446, 1545, 1546) which may be rotatably attached and actuated by an effector member (1049, 1149, 1249, 1349) disposed within the fuselage housing (1001) and extendible in part to engage the one or more rudder elements.
US09108712B2	Airship with a controlled variable profile The invention relates to an airship comprising a flexible envelope having at least one adjustment region provided with two longitudinal adjustment elements mounted in opposition and mobile in relation to each other between a maximum distancing position and a minimum distancing position, the two longitudinal adjustment elements being connected to each other by a group comprising a plurality of cables crossing the inner space of the envelope, each of the cables cooperating with a plurality or tightening points provided along each longitudinal element. The cables are connected to at least one tightening module that can exert a tightening or loosening action on the cables and thereby bring the longitudinal adjustment elements closer together or move them further away.
US09108710B1	Pontoon boat A pontoon boat has left and right pontoons extending longitudinally, a tunnel therebetween, and a deck supported thereon. Bow and stern ends, and a boat length therebetween, are defined by at least one of the pontoons and the deck. An opening of the deck communicating with a tunnel thereunder has an outboard engine mounted therein and a hatch disposed thereover. A longitudinal center plane is vertical and equidistant from the bow and stern ends. A drive unit of the engine has a driveshaft, a propeller shaft operatively connected thereto, and a propeller connected to the propeller shaft. A mounting bracket connects the drive unit to the deck. The engine is disposed forward of the stern end by a distance at least equal to one-fourth of the boat length. The engine is aligned with or rearward of a longitudinal center plane. A method of operating the pontoon boat is also disclosed.
US09108708B1	Small vessel marina The invention relates to a small vessel marina which includes a stocks framework, which contains sliding elements at a distance from each other and joining beams between them, a boat trailer for a boat, which boat trailer is installed on top of the sliding elements and arranged movable along them, and in front of the boat trailer is connected a pier with steps with a connecting rail, which pier is movable along the boat trailer on top of the sliding elements.
US09108694B2	Bicycle fitting method for producing bicycle, bicycle fitting system and computer program product A bicycle fitting method for producing a bicycle is provided. The method includes the steps of receiving a bicycle riding information and a body measurement corresponding to a cyclist. According to the bicycle riding information, a bicycle model is provided. According to the body measurement and the selected bicycle model, a bicycle frame size and a set of bicycle geometric adjustment parameters are provided. According to the bicycle model, the bicycle frame size, and the set of bicycle geometric adjustment parameters, a bicycle which fits the cyclist is produced.
US09108692B2	Manufacturing method of a motor vehicle and motor vehicle thereby obtained There is described a manufacturing method of motor vehicles which achieves the object of reducing the costs deriving from the manufacturing of vehicles belonging to different segments and the costs deriving from the traditional assembly of vehicles which starts from the external shell onto which the elements forming the interiors and the mechanical members are assembled, by suggesting the arrangement of a single self-supporting structural element formed by composite material, already provided with many interior elements, to which a new other interior elements, bodywork elements and mechanical elements can be connected in any assembly order.
US09108686B2	Air guide assembly for vehicle An air guide assembly for a vehicle includes an air guide depending from an underside of the vehicle and an air guide extension contiguously disposed at one lateral end of the air guide. The air guide extension includes a tab received through a tab aperture defined in the air guide. The tab includes a tab feature facilitating sliding movement of the tab relative to the tab aperture due to an external force being applied to one of the air guide and the air guide extension.
US09108684B2	Rocker end portion structure A load transmission performance of transmitting load efficiently in a vehicle longitudinal direction of a rocker is improved. At a load input portion of a rocker, a sectional surface area, that is orthogonal to the vehicle longitudinal direction, of a rocker outer panel is greater than a sectional surface area, that is orthogonal to the vehicle longitudinal direction, of a rocker inner panel. Accordingly, load is sufficiently distributed and inputted to the rocker outer panel. Accordingly, a bending moment, that bends toward a vehicle transverse direction inner side at the rocker inner panel, is suppressed.
US09108682B2	Vehicle underbody structure A vehicle underbody structure includes a floor panel that is provided to extend in a longitudinal direction of a vehicle body; a pair of rockers that are respectively provided along both side portions of the floor panel in the vehicle body to extend in the longitudinal direction of the vehicle body; and a cross member that is mounted in a bridging manner between the pair of rockers to be apart from a floor surface of the floor panel, and that has strength greater than that of the rocker.
US09108668B2	Steering apparatus A steering apparatus is provided with: a specifying device which is configured to specify an environment of a road on which a vehicle travels, on the basis of a manipulated amount of the steering wheel manipulated by a driver and a change of the manipulated amount in a predetermined period.
US09108667B2	Motor vehicle steering system A motor vehicle steering system includes a knob for rotationally manipulating a steering member and a knob reaction force actuator for giving a reaction force in response to the rotation of the knob. The knob has a knob center and is supported by the steering member in a manner rotatable about the knob center. Holding the knob and manipulating the steering member causes the knob to rotate (spin) about the knob center as the steering member rotates. The knob reaction force actuator then gives an appropriate reaction force in response to the rotation (spinning) of the knob.
US09108659B2	Stroller with selectively hidden adapters A stroller may include a frame and at least two adapters. An infant seat may be selectively engaged with the stroller. The frame may have a first side and a second side that generally oppose one another. The adapters may each be configured to selectively engage with the infant seat. One of the adapters may be positioned on the first side of the frame, and a remaining adapter may be positioned on the second side of the frame. The adapters may be rotatable between a first position and a second position. The adapters may be visible and positioned to engage with the infant seat in the first position, and may be substantially hidden from view in the second position.
US09108653B2	Adaptive wheeled carrier and transport device A wheeled carrier for manual movement of material includes a base frame with a pair of frame rails. The frame rails are turned down at the front end with a first bracket connecting the rails and providing a mounting point for at least one wheel and a receiver between the frame rails. The wheel is positioned so that it does not extend above either of the frame rails. A second bracket extends between the frame rails and includes a release mechanism positioned between the frame rails. An attachment including a yoke may be releasably mounted to the base frame. The yoke extends between the receiver of the first bracket and the release mechanism of the second bracket and engages the receiver and the release mechanism. The attachment further including a load carrying arrangement configured to rest on the frame rails above the at least one wheel without engaging the wheel.
US09108652B2	Method and system for timetable optimization utilizing energy consumption factors Systems and methods for synchronizing two or more vehicles operating on an electric transportation line to optimize energy consumption. A controller is provided having a computer memory component storing a set of computer-executable instructions, a list of braking intervals, and a list of acceleration intervals for the vehicles. The controller also has a processing component configured to execute the set of computer-executable instructions to operate on the list of braking intervals and the list of acceleration intervals to minimize an energy consumption of the electric transportation line over a determined period of time by shifting acceleration intervals to synchronize with braking intervals. A dedicated heuristic greedy algorithm and an energy model are implemented in the controller as part of the computer-executable instructions to achieve the improved energy consumption.
US09108644B2	Fuel pressure actuated coupling for train consist A coupling system for a train consist is disclosed. The coupling system may include a first conduit associated with a locomotive of the train consist, a second conduit associated with a tender car of the train consist, and a fluid coupling connecting the first and second conduits. The coupling system may also include a first mechanical coupler associated with the locomotive and a second mechanical coupler associated with the tender car and configured to engage and lock with the first mechanical coupler. The coupling system may further include a locking device driven by fluid passing through the fluid coupling that is configured to inhibit disengagement of the first mechanical coupler and the second mechanical coupler.
US09108640B2	Systems and methods for monitoring and reporting road quality Systems and methods for monitoring vehicle sensors to determine and report road quality using a communication device are disclosed. The communication device determines the vehicle's location on a road, such as by use of a GPS-enabled head unit or similar device and appropriate mapping software. Monitoring road quality may be achieved by adding a sensor to the shocks, by use of a vertical displacement sensor present on the head unit, and the like. Various combinations of sensors may be employed. A horizontal displacement sensor may be used. The signals from the sensors are monitored by the head unit and analyzed to judge the quality of the road by the amount of vertical vibration that is encountered. This data, together with the vehicle's location, may be transmitted through a mobile network to a central server for distribution in road quality reports and to improve driving directions in mapping software.
US09108637B2	Method for controlling a separating clutch in a hybrid drive train, and drive train A hybrid drivetrain and method for controlling a friction clutch of a hybrid drivetrain of a motor vehicle having a combustion engine which is coupled by means of a freewheel to a transmission input shaft of a transmission to transmit the engine torque, and having an electric machine which starts the combustion engine and/or propels the motor vehicle, which friction clutch transmits to the combustion engine a summed torque formed of a starting torque for starting the combustion engine by means of the electric machine and a drag torque which acts on the combustion engine when the drivetrain is in drag mode. To be able to operate the friction clutch reliably and to avoid over-dimensioning of the friction clutch as a result of high summed torques, a torque present at the friction clutch is limited to a predefined transmission torque which can be transmitted via the friction clutch.
US09108636B2	Transmission control device for hybrid vehicle In a transmission control device for a hybrid vehicle, when an engine torque is equal to or less than a predetermined value during a constant speed traveling, a learning engine rotational speed is set to a rotational speed being higher by +α than the present engine rotational speed. Then, a learning engine torque is calculated that corresponds to the learning engine rotational speed, a learning clutch actuator operation amount is obtained that corresponds to the learning clutch torque, and a clutch actuator is operated based on the learning clutch actuator operation amount. Thereafter, when the engine rotational speed and the engine torque are in stable states, a clutch torque value corresponding to the learning clutch actuator operation amount is compensated by a stable engine torque value.
US09108631B2	Hybrid vehicle and associated control method A hybrid vehicle and method of control include an internal combustion engine and at least one traction motor operated in an automatic mode such that the combined wheel torque is a function of accelerator pedal position and vehicle speed. In a select shift mode, wheel torque is also a function of a virtual gear number. The virtual gear number varies in response to driver activation of shift selectors or automatically in response to changes in vehicle speed. The vehicle transitions into select shift mode in response to driver activation of a downshift selector. When the transition occurs, an initial virtual gear number is selected to ensure that wheel torque increases.
US09108627B2	Method for controlling a vehicle A method for improving starting of an engine that may be repeatedly stopped and started is presented. In one example, the method adjusts application of vehicle brakes to reduce the possibility of impact between gear teeth after engine starting.
US09108623B2	System and method of controlling motor vehicle operation The present disclosure provides a system and a method of controlling motor vehicle operation. The method may include: setting a creep torque as a minimum torque; setting a maximum torque as a sum of a maximum torque of an engine and a maximum torque of a motor; monitoring an acceleration pedal position sensor (APS) value; calculating a demand torque according to the APS value; setting a filter coefficient for filtering the demand torque according to an operating condition of the vehicle; and filtering the demand torque by means of the filter coefficient.
US09108622B2	Drive control apparatus for vehicle and method of controlling drive apparatus for vehicle A drive control apparatus for a vehicle includes an engine, an electric motor, a clutch mechanism, an engine rotation sensor, a motor rotation sensor, an acceleration and deceleration intention detecting portion, and a controller. The controller controls a rotation speed of the engine to be an acceleration intention target value greater than a rotation speed of the motor and thereafter brings the clutch mechanism into the engagement state in a case where the acceleration and deceleration intention detecting portion detects that the vehicle is in an acceleration intention mode, and controls the rotation speed of the engine to be a deceleration intention target value smaller than the rotation speed of the motor and thereafter brings the clutch mechanism into the engagement state in a case where the acceleration and deceleration intention detecting portion detects that the vehicle is in a deceleration intention mode.
US09108617B2	Method and system for control of a clutch at a vehicle A method for controlling a clutch which pertains to a vehicle and which is operated by means of a vehicle control system. The vehicle is provided with an engine, and a driver of the vehicle requests propulsive force from the engine. A first propulsive force requested by the driver and transmitted via a clutch involves determining whether the clutch slips while transmitting the first propulsive force. When the clutch slips during transmission of the first propulsive force, the propulsive force transmitted by the clutch increases. The invention relates also to a system and a vehicle.
US09108613B2	Method and system for stopping an engine A method and a system for improving operation of a hybrid vehicle are presented. In one example, a disconnect clutch is operated in response to an engine stop request to adjust an engine stopping position during an engine shutdown. The approach may reduce engine starting time after the engine stop.
US09108606B2	Fluidically controlled pressure switching valve for a vehicle brake system and vehicle brake system The disclosure relates to a fluidically controlled pressure switching valve for a vehicle brake system including a valve chamber, which is arranged in a valve interior and into which an inlet opening and an outlet opening open, and a valve closing body, which is movable in the valve interior and which comprises a piston, defining a first piston surface and a second piston surface, and including a closing element. The valve closing body is movable in accordance with a pressure difference between a pressure acting on the first piston surface and a pressure acting on the second piston surface, against the force of a setting spring arranged in the valve interior, between a closed position, in which a fluid connection between the inlet opening and the outlet opening is interrupted, and an open position, in which the fluid connection between the inlet opening and the outlet opening is open.
US09108580B2	Bumper system with pedestrian-friendly lower apron An apron for a vehicle front end comprises a unitary plastic component having a front structure and a rear structure joined by an offset portion. The front and rear structures extend at rearward downward angles and in generally parallel directions, and the offset portion extends at a rearward upward angle. The apron has a relatively constant vertical dimension, such that the angled structures define a wave-shaped envelope. Preferably, a horizontal plane extending from the tip of the front structure stays within the wave-shaped envelope, so that impact forces stay within the boundary in a manner providing improved impact strength and greater energy absorption during an impact. At the same time, the front structure provides a homogeneous structure that distributes local impact stresses uniformly and more widely into the rear structure, thus providing a more uniform impact resistance less sensitive to impact location.
US09108579B2	Centrally managing personalization information for configuring settings for a registered vehicle user A system and method are described herein for managing personalization information used to configure settings for a registered vehicle user in a vehicle including a telematics unit. In particular, the method performed by the system includes establishing, for the registered vehicle user, a personalization information dataset within a networked vehicle user database. The system is further configured to submit a request to download the personalization information dataset from the networked vehicle user database, the request identifying the registered vehicle user and the vehicle. The system is also configured to download in accordance with the request to download, via a mobile wireless link to the telematics unit, values from the personalization information dataset to the telematics unit of the vehicle.
US09108571B2	Method, system, and computer program product for image capture positioning using a pattern of invisible light Systems, methods, computer programs, and user interfaces are provided to project, by a projection device, a pattern of invisible light onto a surface; position a vehicle at an image capture position on the surface, the vehicle including an image capture device oriented to capture an image of a view at the image capture position; capture, by an invisible light sensor connected to the vehicle, a pattern image at the image capture position, the pattern image including at least a portion of the pattern of invisible light projected onto the surface; and send the pattern image to an application server, the application server determining the image capture position relative to the projection device based on the portion of the pattern of invisible light.
US09108560B2	Seat belt failure warning apparatus The seat belt failure warning apparatus is disposed with a buckle switch that detects wearing of a webbing, a rotation sensor that detects a drawing-out amount of the webbing, and a liquid crystal display that switchingly displays a plurality of alarm information. A controller is disposed with a failure determination unit that determines whether the seat belt device has had a failure or not, and a control unit that controls display of the liquid crystal display. When the buckle switch is OFF and drawing-out of the webbing is detected by the rotation sensor after the failure determination unit has determined the seat belt device has had a failure, failure information of the seat belt which indicates that the seat belt device has had a failure as a determination result by the failure determination unit is displayed on the liquid crystal display regardless of a display priority of alarm information.
US09108556B2	Vertical lifting axle for a cask transporter The present disclosure relates to a vertical hydraulic cylinder axle arrangement that can receive flexible power lines through the cylinder. In particular, a hollow piston rod having a longitudinally extending passage through which hydraulic hoses and electrical lines can pass is incorporated into a heavy-load transporter. A portion of the piston rod defines a splined shaft to mechanically engage a rotating slew gear drive to permit omnidirectional steering. The piston rod extends downward to form a trunnion mount on which drive wheels can articulate laterally to conform to irregularities in various surfaces and other inclinations.
US09108550B2	Headrest apparatus for multi-purpose vehicle A headrest apparatus for an MPV includes a headrest that can be automatically completely housed in a storage space in such a way as to slide without requiring a user to perform an additional operation of pushing the headrest downwards, thus being more convenient for the user. The headrest apparatus has a simple structure and a reduced size, thus reducing the weight of the vehicle. The headrest apparatus includes a headrest sliding unit, a sinking seat folding unit, and a seat support frame supporting a sinking seat on a floor of the MPV, wherein, when the sinking seat is housed in a seat storage space formed in the floor of the MPV, the upper surface of the sinking seat that is in a housed state is level with the upper surface of the floor of the MPV.
US09108549B2	Self-adjustable arm rest assembly An auto-adjustable armrest mechanism for reclining seats is disclosed. The armrest mechanism causes the armrests to follow a more natural movement of an occupant's arms when adjusting the seatback to different angles. The armrest mechanism utilizes a cam that rotates in response to movement of the seatback relative to the seat base. A rod connected to the rotatable armrest is in communication with and, in turn, responsive to the rotation of the cam for defining an auto-adjustable angle between the seatback and the armrest.
US09108548B2	Vehicle seat A vehicle seat comprises: left and right base frames (side portions 52, 53 of pipe frame 5) which extend in an upward-and-downward direction and constitute left and right portions of a seat back frame (2); a pressure-receiving member (10) disposed between the left and right base frames, and configured to move rearward upon receipt of a rearward load of a predetermined magnitude or greater from an occupant; a force-receiving member (bracket 7) disposed adjacent to a left or right outer side of one base frame (side portion 53), and configured to receive a load from outside in a lateral direction; and a load transmission part (lower portion 51 of pipe frame 5) disposed under the pressure-receiving member (10), connected to a lower end of the one base frame, and configured to transmit the load from the force-receiving member to a side laterally opposite to that on which the force-receiving member is provided. The force-receiving member is provided such that the lower end of the one base frame (53) is located within a width in the upward-and-downward direction of the force-receiving member.
US09108547B2	Vehicle seat A vehicle seat comprises: left and right side frames (4) which constitute left and right portions of a seat back frame (2); a reinforcing frame (pipe frame 5) disposed adjacent to one side frame (4) in a lateral direction, and configured to reinforce the side frame (4); and a force-receiving member (bracket 7) disposed adjacent to the one side frame (4), provided discretely from the reinforcing frame, and configured to receive a load from another member. The force-receiving member is disposed opposite to the reinforcing frame with the side frame 4 disposed therebetween, and directly fixed to the reinforcing frame.
US09108541B2	Recliner system for a vehicle seat For a recliner system for a vehicle seat, in particular a motor vehicle seat, comprising at least one recliner, which has a first recliner part and a second recliner part, which can be locked to each other and can be rotated relative to each other about an axis, a transfer rod, the rotation of which unlocks the recliner, and a hand lever, the operation of which rotates the transfer rod in order to unlock the recliner, a stop module is provided, which is operatively connected to the hand lever and to the transfer rod and which stops the hand lever and one of the recliner parts relative to each other in at least one rotational direction.
US09108539B2	Safety apparatus of seat for vehicle with height adjust device A safety apparatus of a seat for a vehicle with a height adjustment device may include a height link that has one end rotatably connected to a seat rail bracket and the other end fixed to a rear hinge pipe, a restriction link that may be disposed at a side of the height link and has one end pivotally coupled to the seat rail bracket, wherein the restriction link may be elastically biased away from the height link, a first anti-rotation mechanism that may be disposed at the height link and the restriction link to restrict rotation of the height link when a front of the height link rotates upward in a front collision, and a second anti-rotation mechanism that may be disposed at the height link and the restriction link to restrict rotation of the height link when a rear of the height link rotates upward in a rear collision.
US09108534B2	Vehicle seat A vehicle seat slidable in a front-rear direction comprises a lower rail (5) fixed on a floor of a vehicle, and configured to have a shape elongated in the front-rear direction and having a groove (55) provided in a laterally central position, an upper rail (4) configured to be engageable with the groove (55) and slidable in the front-rear direction relative to the lower rail (5), and a seat bottom frame (3) fixed to the upper rail (4). The seat bottom frame (3) is fixed to a left or right side surface of the upper rail (4), the lower rail (5) has a pair of left and right top portions (53A, 53B) between which the groove (55) is disposed and of which the to inner top portion (53A) fixed to the seat bottom frame (3) is formed in a position lower than that of the outer top portion (53B) that is on a side opposite to the inner top portion (53A). A lower end (62C) of a rear link (62) that is an end of a seat bottom frame (3) facing to the inner top portion (53A) is in a position lower than that of the outer top portion (53B).
US09108526B2	Hybrid vehicle A hybrid vehicle includes a power storage device, an engine, a power generation apparatus, an input apparatus, and an ECU. The power generation apparatus is configured to generate charging power of the power storage device by using output of the engine. The input apparatus is configured to request, by a user input, an increase in a power storage amount of the power storage device. The ECU is configured to: (a) control charging of the power storage device by the power generation apparatus and accelerate the charging of the power storage device, when the increase in the power storage amount is requested, and (b) suppress charging of the power storage device at the time when a travel load is small in comparison with charging of the power storage device at the time when the travel load is large, when the increase in the power storage amount is requested.
