Document | Document Title |
---|---|
US07732710B2 |
Multifunction clips and ground/mounting strap for wiring device
The instant invention overcomes the difficulties encountered with respect to mounting electrical wiring devices to a common box and then positioning the devices relative to each other prior to attaching a wall plate. Some of the difficulties encountered are positioning the wiring devices to be in alignment with each other, locating the wiring devices to be parallel to each other, adjusting the spacing between the different devices to be equal and uniform and fixing all of the devices to be flat against the wall. The alignment pins, when engaged by the close clearance locating openings, accurately positions the wiring devices to allow a wall plate to be placed around the wiring devices without requiring any initial or subsequent adjustment. Each set of alignment pins on the alignment plate can be located on a vertical axis which accurately defines the center for the wiring device. The opening in the wiring device receives and holds captive a set of alignment pins. The alignment pins accurately position, align and locate all of the wiring devices mounted to the alignment plate, and the plate allows the wiring devices to be positioned against a flat surface. |
US07732700B2 |
Playback device, contents selecting method, contents distribution system, information processing device, contents transfer method, and storing medium
A playback device includes a storing unit storing a contents database in which contents including at least music and tempo information indicating the tempo of the music are correlated with each other; a playback unit for performing playback of the contents; a tempo measuring unit for measuring an exercise tempo obtained along with the body movements of a user; a searching unit for searching contents from the contents database based on the information of the measured exercise tempo by the tempo measuring unit; and a contents selecting unit for selecting the contents searched by the searching unit as contents to be played by the playback unit. |
US07732698B2 |
Electronic keyboard instrument having a key driver
An electronic keyboard instrument with a key driver stores automatic performance data including a first event and first timing data and key-driving data including a second event and second timing data that precedes the first timing data for a predetermined time, and reproduces the automatic performance data and the key-driving data in parallel. An event which appears first is detected in the automatic performance data and the key-driving data when the reproduction is started. The automatic performance data and the key-driving data are reproduced rapidly until the detected event and at a normal speed after the detected event. |
US07732691B2 |
Methods and apparatus for vibrato effects in keyboard percussion musical instruments
Improved methods and apparatus of producing vibrato on keyboard percussion/tone bar instruments such as the vibraphone and marimba are provided. Means are disclosed for real time control of the expressive qualities of both the speed and strength of the vibrato of such instruments, while eliminating the need for an electrical motor. According to certain embodiments, methods and apparatus are disclosed to easily produce a change of dynamic level (crescendo and diminuendo) after a single strike of a tone bar or chord. |
US07732690B2 |
Woodwind instrument and manufacturing method of pipe thereof
A pipe of a woodwind instrument (e.g., an upper joint of an oboe) having a through-hole running therethrough in its longitudinal direction is produced in such a way that a plastic lining layer composed of a thermoplastic material is formed on the interior wall of the pipe and the circumferential surfaces of tone holes of the pipe. The thermoplastic material is selected from generally-known plastic materials such as polyethylene, polypropylene, polystyrene, ABS resin, and POM resin. This prevents the inside of the pipe from being excessively expanded due to a player's moist breath in playing the woodwind instrument; hence, it is possible to prevent cracks or flaws from occurring on the pipe. In addition, this structure is superior in manufacturability and suited to mass production. |
US07732689B1 |
Foldable and height adjustable support for musical instrument used in seated position
One embodiment of a foldable and height adjustable playing support for musical instrument that supports an instrument such as a guitar in the playing position while the musician is in the seated position. When in use it supports the instrument's bottom surface with its top instrument supporting surface and its bottom portion, the body contacting surface, rests on the performer's thigh. The support provides the performer various height adjustments to achieve the most comfortable playing position. When not in use it can be flattened to a form that is easy to carry and travel with. |
US07732687B2 |
Stringed instrument fretboard for use with light-system