US09108519B2	Meter display device for electric vehicle An electric vehicle includes a main battery, a motor generating drive power of the vehicle by supply of electric power from the main battery, an output control circuit for the motor, a charging connector for supplying electric power from an external to the main battery, and a meter display device. The meter display device includes a display section including at least a vehicle speed displaying portion and a charging connector condition displaying portion displaying information related to the condition of the charging connector. The charging connector condition displaying portion displays information on maintenance of the charging connector and is disposed adjacent the vehicle speed displaying portion. A main battery residual displaying portion and a sub battery residual displaying portion are disposed around the vehicle speed displaying portion.
US09108514B2	Control device and method for operating a braking system equipped with an electric drive device and/or generator device A control device for a braking system equipped with an electric drive device and/or generator device includes: a first receiving device with the aid of which a specified value regarding a brake pressure in at least one wheel brake cylinder of at least one brake circuit is receivable, a second receiving device with the aid of which an actual value regarding a pressure in the at least one brake circuit and/or the brake pressure in the at least one wheel brake cylinder is/are receivable, and a control unit with the aid of which a setpoint mode of the electric drive device and/or generator device is specifiable taking the received specified value and the received actual value into account.
US09108513B2	Viewing direction and acoustic command based operating device for a motor vehicle In a method for the operator control of a motor vehicle having a display for displaying variable information and having a microphone, the viewing direction of an operator of the motor vehicle is ascertained, it is checked whether the viewing direction of the operator is aimed toward the display, and information assigned to an acoustic command is shown on the display when a corresponding acoustic command is given while the viewing direction of the operator is aimed toward the display.
US09108511B2	Transfer case A transfer case includes a planetary differential including an input, a first output and a second output, a sprocket journalled on the second output, and a sleeve driveably connected to the second output, for (i) releaseably connecting the first output to the sleeve, (ii) releaseably connecting the sprocket to the sleeve, (iii) releaseably connecting the first output and the sprocket to the sleeve, and (iv) disconnecting the sprocket and first output from the sleeve.
US09108506B2	Nanolaminate-reinforced metal composite tank material and design for storage of flammable and combustible fluids An improved fuel tank and method of forming a fuel tank utilize reinforced porous metal composite materials. In one embodiment, the composite material includes a fully dense, fluid-impermeable skin combined with a porous metal baffle. The skin and baffle may be formed as a single monolithic system via electrodeposition of a nanolaminate material into at least a portion of open, accessible void space within a porous preform (e.g., a metal foam preform) and on the exterior surface of the preform to form the fluid-impermeable skin.
US09108505B2	Powersplit powertrain for a hybrid electric vehicle A powertrain includes a planetary gearset including an input connected to a shaft driveably connected to an engine, a second input driveably connected to an electric machine, and an output driveably connected to a countershaft, a clutch for releaseably connecting the countershaft and the input shaft through a first pair of meshing gears, and a brake for releaseably holding the input shaft and the input against rotation.
US09108504B2	Split axis transmission hybrid system architecture A split-axis transmission hybrid system may include two planetary gear sets to provide two parallel torque paths from an input axis to an output axis. A secondary power source may be coupled to either the input axis or the output axis to provide torque to the system. Thus, the split-axis transmission hybrid system may provide the ratio preselection capability and the low power losses of a dual-clutch transmission and the ratio-changing control and smoothness of a traditional powershift automatic transmission, while also providing the improved efficiency and enhanced drivability of a hybrid power source arrangement.
US09108502B2	Cable routing structure A cable routing structure includes a drive train within which an electric motor is housed; a power control unit configured to supply alternating current to the electric motor, the power control unit being fixed to an upper portion of the drive train, and on-board components being arranged on both sides of the power control unit in a lateral direction of a vehicle; an electrical component being arranged on a side of a plane that the power control unit is on; and a first end of a first cable being connected to a side surface of the power control unit that faces toward a front or a rear of the vehicle, a second end of the first cable being connected to the electrical component, and the first cable being routed through a space defined by the power control unit and the drive train.
US09108490B2	Air supply duct The present disclosure relates to an air supply duct for a vehicle, the air supply duct comprising a housing, the housing having an inlet adapted to receive air from outside of the vehicle and an outlet adapted to convey the air to a vehicle climate control system, and a cowl arranged inside the housing, the cowl being adapted to direct the air along an air path, such that the air path changes direction within the housing. The cowl has a curved form adapted to form an inner curve of the air path. Further, the cowl comprises a precipitation collection means arranged to collect precipitation borne by the air from the outside of the vehicle and to remove the precipitation from the air. The disclosure also relates to a vehicle comprising such an air supply duct.
US09108482B2	Torsion bar spring arrangement for a wheel suspension of a motor vehicle A torsion bar spring arrangement for a wheel suspension of a motor vehicle includes an actuator arranged on a vehicle body or on a subframe and constructed to variably pre-tension the torsion bar spring arrangement, a coaxial first torsion bar spring having an output side that is connected by way of an output lever to a wheel suspension element of the wheel suspension, and a housing of the actuator supported on the vehicle body in at least one bearing location for movement in a circumferential direction and resiliently yieldingly supported on the vehicle body in the direction of torsional moments acting on the torsion bar spring by way of at least one spring element.
US09108480B2	Modular suspension system Modular suspension systems for customizing a stock automobile are presented including in any combination: a pair of asymmetrical control arm components having a control arm connection geometry sized to replace a pair of stock control arm components, where the pair of asymmetrical control arm components include at least additional control arm customization, and where the pair of asymmetrical control arm components are compatible with all other stock components of the stock automobile without modification of the stock components; a pair of spindle components having a spindle connection geometry sized to replace a pair of stock spindle components, where the pair of spindle components include at least additional spindle customization, and where the pair of spindle components are compatible with all other stock components of the stock automobile without modification of the stock components.
US09108477B2	Coupling device for different landing gears of aircraft Coupling devices for different landing gears of aircraft are disclosed. In one embodiment, a coupling device for coupling to a landing gear of an aircraft may include a first landing gear adapter that is designed for coupling to a landing gear of an aircraft of a first type. A second landing gear adapter that is designed for coupling to a landing gear of an aircraft of a second type is provided. The second type is different from the first type. A change device is coupled to the first and second landing gear adapters and designed such that optionally the first or the second landing gear adapter can be positioned in an operating position, or location of the coupling device, suitable for coupling to the landing gear. A plurality of second landing gear adapters may be provided and may one at a time be moved into the operating position in a pivoting manner.
US09108464B2	Rubber composition for a tire containing epoxide natural rubber and a plasticizing resin The present invention relates to a rubber composition based on at least an epoxidized natural rubber (ENR), a reinforcing filler and, as plasticizing agent, an alpha-methylstyrene polymer resin. The invention also relates to the use of such a composition for the manufacture of a tire tread exhibiting an improved compromise of properties with respect to grip on wet ground and rolling resistance.
US09108463B2	Wheel dolly for small aircraft A wheel dolly for lifting and transporting a flat tire attached to an aircraft is comprised of a frame assembly having first and second laterally spaced frame members and a telescopic frame structure interposed between the laterally spaced frame members. A pair of tire scoops are pivotally coupled the frame assembly. An actuator is coupled between the tire scoops to pivot the tire scoops relative to the frame assembly in order to raise the tire scoops. A plurality of castors is coupled to the frame assembly to allow the frame assembly to roll in any direction.
US09108429B2	Method of controlling printer and printer A method of controlling a printer includes measuring a first voltage value of a power supply of the printer before energizing heat generating elements of a print head of the printer. The method also includes calculating, by a controller of the printer, the number of heat generating elements that are simultaneously energizable based on the measured first voltage value of the power supply, an end voltage value of the power supply, an internal resistance value of the power supply, a resistance value of each of the heat generating elements, and a current value of an electric current flowing through a motor of the printer for conveying recording paper. The method further includes performing printing on the recording paper by the print head using the heat generating elements of the calculated number.
US09108425B2	Recording apparatus and liquid ejection head A recording apparatus including an ink tank and a recording head having a flow path forming portion that has an ejection orifice plate having plural ink ejection orifices and a liquid chamber provided for each orifice to supply ink to the orifices, and an energy generating element for ejecting ink in the chamber. A surface layer of the flow path forming portion opposes to the outside of the plate. An opening is provided opposing to the orifices in the surface layer. An ink reservoir is provided between the plate and the opening. A circulation flow path communicating with the ink reservoir is provided. The area of the opening is larger than that of the orifice. Both ends of the circulation flow path are respectively connected to inlet and outlet portions connected to the circulation flow path. The inlet and outlet portions and liquid chamber are connected to the ink tank.
US09108422B2	Accumulator bag and carrier sheet for use in manufacturing printer cartridges and methods of making same An apparatus useful in the assembly of printer cartridges includes a plurality of accumulator bags removeably secured to a carrier sheet. Each accumulator bag includes a first polymer film panel and a second polymer film panel welded together to form a pressurizable chamber with an aperture formed in the bag to provide access to the pressurizable chamber. An annular adhesive element is secured to each bag such that an aperture of the annular adhesive element is generally concentric with the aperture of the accumulator bag. The carrier sheet includes an upper adhesive stripe, a lower adhesive stripe, and a silicone stripe. The plurality of accumulator bags is removeably secured to the carrier sheet by adhering an upper portion of each bag to the upper adhesive stripe, adhering a lower portion of each bag to the lower adhesive stripe, and positioning the annular adhesive element in contact with the silicone stripe.
US09108417B2	Cartridge and printing device A cartridge is adapted to be used in a printing apparatus having a mounting section provided with a lever and a terminal group. The cartridge includes a front surface, a rear surface, an upper surface, a lower surface, a circuit board, and a first convex section. The upper surface includes a concave section configured and arranged to allow a regulating section of the lever to be inserted in the concave section. The circuit board is electrically connected with the terminal group. The first convex section is configured and arranged to be guided in a groove provided in the mounting section. The circuit board, the first convex section, and the concave section are disposed in the upper surface in a plan view of the upper surface.
US09108413B2	Liquid droplet discharge device and method of manufacturing liquid droplet discharge device In a liquid droplet discharge head, a liquid repellent layer is continuously formed from a liquid droplet discharge surface to a middle position in a thickness direction of an end surface of a nozzle plate.
US09108406B2	Device substrate, liquid ejection head, and method for manufacturing device substrate and liquid ejection head A device substrate includes a substrate body having an energy generating device provided thereon, where the energy generating device generates energy for ejecting liquid, an ejection port forming member disposed on the substrate body, where the ejection port forming member has a pressure chamber that surrounds the energy generating device and an ejection port that communicates with the pressure chamber, and a supply port configured to supply the liquid to the pressure chamber. The ejection port forming member has a first surface that is in contact with the substrate body and a second surface other than the first surface, and the supply port is formed in the second surface.
US09108404B2	Ink jet recording method and recorded matter An ink jet recording method includes discharging a first ink composition onto a recording medium using a recording head, in which the first ink composition includes a coloring material, an alkane diol with 4 or more to 8 or fewer carbon atoms, a water-soluble solvent, and water; the recording head discharges the first ink composition using a piezoelectric element, and has a resolution per unit length of 200 dpi or more, and the recording medium has an absorbing layer on the surface thereof, in which a nonpolar component of a surface free energy of the absorbing layer is 20 mN/m or lower.
US09108403B2	Printing apparatus and printing method A printing apparatus including a print head including nozzle groups each having nozzles, each of the nozzle groups applying ink having a plurality of volumes from the nozzles to form dots including dots differing in size, including: an arrangement determination unit to determine an arrangement of dots to be formed by each of the nozzle groups; a size determination unit to determine sizes of ink ejected to print the dots determined by the arrangement determination unit, according to respective ejection characteristics of the nozzle groups, such that a print characteristic of an image based on the dot arrangement determined by the arrangement determination unit is within a predetermined range; and an ejection control unit to control the print head to eject ink having the plurality of sizes determined by the size determination unit in positions of a print medium based on the arrangement determined by the arrangement determination unit.
US09108400B1	Method for preventing flutes on a print side A method for printing an image on a substrate, the method including providing a plurality of rollers for moving a substrate on which the images are printed; depositing a plurality of different colored inks on a print side of the substrate which forms the image; depositing a clear liquid on the print side of the substrate in a linear, spaced apart pattern adjacent an edge of the image for forming clear liquid ribs; wherein the clear liquid ribs extend away from the image, and the clear liquid is devoid in at least at a plurality of portions between the clear liquid ribs.
US09108380B2	Trash bag with odor control and method of making same The trash bag for receiving refuse may include a bag body, the bag body including an inside surface, an outside surface, and a rim defining a mouth with a hem and a draw tape in the hem. A liquid additive may be applied to the interior of the bag using the intermittent application of micro-droplets to the interior of a folded web and then converting to a roll of connected trash bags or to individual trash bags on a roll. The liquid additive may contain fragrance, malodor control agents and fragrance release inhibitors. Also, described is a method of producing trash bags with liquid additives applied by the application of micro-droplets.
US09108378B2	Press pads A press pad is provided for use in a laminate press. The pad comprises a woven fabric of heat resistant strands wherein at least a proportion of the weft comprises a core made up of a bundle of strands within a sheath of an elastomeric material and at least a proportion of the warp comprises metal strands. The strands forming the bundle are dose-packed prior to extrusion of the sheath around them. The transverse cross-sectional profile of the sheath is a regular geometric profile that is other than a circular profile prior to weaving of the fabric of the press pad. Preferably, the transverse cross-sectional profile of the sheath is a splined profile or a regular polygonal profile that is composed of straight lines or arcs.
US09108377B2	Roller press having torque balance A roller press for the pressure treatment or compaction of granular material, having at least two rolls formed as freely rotating rolls, in each case rotatably mounted in a machine frame by a shaft, driven in opposite directions and separated from one another by a roll gap. The shafts of the rolls are accommodated in bearing housings movably mounted in the machine frame and in each case two bearing housings arranged on one side of the rolls and belonging to different rolls are connected to each other via at least one pressure cylinder. The connection between the bearing housings in each case has at least one torque balance. In this way, the structure of a roller press having roller centering is simplified and can be produced more cost-effectively.
US09108375B2	Mold for vulcanizing a tire tread, comprising at least one added element in a cord A mold for vulcanizing a tire tread comprising a molding surface able to mold a tread surface of the tread of the tire and at least one bar of length L and of width W able to mold a groove in the tread. The bar comprises two lateral faces extending along the length of the bar and projecting from the molding surface and an upper face connecting the said lateral faces. The mold comprises in the bar at least two cavities respectively opening onto the two lateral faces of the bar without opening onto the upper face of this bar. These cavities overlap in the width of the bar. The mold further comprises a first element added into the bar beforehand, this first element separating the two cavities in the length of the bar.
US09108370B2	Microgravity fabrication and metalization of large, lightweight polymeric bubbles and films for space system applications A method of forming a metalized polymeric bubble in a space, microgravity environment is described. A liquid polymer bubble having a predetermined diameter is formed from a mixture comprising a liquid polymer and at least one of a UV curing material, a stabilizer, a UV absorber, or a surfactant. The liquid polymer bubble is cured with radiation to form a rigid polymer bubble. The rigid polymer bubble is then metalized with a metal to form the metalized polymeric bubble.
US09108365B2	Method for manufacturing a FRC/FRP-component from rovings with a moulding tool The invention pertains to a method for manufacturing a FRC/FRP-component component from rovings by means of a molding tool with a mold surface, featuring the steps of: applying rovings formed of dry fibers onto the mold surface by depositing the rovings under tension with predetermined orientations between deflection devices by means of an application device, applying binder material onto the tensioned rovings; consolidating the arrangement of fiber strands and binder material by applying heat and pressure in order to produce a preform for the component to be manufactured; separating the preform from the deflection devices and removing the preform from the molding tool; and carrying out an injection process or infusion process in order to manufacture the component after separating the preform from the deflection devices; as well as to a molding tool and a device for implementing the method.
US09108363B2	Thin wall bushing for robust electrical bonding to fiber-reinforced structures A method for directing electrical current to prevent sparking from the interaction between a composite structure and lightning or static electrical charge, the method including the steps of forming a hole in a composite structure; and positioning a bushing into the hole to create an interference fit between the bushing and the composite structure, wherein the bushing is formed of a material that has a coefficient of thermal expansion close to the coefficient of thermal expansion of the composite structure and the bushing provides an electrical path between a fastener disposed in the bushing and the composite structure.
US09108362B2	Welding device and method for welding thermoplastic resin articles, and pressing unit for the welding device A welding device includes a compressor configured to compress a welding part and its adjoining surfaces of thermoplastic resin articles (2a, 2b) in directions perpendicular to the axis of a core (1), and a heater, and is configured such that: the surface of the welding part of the thermoplastic resin articles is compressed with a predetermined pressure by the compressor, the compression of the thermoplastic resin articles is then continued to extend a compressed region along the axis of the core without changing a relative position between the compressor in the compressed region and the surface of the welding part of the thermoplastic resin articles, the welding part of the thermoplastic resin articles is heated and welded by the heater, and after the welding, the pressure applied by the compressor is lowered to stop the compression of the thermoplastic resin articles such that the thermoplastic resin articles fitted on the core can be taken out of the welding device.
US09108357B2	Multilayer decorative film The present invention relates to a process for overlaying a base substance with a multilayer decorative film in a vacuum forming, a multilayer decorative film for a secondary decoration used in such a vacuum forming process, to a multilayer decorative film excellent in adhesiveness, workability, and secondary physical properties such as heat resistance and hydrolysis resistance after forming and the use of such multilayer decorative film in a vacuum forming process.
US09108356B2	Methods for making a film material exhibiting textile properties A film material formed of thermoplastic polymer material is processed so as to have linearly extending regions (A) linked together by linearly extending webs (B), regions (A) and webs (B) each being oriented, the dominant direction of orientation in regions (A) forming an angle (V) to the direction on which (A) extends and webs (B) comprising arrays of linear furrows of thinner material or splits forming angles (U) higher than (V) to the direction in which (A) extends. The method of producing the new film involves passing an orientated film through a pair of intermeshing grooved rollers to cold-stretch the film in a direction at an angle to the predominant original orientation, at least one of the grooved rollers having crests with sharp edges to form the division between regions A and webs B and to stretch the material to form webs B while stretching the material less or not at all to form regions A. Preferably at least one of the grooved rollers has crests with a waved surface shape.
US09108351B2	Method for forming anodized layer, method for producing mold and method for producing antireflective film An anodized layer formation method of an embodiment of the present invention includes the step a of providing an aluminum film which is formed on a first principal surface of a support and the step b of anodizing a surface of the aluminum film to form a porous alumina layer which has a plurality of minute recessed portions. In the step a, a second principal surface of the support which is opposite to the first principal surface is provided with a low heat conduction member that has a predetermined pattern. According to an embodiment of the present invention, a porous alumina layer can be formed which includes regions of different minute structures in the predetermined pattern.
US09108349B2	Profiled extrusion replication A profiled extrusion replication process is disclosed that includes steps of (a) extruding a molten material through an extrusion die having at least one profiled die lip to form a molten extrudate having first and second major extrudate surfaces and having a first structural feature in the first major extrudate surface; (b) bringing the molten extrudate into contact with a tool surface comprising one or more second structural features so as to cause a portion of the first structural feature in the first major extrudate surface to contact the one or more second structural features on the tool surface; and (c) cooling the molten extrudate to provide the structured film. Structured films and apparatus for making structured films are also disclosed.
US09108340B2	Process for manufacturing a resulting multi-layer pharmaceutical film The invention relates to the film products and methods of their preparation that demonstrate a non-self-aggregating uniform heterogeneity. Desirably, the films disintegrate in water and may be formed by a controlled drying process, or other process that maintains the required uniformity of the film. The films contain a polymer component, which includes polyethylene oxide optionally blended with hydrophilic cellulosic polymers. Desirably, the films also contain a pharmaceutical and/or cosmetic active agent with no more than a 10% variance of the active agent pharmaceutical and/or cosmetic active agent per unit area of the film.
US09108339B2	Method for the production of coated moldings The present invention relates to a process for the production of coated mouldings, by injecting a moulding composition into an injection mould and cooling the composition to obtain a moulding, and altering the injection mould in such a way as to produce an intermediate space between a surface to be coated of the moulding and the inner surface of the injection mould, and using injection moulding to charge a reactive mixture to the resultant intermediate space, where the temperature of at least a portion of the injection mould is increased for the curing of the reactive mixture.The present invention moreover describes a system for the conduct of the process described above.
US09108338B2	Methods and systems for thermal forming an object A method and system for thermal forming an object. A mold is provided, a shape of which corresponds to a desired shape of the object. A material is inserted into a heating area, and the material is heated using a plurality of independently controllable heat sources that heat different areas of the material. The heated material is then disposed over or into at least a portion of the mold so as to deform the material. The deformed material may then be trimmed so as to form the object.
US09108334B2	Flush cut saw This invention relates generally to power tools, particularly to a portable, multifunction saw and uses thereof (e.g., for household, commercial (e.g., for use in window removal and replacement) and medical (e.g. for bone cutting) applications), and more particularly to a multifunctional saw with a protective blade guard configured to cover the entire blade.
US09108323B2	Utility knife A utility knife configured to provide a user with a variety of configurations. The utility knife includes first and second handle members configured to move relative to one another between open (e.g. unfolded) and closed (e.g., folded) positions. The knife further includes a retractable blade within the second handle member. The retractable blade may be moved between a retracted position, wherein most, if not all, of the blade is maintained within the second handle member, and an extended position, wherein a portion of the blade is exposed. The knife is configured to allow the blade to be in retracted and extended positions when the first and second handle members are in either the unfolded or folded positions.
US09108304B2	Ratchet screwdriver able to change operating direction A ratchet screwdriver includes a handle, a shaft and a ratchet switch device. The shaft is connected to the front end of the handle and a mounting member is connected to the handle so as to be connected with the shaft. The ratchet switch device is located in the chamber in the rear end of the handle and includes a base, a frame, two engaging members, a positioning member, a resilient plate, two positioning pieces, and a ratchet member a switch. The shaft can be replaced by operating the mounting member on the handle. The switch on the rear end of the handle can change the direction of the ratchet member to output torque via the shaft.
US09108300B2	Sanding device A sanding device for use with sandpaper sheets comprises a base connected to two lateral extensions by flexible connectors. The base further includes a plurality of spikes pointed towards the extensions and positioned inside slots in the extensions when the device is in a closed position. In order to load and unload sandpaper sheets, a lateral extension may be lifted against a tension force from the flexible connector. The stress on the flexible connector is limited by the contact of two edges which are positioned to prevent the flexible connector from undergoing stress beyond a specified level.
US09108298B2	Method of treating surface of mold and mold having surface treated by said method Provided is a method of treating a surface of a mold to achieve good demoldability and capable of preventing wearing of the mold by avoiding load concentration on one part of the surface of the mold. After a first blasting is performed on the surface of the mold to remove a hardened layer produced on the surface and/or to adjust the surface roughness, a second blasting is performed to create fine irregularities on the surface. Then, an elastic abrasive in which abrasive grains are carried on an elastic body, or a plate-like abrasive having a planar shape with a maximum length that is 1.5 to 100 times the thickness thereof, is ejected onto the surface of the mold at an inclined ejection angle such that the abrasive is caused to slide along the mold surface to flatten peaks of the irregularities created on the mold surface.
US09108291B2	Method of forming structured-open-network polishing pads The invention is a method of forming a layered-open-network polishing pad useful for polishing at least one of magnetic, semiconductor and optical substrates. Exposing a first and second polymer sheet or film of a photocurable polymer creates an exposure pattern in the first and second polymer sheet. The exposure pattern has elongated sections exposed to the energy source. The light exposure is of an exposure time sufficient to cure the photocurable polymer, but insufficient to cure adjacent elongated sections together. Attaching the first and second polymer sheets forms a polishing pad with the patterns of the first and second polymer sheets crossing. Curing the layered-open-network polishing pad to secure the layered-open-network polishing pad with the first and second sheets having sufficient stiffness to reduce sagging and maintain an orthogonal relationship between the elongated channels and the parallel planes of the polymer sheets.
US09108280B2	Device having rail and block and method for manufacturing the same A device having a rail and a block includes a rail and a block. The rail includes a body and a hollow inside, the hollow inside being located inside the body. The hollow inside of the rail is provided with a lightweight, shock absorption and sound absorption material, and the lightweight, shock absorption and sound absorption material is selected from a group consisting of foam metal material, polystyrene, asbestos, foam, plastic, and rubber. The block is adapted for sliding along the rail to finish a slide path.
US09108275B2	Bi-material strip and a method of bonding strips of different materials together A continuous hot bonding method for producing a bi-material strip with a strong bond therebetween is provided. The method comprises sanding a first strip formed of steel; and applying a layer of first particles, typically formed of copper, to the sanded first strip. The method next includes heating the first strip and the layer of the first particles, followed by pressing a second strip formed of an aluminum alloy onto the heated layer of the first particles. The aluminum alloy of the second strip includes tin particles, and the heat causes the second particles to liquefy and dissolve into the melted first particles. The first particles and the second particles bond together to form bond enhancing metal particles, which typically comprise bronze.
US09108273B2	Methods of manufacturing large-area sputtering targets using interlocking joints In various embodiments, joined sputtering targets are formed at least in part by spray deposition of the sputtering material and/or welding.
US09108272B2	Controlling rules and variables for cutting The present invention relates to a method and a system for machine cutting several parts out of a piece of material using a beam cutting technology. The invention provides a set of controlling rules and variables for cutting two dimensional shapes or patterns. One rule or a combination of several rules are used for the cutting operation depending on the shape or pattern to be cut, the shape or pattern forming the parts out of the piece of material. The present invention specifically teaches that the set of controlling rules comprises rules for the forming of a cluster of parts with free form shapes, the parts being positioned so close to each other so that only the thickness of one cut made by the cutting beam is found between adjacent parts whenever the shape of the parts allows it.
US09108267B2	Pulse electric-current bonding method and pulse electric-current bonding apparatus A pressure surface of a first metal material for receiving a pressure therethrough is fabricated to have a directional component parallel to a pressure-application direction and a directional component perpendicular to the pressure-application direction, and an electrically-conductive core is fabricated to have a surface along the pressure surface and a surface perpendicular to the pressure-application direction. An assembly comprising the first metal material, the second metal material and the core is set in a pulse electric-current bonding unit to perform a pulse electric-current bonding process.
US09108263B2	Welding power source with automatic variable high frequency A high frequency power source configured to provide a variable voltage output is described such as for use in welding systems. The high frequency power source charges a capacitive storage device. A transformer having a primary winding coupled to the output of the high frequency power source and establishing a resonant frequency signal with the capacitive storage device, and a secondary winding coupled to the welding power supply, superimposes the resonant frequency signals onto the welding power signal of the welding power supply during periods of the resonant rings. By varying the voltage output from the high frequency power source, the high frequency energy delivered to the welding torch can be optimized for a variety of welding applications.
US09108257B2	Gear shaping machine The vertical movement cycle and trajectory inclination angle of a cutter are switched so that when a main spindle is moving downward, a head is moved to position the cutter at a machining location, and the cutter is lowered rectilinearly; that when the main spindle is moving upward, the head is moved to position the cutter at a withdrawal location; that, when an external gear is to be generated by cutting, relieving means for rectilinearly raising the cutter cause the machining location to be positioned on one radial side of the cutter and move the cutter downward parallel to the axis of a workpiece; and that when an internal gear is to be generated by cutting, said relieving means cause the machining location to be positioned on the other radial side of the cutter and move the cutter downward parallel to the axis of the workpiece.
US09108256B2	Apparatus for broaching repair of turbine rotor steeples A broaching apparatus (200, 400) includes; a broach (300, 600) having a cross-section corresponding to a geometry of slot (115) between adjacent steeples (110) of a turbine rotor (100), and a mechanism (210, 220, 230, 410, 420, 430) which moves the broach (300,600) through the slot (115) in a direction substantially parallel to a direction of extension of the slot (115).
US09108249B2	Cutting insert and associated drilling tool A cutting insert for use in a drilling tool includes two end faces disposed perpendicular to an insert axis and a plurality of side walls connecting the end faces. Supporting surfaces for bearing against corresponding mating supporting surfaces of a cutting insert receptacle of the drilling tool are formed on at least two of the side walls arranged in a rear region of the cutting insert. A main lip for machining a workpiece to be drilled is formed on at least one side wall arranged in a front region of the cutting insert. The side walls having the supporting surfaces are arranged in such a way that the cutting insert can be inserted into a trigon cutting insert receptacle in an accurately fitting manner.
US09108248B2	Cutting insert, cutting tool, and method of manufacturing machined product using them A cutting insert having low cutting resistance and excellent chip discharge performance is provided. The cutting insert 1 according to an embodiment of the present invention includes an upper surface 2, a lower surface 3, a side surface, and a cutting edge 5 disposed between an intersection of the upper surface 2 and the side surface 4. The upper surface 2 includes a rake surface continuous with the cutting edge 5. The rake surface includes a first rake surface 21 which is located correspondingly to a middle part of the cutting edge 5, and is parallel to a horizontal plane L including the intersection or is inclined downward as the first rake surface separates from the cutting edge 5, and a pair of second rake surfaces which are located on both sides of the first rake surface 21 and are inclined upward as the second rake surfaces separate from the cutting edge 5, and which include concave parts 2231b and 221c. A cutting tool including the cutting insert, and a method of manufacturing a machined product using the cutting tool are also provided.
US09108245B2	Sliding closure for a receptacle containing molten metal Sliding closure for a receptacle containing molten metal includes a housing frame that can be fastened to a spout of the receptacle, a first refractory base plate and a sliding unit having a refractory sliding plate that is sealingly pressed against the first base plate by spring elements and a contiguous refractory spout sleeve contained in the housing frame. The case has a second base plate juxtaposed to the first base plate and displaceable inside the housing frame at a right angle to the direction of movement of the sliding unit from an initial position in which the first base plate is in an operating position towards a final position in which the second base plate is in the operating position. It is therefore possible to replace the base plate, which wears outs quickly, by a new base plate in a rapid and convenient manner without interrupting the casting operation.
US09108240B2	Method of manufacturing container for absorbing fluid shock or mechanical shock Disclosed herein is a method of manufacturing a container for absorbing fluid shock or mechanical shock. The method includes preparing a raw material pipe, forming a coupling pipe by reducing a diameter of at least one side of the raw material pipe, and forming an inner circumference of the coupling pipe and bending it. Accordingly, a container body and a coupling pipe coupled to at least one side of the container body are integrated together, so that an additional process for coupling the container body with the coupling pipe is not required, and thus the cost of production is reduced.
US09108236B2	Method for transferring a metal coil A method is disclosed for transferring a metal coil, e.g., for transferring a metal coil in a coil box, on a transfer path between a first coil position and a second coil position, wherein the metal coil is supported during the transfer on the transfer path in segments by means of support rollers, and wherein the metal coil is simultaneously unwound, wherein a cradle expanding in the direction of the transfer path is formed by changing the positions of support rollers disposed adjacent to each other, wherein the coil is supported by two support rollers disposed on a first frame part in the first coil position and is displaced in the direction of the second coil position from said first coil position in that said frame part is simultaneously tilted and lowered.
US09108234B2	Method and apparatus for preparing steel stock before hot rolling A process and an apparatus for preparing steel stock before hot rolling. The steps of preheating the stock (5, 16, 22) in a first induction furnace (6) so that the preheated stock enters a subsequent descaling apparatus (7) with a surface temperature of T1≧1000° C.; descaling the preheated stock by a plurality of water jets in a descaling apparatus (7); direct subsequent heating of the descaled stock in a second induction furnace (8), where the descaled stock enters the second induction furnace (8) at a temperature T2 which is ≧Tcurie of the stock and heating in the second induction furnace 8 is either in a largely inert or largely reducing protective gas atmosphere; passing the heated stock in a rolling mill (9), where the heated stock enters the rolling mill (9) at a temperature 1220° C.≧T3 1050° C.
US09108233B2	Washing of contaminated soils The process “Washing contaminated soils” solves the problem of cleansing and remediating soils and sediments and their fine fractions contaminated with toxic metals, using washing solution with chelating agents. The chelating agent forms water-soluble complexes with metals and thus facilitates metal removal from soils and sediments into the washing solution. In addition to toxic metals, the process according to the invention enables removal of organic pollutants from soils and sediments by using washing solution amended with surfactants, detergents or organic solvents in addition to chelating agents. The process according to the invention provides for simultaneous separation of the soil and sediment solid phase and used washing solution in a chamber filter press, and effective rinsing of the solid phase to remove all residual mobilized contaminants. The process according to the invention recycles chelating agents and process water in a closed process loop by applying a pH gradient and by using advanced oxidation processes for process water cleansing.
US09108218B2	System and method for making multilayer films and a layer multiplication device A layer multiplication device may include a housing and at least one layer multiplication insert positioned inside the housing. The housing may have an inlet configured to receive a flow stream, an outlet configured to discharge the flow stream, and a flow cavity extending between the inlet and the outlet. In operation, the layer multiplication insert may divide an incoming flow stream so as to multiply the flow stream into at least a first flow stream and a second flow stream. In some examples, the inlet provides an inlet flow volume equal to a cross-sectional area of the housing at the inlet multiplied by a length of the flow cavity, the flow cavity defines a cavity flow volume, and the cavity flow volume is equal to or greater than the inlet flow volume.
US09108217B2	Nanoparticle coating of surfaces A nanoparticle coated hydrogel may be formed by a method of electrospraying nanoparticles on to a surface includes providing a drug and polymer combination in solvent to an inner capillary of a coaxial dual capillary spray nozzle. A coating with a drug that releases over time may be provided. Open and closed matrixes may be selectively formed to help modify time release periods.
US09108211B2	Vibration systems and methods In one arrangement, a vibration system includes a vibratable plate, a support member surrounding the vibratable plate, and a vibration-inducing member surrounding the support member. The vibration-inducing member is configured to radially expand and contract against the support member so as to produce axial vibration of the vibratable plate. In another arrangement, the vibratable plate has an outer circumference; a tubular member is concentrically disposed about the outer circumference of the plate, and an annular vibration-inducing member is concentrically disposed about the outer circumference of the tubular member. The vibration-inducing member is preferably a piezoelectric ring that is radially expandable and contractable against the wall of the tubular member to cause the plate to vibrate in the axial direction.
US09108207B2	Shower apparatus Provided is a shower apparatus which can stably supply bubbly water through all nozzle holes and can cause water droplets of large, uniform size to land continuously on the user so as to allow the user to enjoy a shower with a voluminous feel as if the user were being showered by large drops of rain. The shower apparatus includes a water supply unit, a throttle unit adapted to eject passing water downstream, an aeration unit adapted to produce bubbly water by aerating the water ejected through the throttle unit, and a nozzle unit provided with a plurality of nozzle holes used to discharge the bubbly water, wherein the throttle unit has a flat-shaped throttle channel and water ejected through the throttle channel plunges into an air-liquid interface as a sheet-like stream, thereby producing bubbly water, which is then discharged through the nozzle hole.
US09108205B2	Coating apparatus for coating an inside of a hollow body with an atomized fluid A coating device for coating an inside of a hollow body with an atomized fluid has at least one atomizing tube enclosing an atomizing channel. A pressurized propellant gas for atomizing an unatomized fluid can be introduced into the atomizing tube. The atomizing tube has at least one outlet opening and further has at least one hollow needle having a discharge opening for the unatomized fluid. The at least one hollow needle interacts with the atomizing channel and is arranged essentially coaxially thereto. The atomizing tube and the hollow needle form a Venturi arrangement.
US09108204B1	Centrifuge with continuous fluid flow for containers A centrifuge includes a container and at least one drive for rotating the container about its own axis and revolving the container about an axis of revolution and through a plane of revolution. At least one conduit extends from the container to a first or second side of the plane of revolution. The direction of rotation of the container is according to the left hand rule if the conduit extends to the first side of the plane of rotation, and according to the right hand rule if the conduit extends to the second side of the plane of rotation. The frequency of the container rotation is equal to the frequency of the container revolution. A centrifugal separator and a method for centrifuging a liquid are also disclosed. The invention provides for continuous centrifugation while prevent conduits into the container from getting tangled.
US09108199B2	Automatic test tube recapper An automatic test tube recapper is presented that is capable of recapping thousands of test tubes per day. Specially designed caps are poured into an upper triangular shaped hopper. The randomly oriented caps are transported by a pair of belts to an upper slide. Misaligned caps are rejected and fall back into the hopper, while properly aligned caps slide down the slide to a cap catch, one at a time. A hammer shaft then drives the cap into the top of the test tube until the cap is firmly seated. The hammer shaft reverses, which withdraws the shaft upwards. As the hammer shaft moves upwards, it triggers a pair of arms that allows another cap to fall into the cap catch. A conveyor also automatically moves the next uncapped test tube under the cap. The cycle then repeats itself.
US09108187B2	Fe(II)-substituted beta type zeolite, gas adsorbent containing same and method for producing same, and method for removing nitrogen monoxide and hydrocarbon To provide an Fe(II)-substituted beta type zeolite which has been ion-exchanged with Fe(II) ions and can effectively adsorb and remove nitrogen monoxide or hydrocarbon contained in gas to be cleaned, even if oxygen is present in the gas at a high concentration or the temperature of the gas is low. In the Fe(II)-substituted beta type zeolite, a ratio of SiO2/Al2O3 is preferably 10 to 18, a BET specific surface area is preferably 400 m2/g to 700 m2/g, a micropore specific surface area is preferably 290 m2/g to 500 m2/g, and a micropore volume is preferably 0.15 cm3/g to 0.25 cm3/g. The amount of Fe(II) supported is preferably 0.01% by mass to 6.5% by mass based on the Fe(II)-substituted beta type zeolite.
US09108185B2	Catalyst support materials, catalysts, methods of making them and uses thereof Catalyst support materials, catalysts, methods of making such and uses thereof are described. Methods of making catalyst support material include combining anatase titania slurry with i) a low molecular weight form of silica; and ii) a source of Mo to form a TiO2—MoO3—SiO2 mixture. Catalyst support material include from about 86% to about 94% weight anatase titanium dioxide; from about 0.1% to about 10% weight MoO3; and from about 0.1% to about 10% weight SiO2. Low molecular weight forms of silica include forms of silica having a volume weighted median size of less than 4 nm and average molecular weight of less than 44,000, either individually or in a combination of two or more thereof. Catalyst include such catalyst support material with from about 0.1 to about 3% weight of V2O5 and optionally from about 0.01% to about 2.5% weight P.
US09108180B2	Cation-exchanged zeolite catalyst and process for producing mono-iodo benzene through transiodination by using it The present invention relates to a cation-exchanged zeolite catalyst for an transiodination and a process for producing mono-iodo benzene by using it. Particularly, the cation-exchanged zeolite catalyst has a molar ratio of Si/Al from 5 to 100 and is ion-exchanged with an alkali metal or an alkaline earth metal in range of 2% to 50% of ion exchange capacity.Further, the process for producing mono-iodo benzene of the present invention comprises the step of performing a transiodination by using the cation-exchanged zeolite catalyst to produce mono-iodo benzene from reactants including benzene and one or more multi-iodo benzenes selected from the group consisting of di-iodo benzene and tri-iodo benzene.
US09108169B2	Desalination treatment membrane According to one embodiment, a desalination treatment membrane includes a desalting membrane and a base material which is disposed in close contact with the desalting membrane, wherein a solid salt is fixed to the base material by a graft-polymerization.
US09108161B2	Water purifier The present invention provides a water purifier which is easily removable from a drinking water supply apparatus, and has a built-in filtration filter with high efficiency of purifying raw water of a bottle. The water purifier is removable from a drinking water supply apparatus, and the drinking water supply apparatus including a bottle for containing water and a main body which has a recess into which a neck of the bottle is insertable. The water purifier is characterized by being placed between the recess of the main body and the neck of the bottle.
US09108160B2	Methods for enhanced electrocoagulation processing using membrane aeration Apparatus and methods for enhanced electrocoagulation processing using enhanced membrane aeration are disclosed for effluent treatment. The apparatus has an enrichment means for establishing an ion rich air/gas stream and a membrane aerator for receiving the ionized air/gas stream and effluent to be treated. An ionized air/gas rich effluent feed stream flows out of the membrane aerator and is received at an electrocoagulation processing assembly for diffused ion enhanced electrocoagulation treatment.
US09108154B2	Exhaust purification system of internal combustion engine In an internal combustion engine, inside of an engine exhaust passage, a hydrocarbon feed valve (15) and an exhaust purification catalyst (13) are arranged. At the time of engine operation, the amplitude of change of the concentration of hydrocarbons which flow into the exhaust purification catalyst (13) is made to become within a predetermined range of amplitude by control of at least one of the injection time and injection pressure of hydrocarbons from the hydrocarbon feed valve (15). In this case, when only the injection time of hydrocarbons is controlled, the injection time of hydrocarbons under the same engine operating state is made longer the higher the temperature of the exhaust purification catalyst (13).
US09108153B2	Exhaust purification system of internal combustion engine In an internal combustion engine, inside of an engine exhaust passage, a hydrocarbon feed valve (15) and an exhaust treatment catalyst (13) are arranged. On a substrate (45) of the exhaust treatment catalyst (13), a coat layer comprised of at least two layers of a top coat layer (46) and a bottom coat layer (47) is formed. The top coat layer (46) is comprised of an exhaust purification catalyst for reacting NOx contained in exhaust gas and reformed hydrocarbons, while the bottom coat layer (47) is comprised of an NOx absorption catalyst. The concentration of hydrocarbons which flows into the exhaust treatment catalyst (13) is made to vibrate within a predetermined range of amplitude and within a predetermined range of period. Due to this, NOx contained in exhaust gas and NOx desorbed from the NOx absorption catalyst (47) are reduced in the exhaust purification catalyst (46).