A fingerboard (or fretboard) for use with a stringed instrument and light-system is disclosed and has a bottom surface adapted to mate or be attached to a neck of the instrument, and has wells extending from the bottom surface toward, but not through, a top surface. The wells are sized to receive a light-emitting device, such as LEDs, and are positioned along the fingerboard according to finger positions of the instrument. Illumination from the light-emitting devices is visible to a player of the instrument, however, when the devices are not illuminated, the fingerboard appears substantially as one made without the wells. The structure is useful for learning to play the instrument, while not appearing as a learning device. |
US07732686B2 |
Stopper for keyboard-based musical instruments
A stopper for a keyboard-based musical instrument is provided for accomplishing a good stopping feeling of a pivotable member, thereby making it possible to improve a touch feeling and restrain collision noise and other noise. A stopper 7 for a keyboard-based musical instrument with which a pivotable member 6 comes into contact while said pivotal member pivotally moves in association with a key touch, thereby restraining the pivotal movement of said pivotable member 6, comprises a mass 26, a first cushion 25 laminated on a front side of said mass 26, and a second cushion 27 laminated on a back side of said mass 26. Preferably, the mass 26 is made of a metal, and the first cushion 25 is harder than the second cushion 27. |
US07732679B2 |
Cotton variety 05H210
The invention relates to the novel cotton variety designated 05H210. Provided by the invention are the seeds, plants, plant parts and derivatives of the cotton variety 05H210. Also provided by the invention are tissue cultures of the cotton variety 05H210 and the plants regenerated therefrom. Still further provided by the invention are methods for producing cotton plants by crossing the cotton variety 05H210 with itself or another cotton variety and plants produced by such methods. |
US07732678B1 |
Cotton fiber transcriptional factors
Novel DNA constructs are provided which may be used as molecular probes or inserted into a plant host to provide for modification of transcription of a DNA sequence of interest in cotton fiber, particularly in very early fiber development. The DNA constructs comprise a cotton fiber transcriptional initiation regulatory region associated with a gene which is expressed in cotton fiber. |
US07732677B2 |
Soybean variety D5567891
The invention relates to the soybean variety designated D5567891. Provided by the invention are the seeds, plants and derivatives of the soybean variety D5567891. Also provided by the invention are tissue cultures of the soybean variety D5567891 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety D5567891 with itself or another soybean variety and plants produced by such methods. |
US07732673B2 |
Soybean variety D5232589
The invention relates to the soybean variety designated D5232589. Provided by the invention are the seeds, plants and derivatives of the soybean variety D5232589. Also provided by the invention are tissue cultures of the soybean variety D5232589 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety D5232589 with itself or another soybean variety and plants produced by such methods. |
US07732671B2 |
Soybean cultivar 7041461
A soybean cultivar designated 7041461 is disclosed. The invention relates to the seeds of soybean cultivar 7041461, to the plants of soybean 7041461, to plant parts of soybean cultivar 7041461 and to methods for producing a soybean plant produced by crossing soybean cultivar 7041461 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars or breeding cultivars and plant parts derived from soybean variety 7041461, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar 7041461 and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants and plant parts produced by crossing the cultivar 7041461 with another soybean cultivar. |
US07732667B2 |
Transgenic plants and progeny and seed thereof
The present subject matter provides a method for enhancing the abiotic stress tolerance of a plant. Polynucleotides isolated from rice (Oryza sativa) and encoding polypeptides for abiotic stress tolerance are also described. |
US07732663B2 |
Cyclin-dependent kinase inhibitors as plant growth regulators
Methods for using cyclin-dependent kinase (CDK) inhibitor genes, or anti-sense constructs complementary to such genes, to modify the growth and development of plant cells and organs are disclosed. Also provided are methods of modifying the development of plant cells and plants by transforming plant cells with nucleic acids encoding cyclin-dependent kinase inhibitor polypeptides, or anti-sense constructs complementary to such nucleic acids, to produce transformed plant cells, and then culturing the plant cells or regenerating a plant under conditions wherein the cyclin-dependent kinase inhibitor, or the anti-sense construct, is expressed. A variety of CDK inhibitor genes, and corresponding anti-sense constructs, are disclosed for use in a variety of plants. The nucleic acid encoding the cyclin-dependent kinase inhibitor may be operably linked to a tissue-specific promoter. Other provided aspects are modified transgenic plants and plant tissues. Also provided are methods of identifying nucleic acids that encode cyclin-dependent kinase inhibitors that are active in plants to modify the development of the plant. |