US09108152B2	Dry scrubber system with low load distributor device An air quality control system (AQCS) 14 useful for treating flue gas FG, such as flue gas FG produced by a fossil fuel fired boiler 12 is described. The AQCS 14 is equipped with a dry scrubber low load distributor device 66. With the low load distributor device 66, flue gas FG flow through a dry scrubber reactor 36 is stabilized under varying plant 10 load conditions to maintain AQCS 14 stability, efficiency and effectiveness.
US09108151B2	Integrated chemical process A process for converting carbon dioxide into solid material, which process comprises the steps of: (a) direct thermal activation of magnesium silicate hydroxide mineral feedstock by combustion of fuel to produce an activated feedstock; (b) separation from the activated feedstock of metal oxides at least substantially excluding magnesium oxide and magnesium silicate to produce a residual activated feedstock; (c) before or after said separation step suspension of the activated feedstock in a solvent to form a slurry; and (d) contacting the slurry of residual activated feedstock with carbon dioxide to convert the carbon dioxide into magnesium carbonate.
US09108143B2	Ethylene absorption filter for refrigerated spaces The present invention relates to an ethylene absorption filter for refrigerated spaces, comprising an inner granulate (2), a perforated tubular body (3) and a mesh cover (4), the perforated tubular body (3) being stiff and being provided with a distribution of holes (5) having an elongate form, the smallest dimension of said holes (5) being equal to or less than 1.5 mm and the largest dimension thereof being at least 45% greater than the smallest dimension.
US09108128B2	Filter A filter has a filter medium (10) during operation clears fluid, particularly in the form of hydraulic fluid. The filter medium (10) is made of a material such that the potential difference to the fluid to be cleaned is low. The parts of the filter medium (10) have different potentials with respect to each other and/or the fluid to be cleaned such that they cancel each other at least partially, specific dissipation is aspired, or a return of electric charge to the associated filter medium (10) is provided, using a charge equalization situation.
US09108127B2	Directed hydroburst system for cleaning flat screens A screen intake system has a body with an open end and a chamber. A flat screen is disposed at the open end of the body. To keep the screen clear of debris, an airburst system has pipes disposed in the chamber. The pipes dispose parallel to one another adjacent the flat screen, and each of the pipes has orifices in a side facing the flat screen. Directors are disposed along the backs of the pipes in a lattice, and each of the directors has a channel in which the pipe disposes. Compressed air released by valves from a tank dispersed from the pipe's orifices. Each of the directors directs the resulting water/airburst from the orifices toward the adjacent flat screen to clear it of debris.
US09108119B2	Section race track with roll over vehicles The invention entails a modular sectional race track with recreational style racing vehicles, such as four wheel all terrain recreational vehicles. The sectional race course usually has moving obstacles, various obstructions plus the general design of the course track induces the racing vehicles to spin out, tilt over on their side or framework roof and/or rollover completely. The race vehicles have specifically designed roll over frameworks that, with the driver's safety harness fastened, assist the racing vehicles to roll back over on to its drive tires. The racing vehicle may be additionally assisted to roll back over by a driver initiated mechanical righting device. The race tracks' sections can be configured to be sized and shaped for specific race venues. The track sections can be quickly attached, detached and transported as needed.
US09108114B2	Tangible user interface and a system thereof The present invention relates to a TUI having a plurality of faces. A sensing system is provided to detect the presence of one or more adjacent TUIs within a predetermined sensing distance of one of the faces. Thus, the sensing system is arranged to detect whether any of the faces of the TUI opposes one or more adjacent TUIs. It may further be able to detect the relative orientation of opposing faces of the TUI and the one or more adjacent TUIs. The sensing system is further configured to enable the determination of the orientation of the TUI with respect to the vertical direction.
US09108099B2	Pad cover A cover for a protective sport pad including a cover portion for covering a surface of the pad, and a fastening means for fastening the cover to the protective sport pad. In one form, the protective sport pad is a cricket pad for a lower leg portion of a player, and the cover portion is arranged to cover an exposed surface of the pad. The cover portion may be formed of colored material to change the color of the protective sport pad.
US09108095B1	Game puck with replaceable runners A hockey puck or game puck designed for non-ice street and court play has friction-reducing runners that engage the playing surface, the runners being replaceable without need for tools. The runners, which can have friction characteristics similar to that of traditional non-ice pucks, can easily be replaced by hand when worn or broken, using the same puck body. Multiple sets of runners with different sizes and friction characteristics preferably are provided, the runners being interchangeable as desired. Replacement runners are inexpensive and allow the puck body to be used over a long period of time.
US09108090B2	Golf club head or other ball striking device having impact-influencing body features A ball striking device, such as a golf club, includes a head with a face having an outer surface configured for striking a ball, a body connected to the face, an elongated, inwardly recessed channel located on the body and extending across a portion of the body, and an insert mounted within the channel. The insert includes a resiliently deflectable base member that engages the channel to retain the insert within the channel and a rigid outer member connected to the base member and forming at least a portion of the outer surface of the insert, where the outer member is made from a different material than the base member. Additionally, the insert has an outer surface that is substantially flush with at least one immediately adjacent surface of the body.
US09108089B1	Golf club including improved club head, improved club head for same, and golf training aid Embodiments provide a golf club for striking a golf ball, the golf club including an elongated shaft, the shaft having an upper end portion spaced apart from a lower end portion, a club head disposed at the lower end portion, the club head having a first club-face portion for striking the golf ball, the club head having a second club-face portion for striking the golf ball, relative to the first club-face portion the second club-face portion defining there between a ninety degree angle.
US09108085B2	Golf ball having an aerodynamic coating including micro surface roughness Golf balls include: (a) a golf ball having a first set of construction specifications; (b) a coating of the golf ball having an exterior surface and (c) the exterior surface having an enhanced micro surface roughness. The enhanced micro surface roughening affects the aerodynamic properties of the ball as compared to golf balls having the same set of construction specifications but without enhanced micro surface roughness.
US09108083B2	Golf ball including a blend of highly neutralized acid polymers and method of manufacture A golf ball having an inner core layer, an outer core layer enclosing the inner core layer, and a cover layer enclosing the outer core layer. The inner core layer includes a blend of a first highly neutralized acid polymer having a first Vicat softening temperature and a first specific gravity, a second highly neutralized acid polymer having a second Vicat softening temperature and a second specific gravity, and an ionomer-based masterbatch comprising an additive and an ionomer resin having a third Vicat softening temperature and a third specific gravity. The absolute values of the differences among the Vicat softening temperatures is no more than about 15° C. and the absolute value of the difference between the specific gravities is no more than about 0.015. The cover layer may include an inner cover layer enclosing the outer core layer and an outer layer enclosing the inner cover layer.
US09108077B2	Reverse resistance unit mount for a bicycle trainer A bicycle trainer includes a reverse resistance unit mounting arrangement that is configured to increase traction between a bicycle wheel and a resistance unit upon an increase in the speed of rotation of the wheel. The reverse resistance unit mounting arrangement is configured to mount the resistance unit in a suspension-type manner and has an actuator that initially positions the resistance unit against the bicycle wheel. The reverse resistance unit mounting arrangement tends to pivot the resistance unit against the bicycle wheel during use, to automatically bias the wheel toward the resistance unit to prevent slippage between the bicycle tire and the roller of the resistance unit.
US09108061B2	Linear electrode array to treat mitral regurgitation A method and apparatus are disclosed for treating mitral regurgitation with electrical stimulation. By providing pacing stimulation to a region of the left ventricle in proximity to the mitral valve apparatus in a manner which pre-excites the region during early ventricular systole, a beneficial effect is obtained which can prevent or reduce the extent of mitral regurgitation.
US09108044B2	Use of electromagnetic radiation in the treatment of sensory organs A method of using and devices for delivering electromagnetic radiation of a selected wavelength for the treatment of conditions pertaining to cephalic sensory organs, in particular to treating conditions of the eye (ocular conditions) and conditions pertaining to the ear (otic conditions). The invention is in particular for the treatment of organelles associated with the acoustic and optic nerves and more particularly for the treatment of age related degeneration of such organelles. The invention also provides devices for treating ocular and otic conditions.
US09108040B2	Methods and apparatus for multi-vessel renal neuromodulation Methods and apparatus are provided for multi-vessel neuromodulation, e.g., via a pulsed electric field. Such multi-vessel neuromodulation may effectuate irreversible electroporation or electrofusion, necrosis and/or inducement of apoptosis, alteration of gene expression, action potential attenuation or blockade, changes in cytokine up-regulation and other conditions in target neural fibers. In some embodiments, the multi-vessel neuromodulation is applied to neural fibers that contribute to renal function. Such multi-vessel neuromodulation optionally may be performed bilaterally.
US09108017B2	Method of making tubing have drainage holes A method for manufacturing a kink-resistant tube having drainage holes is provided. A wire is coated with plastic material and wound around a mandrel forming a plurality of windings. The wound coated wire is heated until the plastic coating material melts and bonds the wire windings to form a wire-reinforced sheath having wire-containing sections and non-wire containing sections. Alternatively, a coated or non-coated wire is wound around a mandrel together with separate polymer filament material and then heated. A filament having an elongated cross-section may be employed with the major axis of the elongated cross-section substantially parallel to the longitudinal axis of the sheath. At least one non-wire containing section is identified by passing light through at least one wall of the wire-reinforced sheath. Image capture and analysis via an optical system and microprocessor automatically identify regions to target a drill for forming holes in the non-wire containing sections.
US09108013B2	Automatic anaesthesia delivery system This invention relates to an improved automatic anaesthesia delivery system comprising: (a) at least one of a bispectral index monitor and an anaesthesia vital sign monitor interfaced with a computer to receive input from patient; (b) at least one pump for controlling delivery of drug based on the feedback from patient; (c) said computer having specific software for controlling said pump(s) and for fine tuning the dosage based on patient's response and requirements.
US09108011B2	Inhalation device The invention relates to an inhalation device (FIG. 1) having a connection device (4) and a container (8) connected or connectable thereto and collapsing upon inhaling, for intermediately storing an aerosol. In order to increase the fine particle count of the dispensed aerosol, the container (8) at least substantially retains the length thereof when collapsing, and/or tapers down toward the free end thereof.
US09108007B2	Spindle and bearing combination and drug delivery device An improved spindle and bearing combination for a drug delivery device is provided that has a first connection between the spindle and bearing comprising a web and a second connection that replaces the first connection when the web is severed that allows the spindle to rotate relative to the bearing.
US09108005B2	Treatment of carpal tunnel syndrome by injection of the flexor retinaculum An apparatus and method for identifying the flexor retinaculum of the carpal tunnel, injecting an effective amount of an agent into at least a portion of flexor retinaculum or tissue adjacent thereto, wherein the agent is configured to weaken the flexor retinaculum. The system may further include means for increasing the tensile stress in the flexor retinaculum post-injection using hand exercises, thereby weakening its structural integrity and decreasing the pressure within the carpal tunnel that impairs median nerve function.
US09107996B2	Medicament delivery devices A medicament delivery device comprises a housing, a holder within the housing for receiving a medicament cartridge, a piston rod for driving a bung of the medicament cartridge, a drive mechanism including a motor for providing an output drive to the piston rod for delivering the medicament and control means for controlling operation of the device. The device is additionally provided with a bung sensor for sensing when the piston rod is in contact with the bung and the control means is operative for advancing the drive of the piston rod towards the bung.
US09107994B2	Systems for fluid reservoir retention A fluid infusion device is provided. The fluid infusion device can include a fluid reservoir having a barrel portion and a housing defining a receiving portion for removably receiving the fluid reservoir within the housing. The housing can have a first side including a first engagement system that cooperates with the barrel portion to bias the fluid reservoir relative to the housing in a direction substantially opposite a direction of fluid flow out of the fluid reservoir.
US09107985B2	Wound treatment containment apparatus The invention relates to the treatment of wounds. In particular, the invention relates to systems, devices, and methods enabling treatment (e.g., debridement) of wounds with liquid, gas, or particles in a non-controlled setting while providing containment of contaminated liquid, gas or particles, thereby preventing exposure of individuals and surfaces in proximity to the patient to infectious materials. In certain embodiments, the systems and devices are conformable to the contours of a non-planar surface, such as the human body (e.g., to seal or partially seal the device or system to a portion of a human body).
US09107984B2	Device and method for mounting a pharmaceutical application aid A device (1) for assembly of a pharmaceutical application aid (51), particularly a pen, is proposed. The device (1) is characterized by a holding device (3) for fixation of a first housing sleeve (5) that accommodates a pharmaceutical container, particularly a carpule (23), and by a stop (43) for limiting a displacement of a second housing sleeve (35) relative to the first housing sleeve (5).
US09107977B2	Implant material, implant component, implant component manufacturing method, laser machining method, and laser machining apparatus In a hydroxyapatite to be joined to another hydroxyapatite or a bone by laser machining (machining of the bone and the hydroxyapatite includes irradiation of laser light on the bone and irradiation of laser light on the hydroxyapatite), to prevent occurrence of a fracture in a junction and in a peripheral portion of the junction during laser machining, the present invention provides an optimum weight ratio of a cordierite or quartz glass component mixed in the hydroxyapatite. As a mixing ratio of the cordierite or quartz glass component, the cordierite or quartz glass component is mixed at least at a weight ratio equal to or higher than 25.7%.
US09107960B2	Antibody-SN-38 immunoconjugates with a CL2A linker The present invention concerns improved methods and compositions for preparing SN-38 conjugates of proteins or peptides, preferably immunoconjugates of antibodies or antigen-binding antibody fragments. More preferably, the SN-38 is attached to the antibody or antibody fragment using a CL2A linker, with 1-12, more preferably 6 or less, most preferably 1-5 SN-38 moieties per antibody or antibody fragment. Most preferably, the immunoconjugate is prepared in large scale batches, with various modifications to the reaction scheme to optimize yield and recovery in large scale. Other embodiments concern optimized dosages and/or schedules of administration of immunoconjugate to maximize efficacy for disease treatment and minimize side effects of administration.
US09107949B2	Method for using naturally occurring gas vesicles as ultrasound contrast agent The present invention generally relates to one or more methods of using naturally occurring vesicles as contrasting agents for ultrasound imaging.
US09107941B2	Methods and compositions for reducing L-pipecolic acid effects in animals The present invention relates to methods and compositions for reducing L-pipecolic acid concentrations and/or effects in animals. In an embodiment, the invention includes a method of reducing plasma concentrations of L-pipecolic acid in animals including administering an effective amount of a composition including saponins. In an embodiment, the invention includes a method of reducing anorectic effects of L-pipecolic acid in animals including administering an effective amount of a composition including saponins. Other embodiments are also included herein.
US09107934B2	MicroRNA as a cancer progression predictor and its use for treating cancer The present invention is based on the findings that a novel function for miR142-3p in the regulation of Sox2, adenylyl cyclase 9 (AC9), and CD133 expressions, and consequently the overall stemness of recurrent GBM cells as well as CSCs, and that miR142-3p modulated tumor-initiating properties in recurrent GBM. The present invention consequently supports the development of novel miRNA-based strategies for brain tumor treatment.
US09107929B2	Stable parenteral formulations of tigecycline The invention relates to stable parenteral formulations of tigecycline and process of preparation thereof, wherein the formulation comprises an edetate, a pH modifying agent or an antioxidant, such that the formulation remains stable for at least 45 hours.
US09107926B2	Mutant selectivity and combinations of a phosphoinositide 3-kinase inhibitor compound and chemotherapeutic agents for the treatment of cancer Methods and compositions are provided for treating hyperproliferative disorders in patients with a PI3K inhibitor, GDC-0032 as a single agent or in combination with chemotherapeutic agents.
US09107925B2	Sodium channel blocker for treatment of loss of superficial sensitivity The invention concerns a sodium channel blocker for the treatment of a reduction or loss of superficial sensitivity or sense of touch of a human being or another mammal.
US09107924B2	Inhibitors of Bruton'S tyrosine kinase for the treatment of solid tumors Described herein are irreversible Btk inhibitor compounds, and methods for using such irreversible inhibitors in the treatment of diseases and disorders characterized by the presence or development of solid tumors.
US09107921B2	Oral dosage forms for oxygen containing active agents and oxyl-containing polymers A pharmaceutical tablet for oral administration once every 12 hours is provided. The tablet includes a first active agent that is a tri-oxy active agent, a second active agent, and a release rate controlling non-ionic oxyl-containing hydrophilic polymer. The tablet is a matrix tablet and a single-dose administration of one or more tablets to a subject under fasted conditions provides a mean Cm˜ for each of the first active agent and the second active agent that is 70% to 135% of a respective mean Cm˜ provided by administering an immediate release oral dosage form to a subject under fasted conditions every 4 to 6 hours over a 12 hour time period, wherein cumulative dosage amounts administered over the 12 hour time period of each active agent is equivalent to the respective amount of each active agent in the pharmaceutical tablet.
US09107904B2	Immunostimulatory compositions and methods of use thereof Lipid conjugates for enhanced delivery of cargo to the lymph nodes are disclosed. The lipid conjugates typically include three domains: a lipophilic domain that binds to albumin, a polar block domain, and a cargo such as a molecular adjuvant or immunostimulatory compound (such as an oligonucleotide) or antigenic peptide. Depending on the cargo, the length and compositions of the polar block can be tailored to push the equilibrium toward albumin binding, stable micelle formation, or cell insertion. The conjugates can be administered to a subject, for example, a subject with cancer or an infection, to induce or enhance a robust immune response in the subject.
US09107903B2	Silver nanoparticle antimicrobial coating for long-term and short-term infection resistance Disclosed herein is an implantable medical device including an antimicrobial layer. The antimicrobial layer may include a first distinct size of silver nanoparticles, a second distinct size of silver nanoparticles, and a third distinct size of silver nanoparticles. The antimicrobial layer extends over a surface of the implantable medical device, and, in some instances, the surface of the implantable medical device may serve as a substrate on which the antimicrobial layer is deposited.
US09107901B2	Immunotherapy compositions and methods of treatment Provided are compositions that include one or more natural, recombinant and/or modified allergens; with a pharmaceutically acceptable non-aqueous solvent to form an immunotherapy composition that includes the active ingredient and solvent, wherein the immunotherapy composition is formulated for administration to a subject in need of immunotherapy. The solvent is miscible with water and interstitial fluid. The at least one active ingredient is soluble in the solvent and insoluble in water and in an aqueous phase of interstitial fluid. The present compositions may be administered to a patient for example, as part of an immunotherapy regimen to help induce a state of immunologic tolerance to one or more allergies, or as treatment for an autoimmune disease. Also provided are methods of making such compositions. Further provided are methods that include administering the composition to a mammal.
US09107896B2	Dermal micro-organs, methods and apparatuses for producing and using the same Embodiments of the present invention provide Dermal Micro-organs (DMOs), methods and apparatuses for producing the same. Some embodiments of the invention provide a DMO including a plurality of dermal components, which substantially retain the micro-architecture and three dimensional structure of the dermal tissue from which they are derived, having dimensions selected so as to allow passive diffusion of adequate nutrients and gases to cells of the DMO and diffusion of cellular waste out of the cells. Some embodiments of the invention provide methods and apparatuses for harvesting the DMO. An apparatus for harvesting the DMO may include, according to some exemplary embodiments, a support configuration to support a skin-related tissue structure from which the DMO is to be harvested, and a cutting tool able to separate the DMO from the skin-related tissue structure.
US09107886B2	Modified polynucleotides encoding basic helix-loop-helix family member E41 The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmRNA molecules.
US09107884B2	Use of semaphorin 6A for promoting myelination and oligodendrocyte differentiation The invention provides methods of treating diseases, disorsers or injuries involving demyelination and dysmyelination, including multiple sclerosis, by the administration of a Sema6A polypeptide.
US09107877B2	Method of treating onychomycosis A nail lacquer consisting essentially of terbinafine as an antimycotic agent, hydroxypropyl chitosan as film forming agent, water and a lower alkanol as solvents, including a method for treating onychomycosis by topically administering such a nail lacquer to a patient in need of such a treatment.
US09107876B2	Surface anesthetic agent Provided is an anesthetic agent which can exhibit an anesthetic effect rapidly when adhered on mucosal membranes, the skin or the like by means of application or the like in local anesthesia, particularly surface anesthesia. Prepared are: a fast-acting surface anesthetic agent containing lidocaine and ethyl paraaminobenzoate at a specific ratio; and a super fast-acting surface anesthetic agent containing lidocaine, ethyl paraaminobenzoate and adrenaline at a specific ratio.
US09107866B2	Adhesin-enterotoxin chimera based immunongenic composition against enterotoxigenic Escherichia coli The inventive subject matter relates to an immunogenic composition composed of a chimeric molecule including a conformationally stable adhesin from Escherichia coli fused to a bacterial toxin A subunit, such as cholera toxin A subunit or heat-labile Escherichia coli toxin A subunit. The invention also relates to the adhesin-toxin chimera noncovalently associated with a toxin B subunit of the same or different species as the A subunit. The invention also relates to a method of utilizing an adhesin/toxin fusion composition to elicit an immune response.
US09107864B2	Tissue targeted antigenic activation of the immune response to treat cancers The invention provides in part methods of treating cancers of a specific organ or tissue by administering a composition that is antigenically specific for one or more microbes that are pathogenic in the specific organ or tissue in which the cancer is situated.
US09107852B2	Uses of agonists of delta opioid receptor in cosmetic and dermocosmetic field The present invention relates to the use of a DOR ligand for stimulating pigmentation in a cosmetic composition and to the use of rubiscolin-6 or its derivatives in a cosmetic composition.
US09107851B2	Solventless mixing process for coating pharmaceutical ingredients The present invention is a solventless method of producing polymer coated active pharmaceutical ingredient that is taste-masked and may be released in relatively short time. It employs high energy vibrations or acoustic mixing of API particles, water soluble coating material particles and hydrophobic polymer particles, with or without use of other pharmaceutically relevant powders as media. Additionally the method is capable of producing individually coated drug particles without agglomeration or the long drying times associated with solvent based coating methods.
US09107848B2	Coupler with cationic 7-amino-1,2,3,4-tetrahydroquinoline structure, dyeing composition comprising same, processes and uses The invention relates to the use of specific heterocyclic couplers which are cationic 7-amino-1,2,3,4-tetrahydroquinoline derivatives of formula (I) for dyeing keratin fibers such as the hair: in which formula (I): R1 to R6, CAT+, An−, and Ra to Rb are as defined in the description.
US09107838B2	Fluoride varnish A tooth varnish that is free from pinus extracts, free of substantial undesired coloring agents, with a reduced viscosity, delivered in a user-friendly, flow-through, unit dose applicator and having improved fluoride release, uptake, and remineralization properties.
US09107835B2	Chewable enteric coated aspirin tablets The invention relates to a tablet capable of being chewed or disintegrated in the oral cavity, which comprises an enteric coated aspirin active ingredient, and preferably a lightly compressed matrix comprising directly compressible carbohydrate(s) and at least one sweetener.
US09107832B2	Risperidone microparticles formed by sublimation Provided are microparticles of active pharmaceutical ingredients, drug delivery vehicles comprising same, and methods for making them.
US09107824B2	Methods of treating cancer with high potency lipid-based platinum compound formulations administered intraperitoneally One aspect of the invention relates to methods of treating cancer in a patient comprising administering intraperitoneally to a patient in need thereof a cancer treating effective amount of a composition comprising a lipid-complexed platinum compound wherein the concentration of the platinum compound of the lipid-complexed platinum compound composition is greater than about 1.2 mg/ml. Another aspect of the invention relates to lipid-complexed platinum compound compositions where the concentration of the platinum compound is greater than about 1.2 mg/ml.
US09107823B2	Foamable formulation The present invention provides DMSO-containing foamable formulations, methods for preparation, and methods of treatment. The formulations can provide good permeability and bioavailability at the target site. Preferably, the formulations are useful for treating osteoarthritis. In one embodiment, the invention provides a foamable formulation for topical use, said formulation comprising DMSO, polyalkylene glycol alkyl ether, an active agent, a monohydric lower alcohol, a diol, and water. Preferably, the active agent is a non-steroidal anti-inflammatory drug, such as diclofenac sodium or ibuprofen.
US09107821B2	Stable bortezomib formulations Multi-dose formulations for bortezomib are presented in which bortezomib has significantly improved stability. Especially preferred formulations include those in which bortezomib is in a liquid form suitable for injection, wherein the solvent system predominantly comprises propylene glycol. In other preferred aspects, bortezomib is present as a Lewis donor-acceptor complex with a hetero-bifunctional Lewis base.
US09107817B2	Method of promoting mucosal reciliation The present invention relates to ionic compositions for promoting mucosal reciliation, particularly in the sinonasal cavity. The ionic components of the composition can include potassium, calcium, rubidium, zinc, bromide, and magnesium in an isotonic solution. In other embodiments, the ionic components of the composition can include magnesium, bromide, sulfate, sodium, and chloride.
US09107815B2	Sustained release poloxamer containing pharmaceutical compositions A thermo-reversible thermoplastic pharmaceutical composition, comprising a botulinum toxin and a biocompatible poloxamer which provides thermoreversibility to the composition and additionally stabilizes the botulinum toxin, is described. The pharmaceutical composition can be administered to a patient as a liquid, and gels after administration into a sustained release drug delivery system from which the biologically active botulinum toxin is released over a multi-day period thereby localizing the drug as a depot and controlling release to enhance the therapeutic effect per dose.
US09107812B2	Pharmaceutical composition containing an N-phenylpyrazole derivative and glycofurol, use for the preparation of a topical veterinary medicament for combating fleas The present invention relates to a liquid pharmaceutical composition containing an N-phenylpyrazole derivative as active ingredient and alpha-(tetrahydrofuranyl)-omega-hydroxypoly(oxy-1,2-ethanediyl) as solvent for the treatment and/or prevention of infestations with fleas in domestic animals.
US09107803B2	Container with storage chambers A container having at least two separate chambers that allow for the storage of two components of a liquid product to be stored, and later mixed, for consumption wherein the storing or mixing takes place within the container and is allowed by placement of a formula chamber disposed at various positions with the container.
US09107797B2	Sexual stimulation devices and methods A sexual stimulation device includes an elongated dildo housing sized to be received within an orifice of a human body, the housing defining an internal cavity extending along a longitudinal axis of the housing, a mass laterally constrained within the cavity and movable linearly along the cavity, and an electrically driven actuator disposed within the housing and operably coupled to the mass. The actuator is operable to accelerate the mass along the cavity and to thereby induce a longitudinal reactive acceleration of the housing.
US09107792B2	Carriage for a surgical boot of a hip distractor A carriage for a limb support includes a space for receiving a longitudinal member of a patient support apparatus, a plurality of rollers configured to engage the longitudinal member and a locking mechanism. The plurality of rollers is configured to maintain alignment of the carriage during movement of the carriage along the longitudinal member. The carriage also includes an elastomeric member that resists rotation to prevent unwanted motion of the carriage. The locking mechanism is configured to secure the carriage to the longitudinal member at any of an infinite number of positions along the length of the longitudinal member, the locking mechanism being lockable with a single action.
US09107783B2	Patient handling device A patient handling device, such as a bed, stretcher, cot, or the like, includes a deck on which a patient may lie and which is surrounded by siderails. Control panels may be mounted on the siderails in a staggered fashion to improve the ease of accessing the control panels. A handle assembly may be included near the top of the Fowler section of the deck which allows a pair of handles to be squeezed independently for manual pivoting of the Fowler section. Squeezing one handle does not increase the force required to subsequently squeeze the other handle. The pivoting of the Fowler section may also be carried out automatically through an electrical actuator. The raising of the deck may be carried out through an electrical pump that pumps hydraulic fluid, and which may be activated near the top end of the stroke of a reciprocating pedal.
US09107781B1	Height adjustable apparatus with opposed legs movably and pivotally connected to rails supporting a deck The present invention relates to an apparatus, such as a bed, having a vertically adjustable deck that is selectably raised and lowered in a substantially vertical manner. Two leg frames are pivotally and movably connected to rails supporting the deck through a slot in the bottom of the rails. Support frames having a fixed longitudinal position relative the bed frame rail are connected to a central pivot point of the leg frames, respectively. The support frames each have a cross member supporting a connection lever defining a path. Actuators are pivotally connected to the bed frame and to a movable pivotal connection point along the path. A control arm is provided to determine the location of the actuator end relative the path of the connection lever. Wheel assemblies can be pivotally connected to the second end of the leg frames.
US09107771B2	Delivery system for a prosthesis The invention provides a delivery system for a prosthesis, said delivery system comprising a catheter shaft with a distal end, a proximal end and a longitudinal axis, a space for a prosthesis with a distal end and a proximal end, the space being at the distal end of the catheter shaft, a sheath with a proximal end and a distal end, the sheath being disposed at the distal end of catheter shaft so as to surround the space, a pusher element attached to the distal end of the catheter shaft and arranged at the proximal end of the space for abutting prosthesis, a pull element with a longitudinal axis, the pull element running the length of the catheter shaft and having a distal end attached to the proximal end of the sheath and a proximal end for pulling the pull element proximally, thereby retracting the sheath proximally relative to the prosthesis space, and at least one fixation element having a proximal end and a distal end and being disposed within a flexible portion of the length of the shaft that lies between the proximal end of the sheath and the proximal end of the catheter shaft. The fixation element serves to limit a radial distance between the axis of the pull element outside the shaft and the axis of the catheter shaft along the length of the fixation element whenever a tensile stress in the pull element results in an endwise compressive stress on the shaft and a tendency of the shaft to bow, relative to the pull element.
US09107769B2	Systems and methods for providing a femoral component Systems and methods for providing deeper knee flexion capabilities. In some instances, such systems and methods include a femoral knee replacement component that includes an articular surface, a first interior surface, and a second interior surface, wherein the first and second interior surfaces run substantially parallel to each other. In some cases, the articular surface includes an anterior condylar extension that is configured to replace an anterior articular cartilage of a femur such that the anterior extension is configured to terminate adjacent to a proximal limit of the anterior articular cartilage of the femur. Other implementations are also discussed.
US09107759B2	Facet arthoplasty devices and methods Surgically installed prostheses replace either the caudal portion of a natural facet joint, the cephalad portion of a natural facet joint, or both. The prostheses are readily attached to the pedicles of a vertebral body and support at least one element that defines an artificial facet joint structure. The caudal facet joint structure is sized and located to articulate with the cephalad facet joint structure. Together, the prostheses form a total facet replacement system. The system is suitable for use in virtually all levels of the spine.
US09107753B2	Method to relieve menstrual pain A method to relieve menstrual cramping which includes the step of placing one or more symmetrical tapered pads having an inner and outer side, each outer side being semi-rigid and each inner side being flexible and compressible. The outer side of each pad is affixed to one or more straps having a first and corresponding second end. A fastener is connected so to attach the first end of each strap to a corresponding second fastener at the second end of each strap as an additional step. The apparatus also includes a constricting device (such as a ratchet) located on or proximate to one pad sufficient to create a compression force through each strap when the first and corresponding second fasteners connect to one another.
US09107747B2	Soft intraocular lens and method of manufacturing the same There is provided a soft intraocular lens, comprising: an optical lens section 10 made of a foldable soft material; and a support arm section 20 formed so as to protrude outward from an outer peripheral edge of the optical lens section 10 for holding the optical lens section 10 in an eye, wherein a tip end part 22 of the support arm section 20 is made of a different kind of material which is harder than a soft material of other portion of the soft intraocular lens 1, and adhesiveness of the tip end part 22 of the support arm section 20 is set to be lower than the adhesiveness of other portion of the soft intraocular lens 1.
US09107745B2	Graft anchor system and method A graft anchor has first and second arms each having a leading end, a trailing end, an inner surface, and an outer bone contactable surface. The graft anchor also has a resilient bridge extending between the inner surface of the first arm and the inner surface of the second arm to space apart the first arm and the second arm. The resilient bridge defines a graft receiving pathway between the inner surfaces of the first and second arms. The resilient bridge also defines a deflection point about which a force acting upon the resilient bridge in a direction from the leading end to the trailing end causes the leading ends of the first and second arms to move toward one another and the trailing ends of the first and second arms to move away from one another.
US09107742B2	Removable stent-graft A stent-graft including a helically-wound stent component provided with a covering of graft material. It is removable from the site of implantation by gripping an end of the helically-wound stent component with a retrieval device and applying tension to the stent component. The use of such a retrieval device allows the stent-graft to be removed remotely, such as via a catheter inserted into the body at a different location from the implantation site. The design of the stent-graft is such that the stent component is extended axially while the adjacent portion of the graft separates between windings of the stent component. The axial extension of the stent component, with portions of the graft still joined to the stent component, allows the device to be unravelled and removed through a catheter of diameter adequately small to be inserted into the body cavity that contained the stent-graft.
US09107740B2	Vessel connector and kit having an applicator for surgery The invention relates to a vessel connector (10) for surgically connecting two vessels and/or prosthetics to each other, comprising a sleeve-shaped body (1), the walls of which are designed to be elastic, such that the force acting on the ligature or suture is limited to the extent that no pressure points or necroses occur in the vessel. It is made of two substantially rigid outer rings (2), delimiting the sleeve-shaped body, and webs (3) present between the rings, wherein at least regions of individual webs have a shape (4) deviating from a straight line over longer distances, and it has at least one ring-shaped region (5) of higher elasticity between the rigid rings. The connector provides a blood-tight connection of at least two natural or artificial vessels, including prosthetic connections, a prosthesis to a natural vessel, or two prostheses to each other. The vessel connection is possible much faster, more easily, and more securely with the novel mechanical connector than using conventional surgical circumferential sutures.
US09107739B2	Small diameter vascular graft produced by a hybrid method The present invention relates to a hybrid graft and methods of generating the hybrid graft. The hybrid graft comprises an exterior surface and a luminal surface. The luminal surface comprises a micropattern of grooves to which cells adhere and orient along. The exterior surface comprises electrospun microfibers wherein the microfibers provide mechanical properties to the graft. The hybrid graft is capable supporting endothelial cell attachment, endothelial cell alignment, cell proliferation, and maintaining their in vivo function. The graft of the invention can recapitulate the in vivo morphology and function of natural vascular endothelium.
US09107735B2	Hinge for knee joint orthoses, knee joint prostheses and/or braces A hinge for knee joint orthoses, prostheses and/or braces includes first and second hinge brackets overlappingly connected to each other at their ends so that with increasing angle therebetween, a combined rolling and sliding movement is effected in a plane defined by the two hinge brackets. Curves and guide elements at the overlapping ends of the hinge brackets interact such that with increasing angle therebetween, a combined rolling and sliding movement of the second hinge bracket is effected in the plane defined by the two hinge brackets in a direction which leads substantially radial to the axis of the first hinge bracket into the quadrant enclosed between the two hinge brackets, wherein the center of rotation of the two hinge brackets remains substantially stationary for an angle between the hinge brackets of between 0 and 25°.
US09107732B2	Method and apparatus for patterned plasma-mediated laser trephination of the lens capsule and three dimensional phaco-segmentation System and method for making incisions in eye tissue at different depths. The system and method focuses light, possibly in a pattern, at various focal points which are at various depths within the eye tissue. A segmented lens can be used to create multiple focal points simultaneously. Optimal incisions can be achieved by sequentially or simultaneously focusing lights at different depths, creating an expanded column of plasma, and creating a beam with an elongated waist.
US09107730B2	Optical coherence tomography and illumination using common light source A light source for a surgical system includes a broadband light source operable to produce broadband light. The light source further includes a wavelength splitter adapted to split the broadband light into illumination light having a spectral range covering at least a majority of the visible spectrum and surgical light having a spectral range outside of the spectral range of the illumination light. The light source then includes at least one surgical module adapted to control application of the surgical light. The light source also includes first and second coupling optics. The first coupling optics are configured to optically couple the illumination light to an illumination light guide for delivery to a first surgical probe. The second coupling optics are configured to optically couple the surgical light to a surgical light guide for delivery to a second surgical probe.
US09107728B2	Eyeball stabilizing apparatus and method of use An adjustable apparatus for stabilizing an eyeball suitable for use during surgical or transplant procedures is disclosed. Furthermore, an associated method is also provided.
US09107720B2	Surgical cable tensioning system A cable tensioning system includes a reaction frame which contains a sliding platform arranged to move linearly within the frame, and a clam-type cleat attached to the sliding platform. The cleat features one or more grooves, each of which comprises two arrays of opposing ridges that converge to form a V-shape groove adapted to receive a length of cable. The ridges of each groove are tilted relative to an axis perpendicular to the groove's longitudinal axis, such that the cable is progressively captured between the ridges of the opposing arrays as it settles into the crotch of the groove when moved in a first direction, and can be disengaged from the cleat by relaxing the axial force on the cable and moving it in the opposite direction. A linear actuator mechanism may be coupled to the sliding platform to move the platform with respect to the reaction frame.
US09107712B2	Bone plate system for hand fractures and other small bones A bone plate system for the internal fixation of metacarpal and phalanx fractures of the hand is provided. The plates are structured to permit independent reconfiguration of holes of the plates relative to a longitudinal axis and are configured to orient fasteners to interdigitate with holes displaced along the longitudinal axis. The plates are very thin, and a locking screw with a low profile head design is provided for use therewith.
US09107703B2	Apparatus and method for connecting surgical rods An exemplary apparatus for connecting surgical rods according the principles of the present disclosure includes an elongate first arm, an elongate second arm, and a clamping assembly. The elongate first arm includes a first end that couples with a first rod and a second end with a first engagement portion. The elongate second arm includes a first end that couples with a second rod and a second end terminating in a second engagement portion. The clamping assembly includes a passageway that slidably receives the first engagement portion and that retains the second engagement portion and an adjustment member offset from the passageway that adjusts a clamping force to restrict positioning of the second engagement portion relative to the first engagement portion.
US09107699B2	Bone tamp and methods of use A system comprises an inflatable bone tamp including a plurality of linearly aligned expandable bodies. The system further comprises an elongated tubular shaft extending through the plurality of linearly aligned expandable bodies. The elongated tubular shaft includes a shaft wall and an interior partition structure. The system further comprises a plurality of channels extending through the shaft, each of the channels formed by a segment of the shaft wall and the interior partition structure and each of the channels in communication with the respective one of the plurality of expandable bodies via openings in the shaft. Each of the expandable bodies is independently inflatable.
US09107697B2	System and method for selecting follicular units for harvesting A system and method for selecting follicular units for hair harvesting using imaging and processing techniques are provided. The method of selecting an order of harvesting follicular units is based on a combination of one or more policies and filters that are generally designed to improve a speed, quality and efficacy of the harvesting process. The method of the present invention may be implemented with various hair harvesting and transplantation systems, including manual, partially automated and fully automated systems.
US09107685B2	Electrosurgical device with disposable shaft having clamshell coupling A surgical device for operating on tissue comprises an end effector, a disposable shaft assembly, and an interface assembly. The shaft assembly comprises an articulation section operable to provide deflection of the end effector relative to the longitudinal axis of the shaft. The interface assembly comprises a plurality of pivotable base sections. The interface assembly comprises a plurality of drive components associated with drive shafts driven by an external system and each drive component is associated with a section of the base. The drive components are operable to cause rotation of one or both of the shaft or end effector and movement of components of the end effector. The drive components are further operable to cause articulation of the articulation section. The base sections are pivotable toward each other to couple with the shaft assembly or away from each other to disengage the shaft assembly.
US09107683B2	Systems and methods for cancellation of joint motion using the null-space Devices, systems, and methods are disclosed for cancelling movement one or more joints of a tele-surgical manipulator to effect manipulation movement of an end effector. Methods include calculating movement of joints within a null-perpendicular space to effect desired end effector movement while calculating movement of one or more locked joints within a null-space to cancel the movement of the locked joints within the null-perpendicular-space. Methods may further include calculating movement of one or more joints to effect an auxiliary movement or a reconfiguration movement that may include movement of one or more locked joints. The auxiliary and reconfiguration movements may overlay the manipulation movement of the joints to allow movement of the locked joints to effect the auxiliary movement or reconfiguration movement, while the movement of the locked joints to effect manipulation is canceled. Various configurations for devices and systems utilizing such methods are provided herein.
US09107681B2	Aortic dissection septal cutting tool The present invention relates to methods of using medical cutting tools for treating aortic septal dissections.
US09107674B2	Systems and methods employing a guidewire for positioning and stabilizing external instruments deployed within the body Systems and methods for treating a tissue region employ an expandable structure projecting beyond the distal end of a catheter tube. A distal tail projects beyond the far end of the basket assembly. The distal tail includes a guidewire lumen that accommodates passage of a guidewire without threading the guidewire through the catheter tube.
US09107672B2	Vessel sealing forceps with disposable electrodes A removable electrode assembly for use in combination with a forceps having opposing end effectors and a handle for effecting movement of the end effectors relative to one another. The electrode assembly includes a housing which is removably engageable with the forceps and a pair of electrodes which are attachable to a distal end of the housing. The electrodes are removably engageable with the end effectors of the forceps such that the electrodes reside in opposing relation relative to one another. The electrode assembly also includes a cover plate which is removably attachable to the housing and at least one stop member for controlling the distance between the opposing electrodes. The stop member is selectively engageable with the electrodes.
US09107670B2	Implant, especially for the occlusion of bifurcation aneurysms The invention relates to an implant (1) to be used for the occlusion of aneurysms in the region of vessel branches, in particular bifurcation aneurysms (A), with a mesh structure (3, 4), said implant comprising—from proximal to distal—sections (a) to (d) where (a) is a section tapering down proximally in which the mesh structure is brought together to form one or several coupling elements (10). (b) is a fixing section by means of which the implant can be supported on the to wall of a vessel, (c) is a permeable section for the region of the vessel bifurcation, and (d) is a distal section in which the implant is expanded in comparison to section (b) and which is intended for placement into the aneurysm (A), wherein a separation zone (T1, T2) being arranged in the area of sections (c) or (d).