US07732662B2 |
Method for the transformation of plant cell plastids
Novel compositions and methods useful for genetic engineering of plant cells to provide a method of producing plastid transformed plants are provided in the instant invention. In particular, the present invention provides methods for obtaining plastid transformed plants on medium containing plastid lethal compounds. |
US07732660B2 |
Methods and means for producing efficient silencing construct using recombinational cloning
Methods and vectors and kits are provided for producing chimeric nucleic acid constructs capable of producing dsRNA for silencing target nucleic acid sequences of interest using recombinational cloning. |
US07732658B2 |
Composition and method for imaging cells
The invention relates to compositions containing a polynucleotide encoding for a reporter gene, a selectable marker and a regulatory element, that provide a method for imaging cells in vivo. |
US07732657B2 |
Absorbent article with lotion-containing topsheet
A sanitary napkin comprising a topsheet having a body-facing side and comprising a plurality of discrete tufts of fibrous material. The topsheet has a lotion composition applied to at least a portion of the body-facing side thereof. An absorbent core is in fluid communication with the topsheet, the absorbent core having an average thickness of less than about 10 mm, and a free absorbent capacity of from about 4 to about 125 grams per gram. |
US07732652B2 |
Perylene derivative synthesis process, perylene derivative and organic EL device
The invention aims to provide a perylene derivative preparation process featuring satisfactory yields and improved preparation efficiency, a perylene derivative obtained by the process, and an organic EL device using the same. The object is achieved by a perylene derivative preparation process comprising subjecting to coupling reaction a 1,8-dihalogenated naphthalene derivative of the formula (1): wherein X is Cl, Br or I, R1 to R4, R11 and R12 each are hydrogen, alkyl, alkoxy, alkylthio, alkenyl, alkenyloxy, alkenylthio, aralkyl, aralkyloxy, aralkylthio, aryl, aryloxy, and arylthio radicals which may be substituted, amino radical, cyano radical, hydroxyl radical, —COOM1 radical (wherein M1 is hydrogen, alkyl, alkenyl, aralkyl or aryl), —COM2 radical (wherein M2 is hydrogen, alkyl, alkenyl, aralkyl, aryl or amino), or —OCOM3 radical (wherein M3 is alkyl, alkenyl, aralkyl or aryl), and at least two adjoining radicals selected from among R1 to R4, R11 and R12 may bond or fuse together to form a substituted or unsubstituted carbocyclic aliphatic ring, aromatic ring or fused aromatic ring with the carbon atoms on which they substitute, with the proviso that when the carbocyclic aliphatic ring, aromatic ring or fused aromatic ring has substituent radicals, the substituent radicals are the same as R1 to R4, R11 and R12, to thereby synthesize a perylene derivative of the formula (2): wherein R1′ to R4′, R11′ and R12′ are as defined for R1 to R4, R11 and R12 in formula (1), and R1 to R4, R11 and R12 and R1′ to R4′, R11′ and R12′ may be the same or different. |
US07732651B2 |
Method of making an alkylated aromoatic using acidic ionic liquid catalyst
A process for alkylating an aromatic compound containing no hydroxyl groups comprising reacting at least one non-hydroxyl containing aromatic compound with at least one olefinic oligomer in the presence of an acidic ionic liquid catalyst, wherein the olefinic oligomer has a carbon range of from about C12 to about C70 and is synthesized by oligomerizing at least one monoolefin monomer in the presence of an acidic ionic liquid catalyst. |
US07732642B1 |
Arylcarbonylated detonation nanodiamonds
Functionalized detonation nanodiamond particulates of the formula: wherein Ar is selected from the group consisting of: wherein R is selected from the group consisting of H, H3C—(CH2)n— and wherein n has a value of 0-10. Also provided is a process for functionalizing detonation nanodiamonds particulates. |
US07732637B2 |
Acylamide compounds having secretagogue or inducer activity of adiponectin
The present invention provides an acylamide compound of the following formula (1), prodrugs thereof, or pharmaceutically acceptable salts thereof; and an adiponectin inducer or secretagogue, therapeutic agent of metabolic syndromes, therapeutic agent of hypoadiponectinemia, therapeutic agent of hyperlipemia, preventive/therapeutic agent of diabetes, improving agent of impaired glucose tolerance, improving agent of insulin resistance, enhancing agent of insulin sensitivity, therapeutic agent of hypertension, preventive/therapeutic agent of vascular disorders, an anti-inflammatory agent, therapeutic agent of hepatic inflammation, therapeutic agent of fatty liver, therapeutic agent of hepatic fibrosis, therapeutic agent of liver cirrhosis, preventive/therapeutic agent of non-alcoholic/nonviral steatohepatitis (NASH) or non-alcoholic/nonviral fatty liver disease (NAFLD), or therapeutic agent of obesity, each of which has the above compounds as an active ingredient. |