US09107656B2	Internal suturing device leg suspension system and method of use A suture delivery device for insertion into an internal tissue wall opening and delivery of a suturing apparatus to the internal tissue wall is provided. In one embodiment, the suture delivery device comprises at least one carrier tube, at least one leg, and a tensioning device. The at least one carrier tube is configured to house a pusher and a suturing apparatus, the carrier tube having an expulsion end. The at least one leg is coupled to the at least one tube at a first end of the leg. The tensioning device is pivotally coupled to the at least one leg at a second end of the leg. When the at least one leg is in an open position, the tensioning device exerts tension on the leg such that the leg is movably suspended and can pivot about the tensioning device in response to contacting a tissue wall, and the pusher and suturing apparatus are in an delivery configuration for delivery of the suturing apparatus to the internal tissue wall.
US09107654B2	Attachment device for tissue approximation and retraction An attachment system for tissue apposition or manipulation and a method of attaching a suture to a tissue for apposition or manipulation of the tissue are provided. The system includes an attachment device including a body having a proximal portion and a distal portion. The attachment device further includes a tissue attachment portion operably connected to the distal portion wherein the tissue attachment portion has a shape that is maintained throughout a tissue apposition procedure. The attachment device also includes a suture operably connected to the body and having an unconnected proximal end and a retaining structure at the proximal portion of the body. The retaining structure configured to releasably mate with a complementary retaining structure on a stylet.
US09107653B2	Tensionable knotless anchors with splice and methods of tissue repair Systems and methods for soft tissue to bone repairs, without knot tying. The soft tissue repair systems include self-cinching constructs with a fixation device, a flexible strand and a shuttle/pull device attached to the flexible strand and provided within the body of the fixation device. A splice is formed by pulling on the shuttle/pull device subsequent to the fixation device being secured into the bone, to allow desired tensioning of soft tissue to be fixated or repaired relative to the bone.
US09107652B2	Sampling devices and methods An automated sample aspirating method in which a magnetic force is applied to a collection tube containing a sample carrier to move at least the top of the carrier to a location off the center axis of the collection tube. An aspirator is inserted into the tube at a vertical position along the sample carrier, and a fluid is aspirated from the tube. Also provided are a sample collector having a tip adapted to obtain a sample from a sample source, and a handle that extends from the tip and is magnetic at a location remote from the tip. Also provided is a sample processing system having a sample collector such as described above, a collection tube adapted to hold the sample collector with the tip at a closed lower end of the tube and the handle extending towards an open upper end of the tube, and a cap that seals the sample collector tip and at least a portion of the handle inside the tube. Also provided is a sample processing system having a sample holding rack having at least one opening adapted to hold one or more sample containers, a sample processing device adapted to move along a predetermined path into the one or more sample containers and process a sample contained therein, and one or more magnets adapted to displace an object in the one or more sample containers out of the predetermined path of the sample processing device.
US09107643B2	X-ray detector, X-ray detection system having the same, and X-ray detection method An X-ray detection system includes an X-ray generation device and an X-ray detector. The X-ray generation device includes an X-ray emission unit and a first sensor unit. The X-ray detector includes an X-ray reception unit for receiving X-rays from the X-ray emission unit, a data detection unit for detecting data from the X-ray reception unit, a second sensor unit, a computation unit for computing correction data using a distance between the first sensor unit and the second sensor unit, and a data correction unit for receiving a data signal from the data detection unit, receiving the correction data from the computation unit, and then generating corrected data.
US09107639B2	System for synchronously visualizing a representation of first and second input data A system for synchronous visualization of a representation of first input data and second input data in real time on single display unit is disclosed. The system comprises a control unit for receiving said first and second input data, said control unit being arranged for displaying a synchronous representation of said first and second input data on said display unit. A method for operating the system is also disclosed.
US09107637B2	X-ray imaging apparatus and wavefront measuring apparatus There is provided an X-ray imaging apparatus which images a specimen. The X-ray imaging apparatus comprises: an X-ray source; a diffraction grating configured to diffract an X-ray from the X-ray source; an X-ray detector configured to detect the X-ray diffracted by the diffraction grating; and a calculator configured to calculate phase information of the specimen on the basis of an intensity distribution of the X-ray detected by the X-ray detector, wherein the calculator obtains a spatial frequency spectrum from the plural intensity distributions, and calculates the phase information from the obtained spatial frequency spectrum.
US09107629B2	Spreading retractor A method for retraction useable in joint arthroplasty. The method includes using a joint retractor having a first arm and a second arm. The first arm has a first portion and a second portion and the second arm having a first portion and a second portion. The retractor is inserted into a surgical opening of a patient's shoulder joint. The second portion of the first arm is placed against the coracoid process and the second portion of the second arm is placed against the resected humerus. The first portions of the first and second arms are hung over the resected tissue to allow exposure of the glenoid.
US09107624B2	Methods and computer readable storage media for hyperspectral or multispectral imaging of multiple wavelengths A hyperspectral/multispectral imager comprising a housing is provided. At least one light source is attached to the housing. An objective lens, in an optical communication path comprising originating and terminating ends, is further attached to the housing and causes light to (i) be backscattered by the tissue of a subject at the originating end and then (ii) pass through the objective lens to a beam steering element at the terminating end of the communication path inside the housing. The beam steering element has a plurality of operating modes each of which causes the element to be in optical communication with a different optical detector in a plurality of optical detectors offset from the optical communication path. Each respective detector filter in a plurality of detector filters covers a corresponding optical detector in the plurality of optical detectors thereby filtering light received by the corresponding detector from the beam steering element.
US09107620B2	Hearing-ability measurement device and method thereof Provided is a hearing-ability measurement device and a method thereof for measuring a masking curve more correctly and in a shorter time.A test sound generation unit generates a test sound including a probe and a masker, and outputs the test sound from a test sound output unit. A perception examination unit examines whether or not the subject perceives the probe. An adjustment unit adjusts acoustic properties of the test sound, based on a result of the examination. Here, kinds of adjusted acoustic properties are different between the situation of prove perception success and the situation of prove perception failure. As a result, the masking curve is directly tracked and the measurement is performed more correctly and in a shorter time.
US09107617B2	Obtaining data for automatic glaucoma screening, and screening and diagnostic techniques and systems using the data A non-stereo fundus image is used to obtain a plurality of glaucoma indicators. Additionally, genome data for the subject is used to obtain genetic marker data relating to one or more genes and/or SNPs associated with glaucoma. The glaucoma indicators and genetic marker data are input into an adaptive model operative to generate an output indicative of a risk of glaucoma in the subject. In combination, the genetic indicators and genome data are more informative about the risk of glaucoma than either of the two in isolation. The adaptive model may be a two-stage model, having a first stage in which individual genetic indicators are combined with respective portions of the genome data by first adaptive model modules to form respective first outputs, and a second stage in which the first outputs are combined by a second adaptive mode. Texture analysis is performed on the fundus images to classify them based on their quality, and only images which are determined to meet a quality criterion are subjected to an analysis to determine if they exhibit glaucoma indicators. Also, the images are put into a standard format. The system may include estimating the position of the optic cup by combining results from multiple optic cup segmentation techniques. The system may include estimating the position of the optic disc by applying edge detection to the funds image, excluding edge points that are unlikely to be optic disc boundary points, and estimating the position of an optic disc by fitting an ellipse to the remaining edge points.
US09107615B2	Method and apparatus for body impact protection A motion analysis system includes: at least one orientation sensor configured to detect three-dimensional torso motion over time, the at least one orientation sensor including: a multiaxial accelerometer configured to detect acceleration in at least three orthogonal directions, and a gyroscope; and a controller configured to receive data from the at least one orientation sensor, the controller programmed to process the data to: determine at least one of a state and a transition of the torso; identify normal parameters for the determined at least one of the state and transition; and determine whether motion of the torso is outside the normal parameters. The controller is configured to identify, in real-time, the occurrence of a fall in progress of an individual from at least one of a standing state, a standing-to-seated transition, and a seated-to-standing transition.
US09107610B2	Optic neuropathy detection with three-dimensional optical coherence tomography Based on optical coherence tomography (OCT) imaging of a portion of an eye, a mask of an anatomical feature is derived. Using the mask as a reference, a scan path is determined that is at least partially fitted to and/or partially enclosing the mask. OCT scan data corresponding to the scan path is acquired and analyzed to detect optic neuropathies.
US09107603B2	Electronic endoscope system including a suppression section An electronic endoscope system includes a light source apparatus, a CCD, and a processor apparatus. The light source apparatus applies illumination light to a target portion. The target portion includes a surface blood vessel and a subsurface blood vessel. The CCD captures light reflected from the target portion. The processor apparatus generates an image based on an imaging signal from the CCD. The processor apparatus has a suppression processor. Out of the surface blood vessel and the subsurface blood vessel in an image, the suppression processor reduces contrast of a non-target blood vessel relative to that of a target blood vessel to suppress or reduce display of the non-target blood vessel relative to that of the target blood vessel.
US09107599B2	Electroanatomical mapping This invention relates to the determination and/or representation of physiological information relating to a heart surface.
US09107585B1	Tissue characterization using intracardiac impedances with an implantable lead system An implantable system acquires intracardiac impedance with an implantable lead system. In one implementation, the system generates frequency-rich, low energy, multi-phasic waveforms that provide a net-zero charge and a net-zero voltage. When applied to bodily tissues, current pulses or voltage pulses having the multi-phasic waveform provide increased specificity and sensitivity in probing tissue. The effects of the applied pulses are sensed as a corresponding waveform. The waveforms of the applied and sensed pulses can be integrated to obtain corresponding area values that represent the current and voltage across a spectrum of frequencies. These areas can be compared to obtain a reliable impedance value for the tissue. Frequency response, phase delay, and response to modulated pulse width can also be measured to determine a relative capacitance of the tissue, indicative of infarcted tissue, blood to tissue ratio, degree of edema, and other physiological parameters.
US09107581B2	Elastography device and method for determining and imaging of mechanical and elastic parameters of an examination object The present invention relates to a device for determining mechanical, particularly elastic, parameters of an examination object, comprising a) at least one arrangement for determining the spatial distribution of magnetic particles in at least one examination area of the examination object, comprising a means for generating a magnetic field with a spatial profile of the magnetic field strength such that there is produced in at least one examination area a first part-area having a low magnetic field strength and a second part-area having a higher magnetic field strength, a means for detecting signals which depend on the magnetization in the examination object, particularly in the examination area, that is influenced by a spatial change in the particles, and a means for evaluating the signals so as to obtain information about the, in particular temporally changing, spatial distribution of the magnetic particles in the examination area; and b) at least one means for generating mechanical displacements, in particular oscillations, at least in and/or adjacent to the examination area of the examination object. The invention furthermore relates to a method for determining mechanical and/or physical parameters of an examination object, in particular using a device according to the invention. The invention further relates to magnetic particle compositions that can be used in that method according to the invention.
US09107580B2	Device for measuring the activity of the spinal cord of a vertebra A measurement device for measuring activity of the spinal cord of a vertebrate. The device includes at least one main probe (1) shaped to be fastened to a spinous process (2) of a vertebra (3) and to hold in position on opposite sides of the vertebra at least one emitter (6) for emitting a wave capable of interacting with the spinal cord (7) and at least one associated receiver (8) for receiving the wave that has interacted with the spinal cord and for generating a signal representative of the activity of the spinal cord.
US09107579B2	Systems, methods and apparatus for powering devices using RF energy from a mobile transmitter In some embodiments, a personal area network (PAN) includes a mobile transmitter (e.g., a mobile or cellular phone) and one or more devices (e.g., sensors) that require power to operate (e.g., collect data). The mobile transmitter can be configured to transmit a sufficient amount of power (e.g., RF energy) to the one or more devices to power the one or more local devices. In addition to transmitting power, the mobile transmitter can be configured to communicate over a wireless network (e.g., a cellular network) as its primary function.
US09107577B2	Expandable inter vivos tube and method of manufacturing same A flexible expandable inter vivos tube includes at least one arched segmented portion, a corresponding movable element and at least one positioning mechanism. The at least one arched segmented portion and corresponding movable element forming a flexible closed longitudinally expandable tube. The at least one arched segment includes an H-shaped connector having at least one cavity that allows variable slidable movement of a free end portion of the corresponding movable element. A balloon is contained in each of the at least one cavity so that the hydraulic or air pressure within balloon expands the movable element and, thus, the circumference of the flexible inter vivos tube is increased.
US09107572B2	Surgical method utilizing transluminal endoscope and instruments A method of transluminal surgery is provided, which utilizes an endoscopic surgery apparatus having pivotable arms attached by hinges on its distal end. The arms are interchangeable with arms of various configurations. The method includes the steps of inserting an endoscopic surgery apparatus into a body cavity of a patient, making an incision in the body cavity wall to allow access to the patient's abdominal cavity, and further inserting the apparatus through the incision. Surgery is performed at the desired surgical site and the apparatus is withdrawn into the body cavity where the incision is closed. Finally, the apparatus is withdrawn from the patient's body.
US09107570B2	System and method for mapping anatomical structures and marking them on a substrate The present disclosure provides a method and system for mapping anatomical structures and marking them on an image to be printed on a substrate including the steps of inserting an imaging device into a surgical site, obtaining an image of a defect located in the surgical site from the imaging device, adjusting the image, transmitting the image to a printer, and printing the image on a substrate. The printed image may be a size directly proportional to the defect. The adjusting step may further include the steps of setting a minimum margin to be maintained between the perimeter of the defect and the perimeter of the substrate, selecting a shape and size of the substrate, and identifying at least one anatomical feature of the surgical site.
US09107550B2	Compact vacuum and sander A vacuum may include a housing, a filter, a motor-fan assembly, and a flue. The housing defines a chamber having a circular cross-section. The filter may have an annular shape and is disposed in the chamber of the housing. The motor-fan assembly includes a motor drivably coupled to a fan, such that the fan is mounted above the motor. The motor and the fan are enclosed in a casing, and the casing is disposed in an opening of the filter. The fan draws air into the chamber via the intake port and upward through the filter into the casing of the motor-fan assembly. The flue defines an exhaust path from the casing to the exhaust port, whereby air drawn into the casing is discharged via the flue outside the chamber of the vacuum.
US09107545B1	One piece shower pan and method of making same A one piece shower drain pan, encapsulated in a water proof membrane, and the method of fabricating the one piece open drain shower pan, the method which includes providing extruded polystyrene (XPS) foam of the type which absorbs very little water; shaping the section of extruded polystyrene foam with a CNC router to obtain the desired slope in the floor; cutting a hole in the foam to produce the drain hole; cutting a curb from the XPS foam and gluing the foam to a pan base on the open sides. Splash walls are then cut from concrete wall board and glued to the sides having no curb, so that the glue serves as a bonding agent and provides a waterproof seal between the parts; after the glue has cured, spraying the entire pan assembly with a polyurethane or polyurea coating to completely encapsulate the entire pan with a waterproof membrane, which provides strength and rigidity and defines a one piece drain pan ready for installation.
US09107541B2	Beverage maker having a lockable actuation rod The invention relates to a beverage maker, which comprises a container (10) that is open at the top thereof and a lid (20) that covers the container. A removal opening (29) is formed in the lid. A vertical actuation rod (41) passes through the lid. Inside the container, a preparing element (42), for example, a mixing element, is attached to the actuation rod. Outside the container, a grip element (45) is attached to the actuation rod. The grip element can be moved together with the actuation rod between a lower position and an upper position. A closure (30) can be swiveled about a horizontal swivel axis between a closed position that doses the removal opening and a retaining position that releases the removal opening, wherein in the retaining position, the closure fixes the grip element in the lower position thereof. The actuation rod is thereby effectively prevented from sliding out through the removal opening when the beverage is removed.
US09107539B2	Food processor A food processor includes at least two different types of blades to process foods. A processing assembly includes a shaft, a set of pureeing blades attached to the shaft, and a set of substantially horizontal blades attached to the shaft. Each substantially horizontal blade may have a rearwardly curved leading cutting edge. The substantially horizontal blades are positioned higher with a food processing container than the pureeing blades. In some embodiments, upwardly angled blades may be included to induce vertical circulation and/or vorticial flow of the processed food.
US09107532B2	Spray dispensing device One exemplary aspect comprises a juice extractor having a top portion and a bottom portion that is inserted into a skin of a fruit, the juice extractor containing a cavity for collecting juice directly from the fruit, said bottom portion having an external surface with a plurality of openings through which pulp and seeds larger than each of said plurality of openings do not pass and juice flows and collects in said cavity; and a spray dispenser comprising a top portion and bottom portion, and comprising a spray pump partially disposed within and extending from the top portion of the spray dispenser, the bottom portion of the spray dispenser detachably coupled with the top portion of the juice extractor, the spray pump comprising a tube having a lower end disposed within the cavity and terminating within a void enclosed by said external surface, for collecting juice directly from the fruit.
US09107529B2	Adjustable tension-mounted curved rod assembly An adjustable rod assembly includes first and second tubes having first and second arcuate portions, third and fourth tubes of generally straight configurations, first and second end supports, and a tension rod mechanism secured within the third tube. The first tube has a first end, a second opposing end, and a planar surface extending from the second end toward the first end. The first tube is telescopingly received within the third tube and the second tube. The third tube is rotatable relative to the first tube and is rotatably secured within the fourth tube. The fourth tube is secured to the first end support and the second tube is secured to the second end support. The tension rod mechanism rotates with the third tube and has a threaded portion configured to extend from an interior of the third tube to an interior of the first tube.
US09107522B1	Disposable dish with integral trash bag A disposable dish with integral trash bag devised includes a biodegradable food-receiving element, such as a plate, and a biodegradable disposable cover for the food-receiving element for storage, protection against insects, and reduction of waste. An elastomeric outer edge on the cover continuously releasably attaches to an underside of an outer perimeter of the food-receiving element. A fastener, such as an adhesive, a is disposed on the underside of the outer perimeter. The outer edge is further releasably attached to the fastener. In an unexpanded condition, the cover is removably disposed on and has close-fitting contact with only the bottom surface of the food-receiving element and conforms to the bottom surface to avoid increasing bulk to the food-receiving element. The cover is transformed from the unexpanded condition to an expanded condition to cover only the entire food-receiving element and a food product contained therein.
US09107521B2	Enhanced serving apparatus A technique for allowing the convenient and orderly withdrawal of contents is disclosed. An apparatus according to the technique may include a container which includes an enhancement at the rim of the container. The enhancement provides the functionality to move edible and/or inedible substances onto objects. In one example, the enhancement may protrude inwardly as a smoothed surface that may push substances onto objects as the objects are removed from the container.
US09107520B1	Picture frame hanger A frame which has a wire extending across a rear of the frame is hung on a wall by an integral flexible spring member shaped to define a center mounting plate fastened to lie flat on the wall and a spring strap standing at right angles to the plate with a pair of arms each extending outwardly from the mounting plate along the wall to a respective side of the mounting plate. The arms receive and locate the wire extending along the arms and depending from ends of the arms to the sides of the frame. The arms can flex and the arms allow longitudinal movement of the wire along the arms to allow movement of the frame side to side relative to the mounting plate. A stiffening rod can be inserted onto the strap.
US09107519B2	Portable sleeping assembly A portable sleeping assembly includes a mat member having a top and a bottom and four sides. The sleeping assembly also includes a blanket secured to the mat member along two adjacent sides of the mat member, a pillow pocket secured to the top of the mat member, and a pair of spaced storing straps secured to the bottom of the mat member.
US09107517B1	Foldable display support stand A foldable display support stand is foldable easily and readily into a folded collapsed condition. The stand has a foldable pedestal panel foldable in a horizontal to maintain the stand in a stable erected condition. A pivotal brace extending between the front panel and the rear panel is operative to an extended condition to push the side panels outwards in the erection of the stand, and they are pullable outwards and downwards to initiate the folding operation together with the folding of a pedestal panel upwards to fold the stand into a folded collapsed condition. An elastic cord is connected between the rear panel and the pedestal panel to facilitate the automatic erection of the folded stand to the erected condition.
US09107513B2	Baby walker system with a braking mechanism for movement control The various embodiments herein provide a baby walker with braking mechanism to control a movement of the baby walker from moving into dangerous areas. The baby walker comprises a sensor unit, a wave transmitter system, a braking system and a power supply unit. The sensor unit is configured to sense an obstacle in the way of walker. The wave transmitter system, in communication with the sensor unit, is configured to generate signals on sensing the obstacle. The braking system, in communication with the wave transmitter, is configured to control movement of the walker upon reception of signals from the wave transmitter. The power supply unit is configured to supply electric power to the sensor unit, the wave transceiver the braking system.
US09107512B2	Cushioning support device and method of making the same A cushioning support device and a method for making the same are disclosed. The device comprises a first polyurethane foam having a non-slip sheet attached on a surface of the first foam, a second polyurethane foam having a resting sheet attached on a surface of the second foam, and a compound pressure-redistributing body. The first and second polyurethane foams are arranged one over another into a stack which is welded and envelops to form at least an internal pocket along a weld line. The internal pocket houses the pressure-redistributing body, and it comprises a foam and a solid gel attached on a top surface of the foam, wherein the solid gel is securely positioned by way of melting. Dips of the gel can lodge into the small interstices of the foam material during the melting process; the gel gets into a solid state after solidification.
US09107509B2	Mattress supporting system with headboard attachment A folding mattress support system replaces a conventional bed frame with rails and the box spring. The mattress support system is lighter, easier to transport, and provides more storage space beneath the mattress. The mattress support system includes bed frame assemblies, central connecting bars, edge attachments, headboard attachments and a bed skirt. Leg supports fold out from the bed frame assemblies, which themselves unfold in the middle. Central connecting bars connect inner side edges of the bed frame assemblies. Plastic edge attachments are attached at outer corners of the bed frame assemblies and hold a bed skirt taut when the frame assemblies are standing on extended leg supports. A mattress is then placed on top of the assembled mattress support system. Optionally, metal edge attachments at the head corners hold both the bed skirt and a headboard. Alternatively, headboard attachments protrude from under the bed skirt and support a headboard.
US09107504B2	Reclining loop frame stacking / swivel chair A chair with a seating surface and a link with two ends connected to the seating surface. A frame with two supporting portions connected to the link and the frame can displace against a bias to allow one of the two supporting portions to move, allowing the seating surface to tilt. A flexible front is attached to a front member on the frame, the flexible front bends when the seating surface tilts. The link rotates when the supporting portions displace. The supporting portions are round and pass through round holes in the link, allowing the supporting portions to rotate within the link when the seating surface tilts. A stop connected to the seating surface and a stop connected to the frame limits the maximum tilt angle of the seating surface.
US09107502B2	Surgical screw rack A rack for holding at least one surgical screw is described. The rack comprises a body in which at least one bore is provided and at least two support elements surrounding the bore. The support elements protrude from a first level defined on or in the body and are configured to support the screw head on a second level above the first level. The support elements are spaced apart from each other to define spaces therebetween for enabling fluid communication between the surface and the bore. Further, a system is described comprising the above mentioned rack and one or more surgical screws accommodated in the rack.
US09107494B2	Refrigerator with a lift mechanism including at least one pivot arm A refrigerator is provided including a refrigerator compartment having a bin door. A storage bin is positioned within the refrigerator compartment. A lift mechanism is positioned within the refrigerator compartment. The lift mechanism includes a bin support structure configured to support the storage bin. The lift mechanism further includes at least one pivot arm pivotally attached to the bin door, and a drive unit attached to the bin door. The drive unit applies a vertical force to the at least one pivot arm, and rotation of the at least one pivot arm vertically moves the bin support structure and storage bin.
US09107487B2	Mascara brush A reservoir and application device including an applicator having a stem and a brush at the end of this stem, the brush presenting a largest transversal dimension between 9 and 14 mm, the brush being at least 30% wider than it is thick in cross section, a reservoir containing the product to be applied, having a wiper member defining a wiper orifice traversed by the brush when it is removed from the reservoir, the diameter of the wiper orifice being between 2.5 and 5.5 mm.
US09107484B2	Electronic device enclosure An enclosure for an electronic device includes a device opening and a device window. The enclosure typically includes a door that may be rotated about an axis to provide access to the device opening while remaining connected to the enclosure. Exemplary enclosures include a slot for a magnetic card reading system that facilitates the alignment and insertion of a magnetic card.
US09107483B2	Bag with reinforcing seam tape A bag with reinforcing seam tape is provided. The bag has a bottom, at least two sides, and at least two ends formed from textile panels; the textile panels are joined by seams. A reinforcing seam tape adheres to at least a portion of the seam. The reinforcing seam tape is made of thermoplastic polyurethane having a thickness between 0.3 millimeters and 0.8 millimeters. At least one face of the seam tape may have a cross-sectional shape that provides structural support to the bag.
US09107479B2	Adjustable last An adjustable last that may be inserted into an article includes provisions so that the position of an adjustable portion of the adjustable last can be changed according to the size of the article. In some embodiments, the adjustable last includes an inflatable member that can be filled with fluid according to the size of the article, and may be used to adjust the size of the article. Other embodiments do not include an inflatable member. The adjustable last can include an adjustment assembly for adjusting the adjustable portion. The adjustment assembly can include a wedge member.
US09107472B2	Orthotic foot device with removable support components and method of making same An embodiment of footwear having the orthotic foot device and method of making it is disclosed herein. The device provides support for the foot when used in footwear, in certain regions of the foot such as in the arch and metatarsal regions, in a manner that is very comfortable and yet supportive to the wearer. The embodiment of the orthotic foot device may provide at least one secure, but easily adjusted support component for a region of the foot such as the arch and metatarsal regions. The support component may be removably attached to a cushioned supportive footbed or chassis to provide an increased walking/running comfort and performance. It will become apparent to those skilled in the art that at least one of the support components may be fixedly or integrally attached to the footbed or chassis.
US09107470B2	Article of footwear for dancing An article of footwear with a pivot portion including a plurality of flex grooves is disclosed. The plurality of flex grooves provides increased flexibility in different portions of a sole of the article. In addition, a periphery of the sole includes sole pods to increase the traction on the periphery of the sole.
US09107464B2	Quick release device for safety helmet A quick release device comprises an anchor to couple to a safety helmet and a latch to couple to a tether. The anchor may include a cylindrical wall with an indentation circumferentially located thereon. The latch is configured to be attached to and removed from the anchor and may include a barrel, a plurality of ball bearings, and a push-pull button. The barrel may include a sidewall in which the ball bearings are rigidly retained when the latch is in a locked state and the ball bearings are loosely retained when the latch is in a released state. The push-pull button may cover one end of the barrel and may be pushed to attached the latch to the anchor and pulled to remove the latch from the anchor.
US09107462B1	Textile pattern optimization based on fabric orientation and bias characterization Aspects of the present disclosure provide computer implemented techniques to generate textile patterns that are optimized according to a predicted fabric behavior in different orientations. By orienting a “bias” of a fabric based on a number of textile panels being produced from the fabric, the textile panels can be configured to take full advantage of the fabric's properties. Orientation parameters for positioning the panels may be calculated to maximize the number of panels that can be cut from the fabric. Automatic adjustments may be made to the parameters by analyzing the fabric's constraints. The user can also input these constraints and an amount of desired stretch in specific areas of the fabric. A mechanism may also be employed to create a 3D model covered by the fabric in order to further adjust the fabric's orientation.
US09107458B1	Tie clip system The present invention relates to a system for clipping a necktie to a dress shirt. The system includes a necktie and a clip that attaches to a loop on the rear portion of the necktie. The clip has a front prong that passes through an aperture in the necktie loop and a rear prong that is placed behind a panel of the dress shirt. The tie clip allows the necktie to lie vertically (not crooked) along the dress shirt and is hidden from view when in use.
US09107455B2	Cigarette filter A cigarette filter containing a mesoporous silicate molecular sieve modified by an aminoalkylsilyl group. The modified molecular sieve reacts with selected components of cigarette smoke to remove or reduce the concentration of the components without adversely affecting desirable flavor constituents of the smoke. The modified molecular sieve preferably is SBA-15, MCM-41 or MCM-48 modified by 3-aminopropylsilyl groups. The modified molecular sieve may be incorporated into the filter by inclusion into a space therein or into one or more of the filter elements or into a fibrous component.
US09107451B2	Coating composition for the dip coating of capsule halves A coating composition for the enteric coating of capsule halves made of water-soluble or water-swellable polymer material in a dipping process is provided. The composition is an aqueous dispersion or solution, containing a polymer mixture of at least one first (meth)acrylate copolymer, which is enteric, and at least one further (meth)acrylate copolymer, which is enteric or water-insoluble, and also auxiliaries which influence the viscosity of the dispersion and the elasticity of the dried polymer film. The solids content of the dispersion or solution is more than 25% by weight and the viscosity is 150 to 1500 mPa·s and a dried film produced from the dispersion or solution has an elongation at break of at least 200%. Also provided is a capsule composed of two capsule halves coated with the dispersion or solution in a dipping process does. The enteric capsule does not dissolve in 0.1 N HCl at pH 1.2 after two hours, but completely dissolves in buffer at pH 6.8 in less than 30 minutes. A method to prepare enteric coated capsule halves is also provided.
US09107447B2	Xyloglucan extraction process The specification provides methods for extracting xyloglucans from fruit, especially from firm fruit such as cranberries, through a sequential extraction procedure.
US09107446B2	Solubilizates of preservatives and method for producing the same Described is a solubilizate of a preservative containing an aliphatic and/or aromatic acid such as sorbic acid and/or benzoic acid that is free of stabilizing agents, as well as one or more emulsifiers with an HLB value between 9 and 18 with a concentration of about 50% and about 95% emulsifier with regard to the total quantity of the solubilizate, and a procedure for the production of such a solubilizate.
US09107440B2	Polypeptides having transgalactosylating activity The present invention relates to polypeptides, specifically polypeptides having transgalactosylating activity and nucleic acids encoding these, and their uses in e.g. dairy product.
US09107439B2	Lipid compositions for the treatment of gastro-intestinal disorders and the promotion of intestinal development and maturation The present invention provides a use of a lipid composition for the preparation of a nutritional, pharmaceutical or nutraceutical composition or a functional food, for the prevention and treatment of gastrointestinal diseases and disorders, and for promoting intestinal development, maturation, adaptation and differentiation.
US09107433B2	Enzyme granules The stability of enzymes in a powder detergent can be very significantly improved by the combination of four measures: Addition of reducing agent/peroxide decomposing catalyst/antioxidant to the core or the coating; Addition of a multivalent cation to the core; Addition of an acidic buffer to the core or to the coating; Applying a salt coating onto the core.
US09107428B2	Fractionated soybean protein material, processed soybean suitable for the material, and processes for production of the soybean protein material and the processed soybean Disclosed is a process for fractionating soybean protein into 7S globulin, 11S globulin or a lipophilic protein at a high purity with good efficiency, which relates to a fractionation technique for soybean protein into proteins having characteristic properties (7S globulin, 11S globulin and a lipophilic protein) and which is a process practicable at a food industrial level. It is found that soybean protein can be fractionated into 7S globulin, 11S globulin or a lipophilic protein at a high purity with good efficiency by extracting soybean milk from processed soybean which has been subjected to a water-insolubilization treatment specific to a desired protein and fractionating the resulting soybean milk or soybean curd refuse into the desired protein.
US09107420B2	Animal shampoo An animal shampoo that can be used for washing animals or for topical treatment to areas that are occupied by animals including soap, water, vinegar, epazote and glycerin (or olive oil) is taught. Other optional ingredients and variations of the primary ingredients are also disclosed.
US09107415B2	2-(substituted-phenyl)-cyclopentane-1,3-dione compounds, and derivatives thereof The present invention relates to a compound of formula (I): wherein: X is methyl or chlorine; R1 is methyl or chlorine; R2 is hydrogen, methyl, ethyl, n-propyl, cyclopropyl, vinyl, ethynyl, fluorine, chlorine, bromine, methoxy, ethoxy or fluoromethoxy; and G, R3, R4, R5 and R6 are as defined herein; wherein the compound of formula (I) is optionally present as an agrochemically acceptable salt thereof. These compounds are suitable for use as herbicides. The invention therefore also relates to a method of controlling weeds, especially grassy monocotyledonous weeds, in crops of useful plants, comprising applying a compound of formula (I), or a herbicidal composition comprising such a compound, to the plants or to the locus thereof.
US09107414B2	Tetrazol-5-yl- and triazol-5-yl-aryl compounds and use thereof as herbicides Tetrazol-5-yl- and triazol-5-yl-aryl compounds of the general formula (I) as herbicides are described. In this formula (I), X, Z, W and R are radicals such as hydrogen, organic radicals such as alkyl, and other radicals such as halogen. A and B are N and CY. Q is cyanoalkylcarbonyl or isoxazolyl.
US09107413B2	Pesticidal compositions and processes related thereto This document discloses molecules having the following formulas (“Formula One” & “Formula Two” and “Formula Three”) The Ar1, Het, Ar2, R1, R2, R3, R4, and R5 are further described herein.
US09107409B2	Physical mode of action pesticide A physical mode of action pesticide for application on plants and in soils, and methods of manufacture and application, comprising an active ingredient in the form of a polymer in a concentration of less than 0.1% wt., a surfactant, a co-solvent and a diluent in a hydrocolloid suspension. The suspension polymer is preferably a polysaccharide having a molecular weight of 10,000 to 25,000,000, and preferably in the range of about 600,000. The pesticide preferably also includes a targeting ingredient for directing the active ingredient to a particular target.
US09107407B2	Grease-like gel for repelling insects and preventing undesirable behavior in hoofed animals Grease-like compositions are provided for repelling insects and preventing undesirable behavior in hoofed animals. The compositions utilize nontoxic mineral, synthetic, or vegetable oil based gels containing silica, clay, urea, polytetrafluoroethylene, or metallic soap thickeners and capsaicin.
US09107396B2	Stabilized synthetic brood pheromone and race-specific ratios of components for manipulating the behavior and physiology of honey bees This invention relates to a 10-component stabilized synthetic honey bee brood pheromone and methods of stabilizing said pheromone by adding one or more antioxidants, thereby enabling the production and sustained use of commercial products based on that pheromone. The 11-component stabilized pheromone composition formed by adding the antioxidant tertiary-butyl hydroquinone to a synthetic blend of ethyl linoleate, ethyl linolenate, ethyl oleate, ethyl palmitate, ethyl stearate, methyl linoleate, methyl linolenate, methyl oleate, methyl palmitate and methyl stearate can be used in generic or race-specific ratios to manipulate the behavior and improve the performance of worker honey bees, resulting in overall increased vigor of the hive.
US09107394B2	Dual dog leash The present invention to provides a dual leash for walking two dogs with a single compact leash while preventing entangling of the individual cables. Horizontal positioning of the spools achieves a more compact design as well as a new way to combine the rotation of the housing with a lock feature. The key to a compact design is to maximize the spool size for proper spring steel retraction functionality and maximization on cord length. Preferably, the companion animal is a canine. Another object of the present invention is to provide individual cable retraction with a non-entangle feature.
US09107393B2	Structure of a handle for a retractable leash A structure of a handle for a retractable leash comprises a holding piece; the holding piece is formed integrally as one piece by soft gel; a housing of the retractable leash is an assembly of a left housing and a right housing; the holding piece is fitted between the left housing and the right housing.
US09107391B1	Multiple pet leash holding device The multiple pet leash holding device is a device that is adapted to hold multiple pet leashes simultaneously and in an untangled arrangement so that a pet walker can walk multiple pets simultaneously. The device is constructed of non-moving parts, and includes a grip member perpendicularly oriented with respect to a support member. A distal end of the support member includes leash holder members that extend laterally therefrom, and onto which the looped end of multiple pet leashes may be placed. Each leash holder member includes a first holder member that is perpendicularly oriented on a distal end of the leash holder member. The first holder member includes a second holder member acutely oriented at a first distal end in order to prevent unintended separation of the looped end of the pet leashes there from.
US09107389B2	System and method for treating pets A system and method for treating pets, the system comprising: a content provider to provide video and audio content adapted for treating a pet; a video and audio output device for playing the video and audio content; and a feedback interface for providing indications to the content provider about behavior of the pet, wherein the content provider is to adapt the provided content according to the received indications. The method comprising playing video and audio content by a video and audio out-put device, the content comprising: an image adapted for treating a pet; and a sound adapted for treating a pet; receiving indications about behavior of the pet; and adapting the played content according to the received indications.
US09107387B1	Portable dog pen assembly A portable dog pen assembly facilitates transport and temporary installation of an enclosure for an animal. The assembly includes a series of panels defining a sheet of material. Tubes are provided including medial tubes and end tubes. Each medial tube is positioned between an associated adjoined pair of the panels and each end tube is coupled to and extends along a free end of the sheet of material. Looped ends of stabilizer bars are alignable with a selectable one of the tubes to extend each stabilizer bar along a top edge of an associated one of the panels. Each of a plurality of posts is insertable through an associated one of the looped ends and the tubes and engages a ground surface such that the post extends upwardly from the ground surface. A connector couples the end tubes together such that the sheet of material forms an enclosure.
US09107381B2	Liquid-permeable panel A liquid-permeable panel that is of a system toilet for animals and that can prevent urine wetting resulting from torsion or folding over of a pee pad. The liquid-permeable panel covers the excrement containment section of the system toilet for animals. Of the aforementioned panel, the side-surface 1 cm compression deformation load, which is the load necessary for at least 1 cm of torsion to arise with respect to load from the side-surface direction that is perpendicular to the direction of thickness of the panel, is at least 5 N and no greater than 20 N. Preferably, the liquid-permeable panel has a plurality of holes that penetrate the liquid-permeable panel in the direction of thickness, and has as a material corrugated cardboard in which liquid goes through the aforementioned plurality of holes, passing through in the direction of thickness of the aforementioned liquid-permeable panel.
US09107370B2	Soybean variety A1036375 The invention relates to the soybean variety designated A1036375. Provided by the invention are the seeds, plants and derivatives of the soybean variety A1036375. Also provided by the invention are tissue cultures of the soybean variety A1036375 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety A1036375 with itself or another soybean variety and plants produced by such methods.
US09107365B2	Soybean cultivar GO1010146 The present invention is in the field of soybean variety GO1010146 breeding and development. The present invention particularly relates to the soybean variety GO1010146 and its progeny, and methods of making GO1010146.
US09107363B1	Soybean variety XBP02003 A novel soybean variety, designated XBP02003 is provided. Also provided are the seeds of soybean variety XBP02003, cells from soybean variety XBP02003, plants of soybean XBP02003, and plant parts of soybean variety XBP02003. Methods provided include producing a soybean plant by crossing soybean variety XBP02003 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety XBP02003, methods for producing other soybean varieties or plant parts derived from soybean variety XBP02003, and methods of characterizing soybean variety XBP02003. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety XBP02003 are further provided.
US09107360B1	Hybrid corn variety 1768536 The invention provides seed and plants of the hybrid corn variety designated 1768536. The invention thus relates to the plants, seeds and tissue cultures of the variety 1768536, and to methods for producing a corn plant produced by crossing a corn plant of variety 1768536 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety 1768536.
US09107356B2	Hybrid carrot variety NUN 85931 The present invention relates to plants of a carrot variety NUN 85931 and seeds and progeny thereof. The invention further relates to methods for producing a carrot plant by traditional breeding methods. The invention further relates to a method for producing a carrot plant containing in its genetic material one or more transgenes.
US09107353B1	Snap on cloning mold for air layering of plants A time saving snap on cloning mold for use in cloning a plant by air layering. The mold has a reservoir for storing liquid to keep the rooting medium in the air layer moist by wicking of the liquid throughout a long period of root development. The cloning mold quickly snaps on the branch that is being air layered. The reservoir is effective when the mold is used on both branches that are growing with an upward tilt and those growing with a downward tilt.
US09107350B2	Mollusk barrier A barrier for deterring slugs, snails, and other gastropod mollusks from entering an area, and a method for using the same are provided. The barrier includes an elongate tubular support having a plastically deformable core member and an outer sheath. A plurality of outwardly extending projections are attached to the tubular support.
US09107347B2	Knotter mechanism for crop balers and the like Knotter operation on a crop baler or the like is controlled electronically by a programmable electronic control unit. Rotary and/or linear electric, hydraulic, or pneumatic drive motors are utilized to drive the knotting components and are controlled by the electronic control unit.
US09107346B2	Wrapping device The invention relates to a wrapping device to wrap an object in foil material including a frame, a wrapping table mounted on the frame and configured to support the object during wrapping, one or more roll support devices to support one or more rolls of foil material to be rotated about the object during wrapping, a carrying structure mounted on the frame and configured to carry the one or more roll support devices, and a clamping and cutting device to clamp the foil material after wrapping of an object, and to cut the clamped foil material, wherein the clamping and cutting device is mounted on the carrying structure, and wherein the carrying structure is pivotable about a substantially horizontal pivot axis with respect to the frame.
US09107345B2	Method of remotely configuring a residue system of an agricultural harvester A shifting method for an inline shaft system of a chopper system of an agricultural harvester is described and illustrated. The method includes the steps of detecting, temporarily rotating and engaging. The detecting step detects a failure to properly engage a shift collar with a splined component. The temporarily rotating step temporarily rotates the inline shaft system. The engaging step engages the shift collar with the splined component.
US09107344B2	Control system of agricultural vehicle with goods carrier, agricultural vehicle, and method of controlling goods carrier of agricultural vehicle A control system controlling a goods carrier of an agricultural vehicle for conveying goods to a target area, has a 3D imaging device providing frames imaging the target area, a data processor and a memory. The control system derives information from the frames and operates to obtain a reference frame comprising 3D information about the pose of the target area, identify a plurality of characteristic points of the target area in the reference frame, obtain a new frame, analyze the new frame to identify a plurality of characteristic points, search and match characteristic points in the reference frame and the new frame, analyze pairs of matched characteristic points to establish a group of pairs showing a common change of pose between the reference frame and the new frame, and provide a signal taking into account results of the latter analysis.
US09107341B2	Monitoring and control of soil conditions Various methods and systems are provided for monitoring and control of soil conditions. In one example, among others, a method includes obtaining aqueous samples from suction probes within a soil substrate and analyzing the aqueous samples to determine a chemical composition of the soil substrate. Amounts of an additive may be determined to adjust the chemical composition of the soil substrate. In another example, a method includes installing a suction probe within a soil substrate; drawing a vacuum to induce hydraulic conduction of aqueous solutions from the soil substrate; extracting an aqueous sample; and analyzing the aqueous sample to determine a chemical composition of the soil substrate. In another example, a method includes obtaining a composition of a fertilizer solution (FS) supplied to a soil substrate and a chemical composition within the soil substrate; determining nutrient utilization, and providing an amount of additive to produce a subsequent FS for supply.
US09113583B2	Electronic circuit board, assembly and a related method thereof An apparatus includes a substrate and a plurality of conductive traces formed on the substrate. The conductive traces are doped with a concentration of an aluminum material forming a protective layer as a portion of the plurality of conductive traces to inhibit oxidation. A set of first metal contact pads are formed in contact with the plurality of conductive traces. The substrate, the plurality of conductive traces and the set of first metal contact pads define an electronic circuit board configured to operate at a temperature greater than 200 degrees Celsius. A high operating temperature electronic device is configured in electrical communication with the conductive traces defining an assembly configured to operate at a temperature greater than 200 degrees Celsius.
US09113577B2	Method and system for automotive battery cooling A battery-cooling system includes a battery array and a plurality of heat pipes that each include a low-profile extrusion having a plurality of hollow tubes formed therein A heat transfer fluid is disposed in the plurality of hollow tubes. Each heat pipe includes an evaporator portion and a condenser portion. The evaporator portion is disposed between successive batteries within the battery array and the condenser portion is disposed outside of the battery array and exposed to a heat sink.
US09113569B2	Wiring board and method for manufacturing same A wiring board includes a core structure having a first surface and a second surface on the opposite side of the first surface, a first buildup structure formed on the first surface of the core structure and including insulation layers, and a second buildup structure formed on the second surface of the core structure and including insulation layers and an inductor device. The insulation layers in the second buildup structure have the thicknesses which are thinner than the thicknesses of the insulation layers in the first buildup structure, and the inductor device in the second buildup structure is position on the second surface of the core structure and includes at least a portion of a conductive pattern formed in the core structure.
US09113555B2	Apparatus for differential far-end crosstalk reduction A method of reducing crosstalk. The method may include forming a first contact over a first vertical conductor. The method may include forming a second contact over a second vertical conductor. The method may include forming a capacitive coupler between the first contact and the second contact, wherein the capacitive coupler is to cancel crosstalk received at the second vertical conductor from the first vertical conductor.
US09113543B2	Device and use of the device for measuring the density and/or the electron temperature and/or the collision frequency of a plasma The invention relates to a device and method for measuring the density of a plasma by determining an impulse response to a high-frequency signal coupled into a plasma. The density, electron temperature and/or collision frequency as a function of the impulse response can be determined. A probe having a probe head and a probe shaft can be introduced into the plasma, wherein the probe shaft is connected to a signal generator for electrically coupling a high-frequency signal into the probe head. The probe core is enclosed by the jacket and has at its surface mutually insulated electrode areas of opposite polarity. A balun is arranged at the transition between the probe head and an electrically unbalanced high-frequency signal feed to convert electrically unbalanced signals into balanced signals.
US09113542B2	Method for temperature stabilization, X-ray detector and CT system A method is disclosed for the temperature stabilization of a direct-converting X-ray detector, including a detector surface having a semiconductor and being divided into a plurality of partial detector surfaces. During the irradiation of the detector surface, heat is generated in the semiconductor by electric power. Electric power generated in the semiconductor is kept constant for each partial detector surface at least during a heterogeneous and/or temporally variable irradiation of the detector surface by feeding-in power-adjusted additional radiation for each partial detector surface. A direct-converting X-ray detector is disclosed for the detection of X-rays. At least one control loop with at least one reference variable is embodied for the energy regulation of the additional radiation, which keeps the temperature in the semiconductor constant for each partial detector surface by keeping the electric power in the semiconductor constant by changing the energy of the additional radiation. A CT system is disclosed.
US09113536B2	Electroluminescent device The present invention relates to electroluminescent devices that comprise organic layers that contain triazole compounds of the formula (I), or formula (II). The compounds are suitable components of, for example, blue-emitting, durable, organo-electroluminescent layers. The electroluminescent devices may be employed for full color display panels in, for example, mobile phones, televisions and personal computer screens.
US09113530B2	Lighting device, illumination device, illumination apparatus and illumination system A lighting device includes an AC to DC conversion unit for receiving a setting signal and converting it into a DC voltage having a predetermined voltage, voltage conversion units for converting the DC voltage inputted from the AC to DC conversion unit and driving the light source modules according to drive signals, a PWM signal generating unit for generating a PWM signal having a duty ratio corresponding to the setting signal, and a control unit, by outputting the drive signals to the voltage conversion units based on a command value determined according to the duty ratio, for controlling output powers of the voltage conversion units such that a characteristic curve of the sum of the output powers of the voltage conversion units has the maximum or at least one inflection point within an adjustment range of the conduction angle.
US09113524B2	LED light source A series arrangement of LED loads (LP1-LP4) is coupled between output terminals of a rectifier having its input terminals coupled to a mains supply supplying a low frequency AC voltage. Control means render the LED loads conductive one by one, when the amplitude of the supply voltage increases, and non-conductive one by one when the amplitude of the supply voltage decreases. The first LED load (LP1, LP2) has a forward voltage that is substantially higher than that of the other LED loads. As a consequence, the LED utilization is comparatively high, thus allowing the LED loads used in the series arrangement to be comparatively cheap.
US09113521B2	Load control device for a light-emitting diode light source A load control device for controlling the intensity of a lighting load, such as a light-emitting diode (LED) light source, may include a power converter circuit operable to receive a rectified AC voltage and to generate a DC bus voltage, a load regulation circuit operable to receive the bus voltage and to control the magnitude of a load current conducted through the lighting load, and a control circuit operatively coupled to the load regulation circuit for pulse width modulating or pulse frequency modulating the load current to control the intensity of the lighting load to a target intensity. The control circuit may control the intensity of the lighting load by pulse width modulating the load current when the target intensity is above a predetermined threshold and control the intensity of the lighting load by pulse frequency modulating the load current when the target intensity is below the predetermined threshold.
US09113520B2	Light emitting diode backlight system the driving apparatus and driving method thereof A light emitting diode (LED) backlight system and a driving apparatus and a driving method thereof are provided. The driving apparatus is suitable for an LED backlight system with N LED strings, where N is a positive integer greater than 1, and which includes an LED driver and a switching unit. The LED driver is configured to receive a dimming signal and time-divisionally generate N control signals in response to a counting clock and an enabling time and a period time both related to the dimming signal. The switching unit is coupled to the LED driver and the N LED strings, and is configured to respectively control an on-off time ratio of a current flowing through each of the LED strings in response to the N control signals.
US09113516B2	Dimmable LED driver and method for controlling the same A dimmable LED driver adapted to be operated with a dimmer that is configured to generate a predetermined conductive angle, wherein the dimmable LED driver comprises: a rectifier configured to convert an alternating current output by the dimmer to a direct current, a buck PFC block configured to adjust an output voltage of the direct current so as to obtain a stable output voltage, a second buck DC/DC block configured to realize output of a constant current after the stable output voltage is realized, a dimming block configured to, after realizing output of the constant current, accomplish a dimming function jointly with the second buck DC/DC block, and an MCU configured to control the buck PFC block, the second buck DC/DC block and the dimming block.
US09113510B2	Dimmer for sport simulation environment A light adjusting system for use with sport simulation equipment and a method of adjusting a state of operation of at least one light source used with golf simulation equipment is provided. The light adjusting system comprises a data interface, a light controller, an operations processor, and a storage device. The data interface is in communication with the sport simulation equipment. The light controller is in communication with at least one light source. The operations processor is in communication with the data interface and the light controller. The storage device is in data communication with the operations processor. The storage device includes at least one lighting profile. In response to communication between the sport simulation equipment and the data interface, the operations processor accesses the at least one lighting profile on the storage device and adjusts a state of operation of the at least one light source using the light controller.
US09113509B2	Lighting device and lighting fixture The lighting device according to the present invention includes: a power source configured to supply power to a light source having a plurality of regions; a plurality of cooling devices arranged corresponding to the plurality of regions to cool the plurality of regions, respectively; and a cooling control circuit configured to control the plurality of cooling devices. The cooling control circuit includes: a plurality of output circuits configured to supply drive voltages to the plurality of cooling devices by use of power from the power source to drive the plurality of cooling devices, respectively; a plurality of temperature measurement circuits configured to respectively measure temperatures of the plurality of regions; and an output control circuit configured to regulate the drive voltages respectively supplied from the plurality of output circuits based on the temperatures respectively measured by the plurality of temperature measurement circuits.
US09113498B2	Apparatus and method with routing logic for communications between multiple baseband modems and a universal integrated circuit card Aspects of the present disclosure are directed to a user equipment having a universal integrated circuit card (UICC), multiple baseband modems, and routing logic for handling communications between the UICC and the baseband modems, and methods for operating the user equipment in which the routing logic arbitrates communication between the UICC and the baseband modems in accordance with arbitration logic. Other aspects, embodiments, and features are also claimed and described.
US09113495B1	System and method for measuring the quantity, type and transmission quality of mobile communication devices within a defined geographical area A system and method for measuring the quantity, type and transmission quality of mobile communication devices within a defined geographical area is disclosed herein. A data server is configured to receive new transmission data for mobile devices from each of a plurality of sensor devices and associate the new transmission data with a corresponding sensor device of the plurality of sensor devices. A console application is also configured to display the display information to an end-user operator.
US09113485B2	Method for reducing latency of wireless data packet delivery A wireless data transmission method includes providing a plurality of radio frequency transmitters. A receiver is provided to receive transmissions from the transmitters. A data format including a plurality of transmission time slots is defined. Each of the transmitters is caused to independently select one of the time slots. The transmitters are used to transmit the transmissions to the receiver in the independently selected time slots.
US09113484B2	Random access channel for OFDM-MIMO system In orthogonal frequency division multiplexing (OFDM) multiple-input multiple-output (MIMO) systems, a wireless transmit/receive unit (WTRU) selects a random access channel (RACH) and a phase for a constant amplitude zero auto correlation (CAZAC) sequence for RACH transmission. The WTRU then transmits a RACH transmission to a Node B via the selected RACH. Once the RACH transmission is detected, the Node B sends an acknowledgement (ACK) to the WTRU over an ACK channel. The Node B may transmit the ACK on a shared channel. The WTRU may ramp up transmit power while the RACH transmission is transmitted, or steps up transmit power of a subsequent RACH transmission. The RACH transmission and data transmission may be either time multiplexed or frequency multiplexed. A plurality of RACHs may be defined and one of the defined RACHs may be selected randomly or based on predetermined criteria.
US09113479B2	Method for multicast frame transmission and duplicated multicast frame detection A method and apparatus of transmitting a multicast frame in a wireless communication system is provided. The method comprises transmitting a request to send (RTS) frame to stations (STAs) included in a multicast group by using an omni-directional antenna, and receiving a clear to send (CTS) frame transmitted by the STAs included in the multicast group in response to the RTS frame, and transmitting the multicast frame to the STAs included in the multicast group by using a directional antenna.
US09113478B2	Methods and apparatus for requesting and allocating resources in multiple transmission opportunities In accordance with a method for scheduling transmission opportunities (TXOPs) in a wireless communications system, a subscriber station may send a request-to-send multiple (RTSM) frame to an access point. The access point may allocate resources for multiple TXOPs based on the RTSM frame. The access point may send a clear-to-send multiple (CTSM) frame.
US09113475B2	Apparatus and method for maintaining synchronization between a receiver having a crystal oscillator and a transmitter A method includes, in a receiver that includes an uncompensated crystal oscillator, receiving signals from a transmitter by activating the receiver periodically at intervals corresponding to a specified wake-up time period. In response to detecting at the receiver that the specified wake-up time period is insufficient for maintaining synchronization between the receiver and the transmitter using the uncompensated crystal oscillator, an actual wake-up time period, smaller than the specified wake-up time period, is selected. The receiver is activated periodically according to the selected actual wake-up time period.
US09113465B2	Method and apparatus of resource allocation for machine type communication device, method and apparatus for receiving data for machine type communication Disclosed herein relates to a resource allocation method for a machine type communication (MTC) device. The resource allocation method for the MTC device includes allocating a control channel with respect to a user terminal to a first time domain of a sub frame, and mixing at least one of a control channel with respect to the at least one MTC device, a data channel with respect to the user terminal, and a data channel with respect to the MTC device in a second time domain of the sub frame, and allocating the mixed channel to the second time domain of the sub frame. Accordingly, in a wireless communication system, control information and data may be transmitted and received to and from the MTC device while maintaining compatibility with the user terminal.
US09113463B2	Resource management for enhanced PDCCH Certain aspects of the present disclosure provide techniques for managing resources utilized for enhanced physical downlink control channel (PDCCH) transmissions. According to certain aspects, a method is provided for wireless communications which may be performed, for example, by a user equipment (UE). The method generally includes receiving signaling indicating a set of time and frequency resources in one or more subframes allocated for an enhanced physical downlink control channel (PDCCH), receiving a downlink transmission in a subframe, making a determination to monitor for the enhanced PDCCH in the subframe based on the signaling, and decoding the enhanced PDCCH transmitted using the set of time and frequency resources in the subframe, in response to the determination.
US09113460B2	Mapping between logical and physical uplink control resource blocks in wireless networks A transmission of information from a secondary to a primary node occurs in a plurality of N logical time durations on an uplink channel in a wireless network. A scheme for mapping between logical uplink control channel (PUCCH) resource blocks (RBs) and physical RBs (PRBs) used by PUCCH is described. A logical uplink control resource block index nLRB is derived by the secondary node in response to information from the primary node. The secondary node then maps the logical uplink control resource block index nLRB to a first uplink physical resource block index nPRB,1 of a plurality of uplink physical resource blocks, wherein nPRB,1=nLRB/2 if nLRB is even and nPRB,1=NPRB−ceil(nLRB/2) if nLRB is odd; wherein NPRB is the total number of the plurality of uplink physical resource blocks; and wherein ceil denotes the ceiling operation. The secondary node then transmits an uplink control information in a subframe using one of the plurality of uplink physical resource blocks indexed by nPRB,1.
US09113458B2	Method and device for transmitting/receiving uplink control information in wireless communication system The present invention relates to a method for a terminal to transmit acknowledgement information including: determining a physical uplink control channel (PUCCH) format and resource, in which the acknowledgement information is transmitted in response to a downlink transmission received in a downlink sub-frame set including M(M≧1) downlink sub-frame; and transmitting the acknowledgement information using the PUCCH format and resource in one uplink sub-frame. Here, more than one serving cells are configured to the terminal, and the more than one serving cells can include one PCell and at least one SCell. The acknowledgement information can be transmitted using a PUCCH format 1a/1b when one physical downlink shared channel (PDSCH) without a corresponding physical downlink control channel (PDCCH) detected, exists only on PCell in the downlink sub-frame set, and a semi-persistent scheduling (SPS) release PDCCH does not exist in the downlink sub-frame set.
US09113457B2	Method and apparatus for transmitting control information The present invention relates to a wireless communication system. More specifically, the present invention relates to a method and an apparatus for transmitting uplink control information when a plurality of cells are configured, comprising the following steps: receiving PDCCH; generating reception reply information on PDSCH which corresponds to the PDCCH; and transmitting the reception reply information through PUCCH.
US09113456B2	Method and device for transmitting uplink signal including data and control information via uplink channel A method and device for transmitting a first and second uplink signal, each having data and control information is provided. The method includes channel encoding the control information of the second uplink signal based on a number of symbols of control information to produce. The channel encoding includes determining the number of symbols in accordance with a payload size of the data of the first uplink signal and a total number of transmissible symbols of a Physical Uplink Shared Channel (PUSCH) of the first uplink signal.
US09113453B2	Methods and arrangements in a radio communication system An Uplink control channel resource Management Module (120, 130), referred to as “UMM”, and a method in the UMM for assigning, to a radio network node 110, uplink control channel resources, referred to as “UCCHR”, for use in a uplink control channel between the radio network node (110) and a communication device (160) are provided. The UMM obtains (210) resource allocation information, referred to as “RAI”, and generates (220) a resource allocation command, referred to as “RAC”, based on the RAI. The RAC indicates UCCHR to be used by the radio network node. Furthermore, the UMM provides (230) the RAC to the radio network node (110). Related methods and nodes to enable the UMM to assign UCCHR are also provided.
US09113449B2	Apparatus for managing network zone having plurality of wireless access points, method of connecting mobile terminal to wireless access point by the apparatus, and the mobile terminal Provided are an apparatus for managing a network zone having a plurality of wireless access points (APs), a method of connecting a mobile terminal to an AP by the apparatus, and the mobile terminal. The apparatus for managing a network zone having a plurality of wireless APS includes a group manager configured to classify the plurality of wireless APs into a plurality of AP groups based on AP device information on the APs belonging to the network zone. Each of the plurality of AP groups can cover the entire network zone.
US09113448B2	Method and apparatus for establishing a device-to-device connection A method, apparatus and computer program product are provided to facilitate the establishment of device-to-device communications, such as non-cellular communications or cellular communications in a licensed exempt band. A method and apparatus receive cellular signals including one or more beacon transmission parameters, such as a beacon transmission interval and an identifier, and a beacon transmission status flag. The method and apparatus may also determine that the beacon transmission status flag is set to authorize beacon transmissions and then cause non-cellular beacon signals to be repeatedly transmitted in accordance with the one or more beacon transmission parameters. The method and apparatus may also cause a device-to-device connection to be established following transmission of the beacon signals. The device-to-device connection may be either a non-cellular device-to-device connection or a cellular device-to-device connection.
US09113442B2	Mobile terminal, base station and methods therein Embodiments herein relate to a method in a mobile terminal (10) for requesting access to a wireless communication system. The mobile terminal (10) receives broadcasted system information that indicates a first available resource of a contention based channel. The mobile terminal (10) derives a second available resource of the contention based channel based on the first available resource of the contention based channel. The mobile terminal (10) further transmits an access request preamble mapped to the second available resource to access the wireless communication system.
US09113438B2	Apparatus and method for mobile assignment An apparatus and method support user devices (109-113) and multiple core networks (125, 126) with a network. A rule set for a user device is associated with a core network (125, 126). Access information associated with a network is converted to core network behaviors using the rule set. A network element (400) can be employed to map the network information to core network information using the rule set for network uses.
US09113436B2	Method and system for information transmission The present invention discloses a method and system for information transmission. Said method includes: an Evolved Packet Data Gateway (ePDG) notifying a Policy and Charging Rules Function (PCRF) entity of the location information of a User Equipment (UE); the PCRF entity sending the location information of the UE to a Broadband Policy Control Function (BPCF) entity. The method and system provided by the present invention solve the problem that the BPCF in a fixed network can not initiate an S9* session to the PCRF entity.
US09113435B2	Communication system, mobile communication terminal and position managing apparatus A mobile node includes a plurality of transceivers, has a network conforming to network-based mobility as its home link and performs position registration to a positional managing apparatus and performs position registration to the position managing apparatus through a foreign network by position registration conforming to host-based mobility. In mobile node and position managing apparatus, a plurality of routes passing through the home link and the foreign link are established. Accordingly, when the mobile node has the plurality of transceivers, it can simultaneously connect to the home link and the foreign link through respective transceivers, to perform communication.
US09113421B2	Techniques to control uplink power Techniques are described that provide uplink power control techniques that can support different uplink multi-input multi-output (MIMO) transmission schemes. Open and closed loop power control schemes can be used to prescribe the power level of the mobile station.
US09113413B2	Communication terminal and communication method An example communication terminal in which a plurality of communication protocols are executed includes a communication device configured to form an association with communication equipment; a communication managing unit configured to decide an operational mode of the communication device; and a device power managing unit configured to control power state of the communication device in accordance with an operational mode decided by the communication managing unit. A plurality of communication protocols (or a plurality of application software) are executed in the communication terminal and a frame to be transmitted is selected according to an execution situation of the communication protocols. The selected frame is transmitted via the association so that the association is maintained and a connection/session of the communication protocol of the selected frame is also maintained.

1 2 3 4 5 6 7 8 9 10