US07732629B2 |
Process for the preparation of diaryl carbonate
The invention relates to a process for the preparation of a diaryl carbonate by transesterification of an aromatic alcohol with a dialkyl carbonate in the presence of a transesterification catalyst during a period of time [ta], in which the aryl moiety is selected from unsubstituted phenyl and mono-, di- and trisubstituted phenyl groups, in which the alkyl moiety is selected from C2 to C4 linear and branched alkyl groups, in which the catalyst concentration is designated [ca], expressed as gram catalyst per gram of aromatic alcohol and dialkyl carbonate, in which the period of time [tm] and catalyst concentration [cm] are determined to arrive at a pre-set approach to the equilibrium for the transesterification of the aromatic alcohol with dimethyl carbonate to methyl aryl carbonate and methanol, in which the product [ca]*ta is at least 1.5*[cm]*tm under otherwise the same reaction conditions. |
US07732621B2 |
Process for the preparation of enantiomerically enriched indoline-2-carboxylic acid
The present invention relates to a process for the preparation of an enantiomerically enriched optionally substituted indoline-2-carboxylic acid or a salt thereof, wherein an enantiomerically enriched chiral ortho-X-substituted phenylalanine compound, wherein X is a leaving group, is subjected to cyclisation, preferably at a temperature of below about 140° C., upon formation of the enantiomerically enriched indoline-2-carboxylic acid compound. |
US07732620B2 |
Process for crystallization of Ramipril and preparation of a hydrated form thereof
The present invention relates to a novel method for obtaining (2S,3aS,6aS)-1-[(S)-2-[[(S)-1-(ethoxycarbonyl)-3-phenylpropyl]-amino]propanoyl]octahydro cyclopenta[b]pyrrole-2-carboxylic acid, viz. Ramipril(I) in high optical purity, free of other stereoisomers, and in high bulk density. The present invention also relates to a novel hydrated form of Ramipril(I) and a process for preparation thereof. |
US07732619B2 |
Stilbene derivatives, light-emitting element, display device, and electronic device
A novel stilbene derivative is provided with motivation of providing a blue emissive material showing excellent color purity. The use of the stilbene derivative of the present invention allows the fabrication of a blue-emissive light-emitting element with excellent color purity. The invention also includes an electronic device equipped with a display portion in which the stilbene derivative is employed. The stilbene derivative of the present invention is represented by formula (1), in which Ar1 and Ar2 may form a 5-membered ring by being directly bonded to each other. In formula (1), A11 represents any one of substituents represented by general formulas (1-1) to (1-3). The variables shown in formula (1) and (1-1) to (1-3) are as defined in the specification. |
US07732618B2 |
Benzimidazole acetic acids exhibiting CRTH2 receptor antagonism and uses thereof
The invention relates to benzimidazole acetic acid compounds which function as antagonists of the Chemoattractant Receptor-homologous molecule expressed on T-Helper type 2 cells (CRTH2) receptor. The invention also relates to the use of these compounds to inhibit the binding of prostaglandin D2 and its metabolites or certain thromboxane metabolites to the CRTH2 receptor and to treat disorders responsive to such inhibition. |
US07732615B2 |
N-(4-fluorobenzyl)-N-(1-methylpiperidin-4-yl)-N′-(4-(2-methylpropyloxy)phenylmethyl)carbamide and its tartrate salt and crystalline forms
Disclosed herein are methods for synthesizing N-(4-fluorobenzyl)-N-(1-methylpiperidin-4-yl)-N′-(4-(2-methylpropyloxy)-phenylmethyl)carbamide. Also disclosed herein is the hemi-tartrate salt of N-(4-fluorobenzyl)-N-(1-methylpiperidin-4-yl)-N′-(4-(2 -methylpropyloxy)-phenylmethyl)carbamide and methods for obtaining the salt. Further disclosed are various crystalline forms of N-(4-fluorobenzyl)-N-(1-methylpiperidin-4-yl)-N′-(4-(2-methylpropyloxy)-phenylmethyl)carbamide and its hemi-tartrate salt including various polymorphs and solvates. |
US07732605B2 |
Synthesis of diketopiperazines
Disclosed herein are methods for synthesizing diketopiperazines with enantiomeric excess by inducing cyclization of an α-keto acid with an acid catalyst. |
US07732602B2 |
Herbicide composition
The present invention relates to an herbicide composition comprising, as active ingredients, a uracil compound represented by the following formula (I): wherein Z represents halogen or cyano; A represents oxygen, sulfur or NH; R1 represents hydroxyl, C1-C7 alkoxy or others, and R2 represents hydrogen or methyl, and one or more organophosphorus compounds selected from the group consisting of N-(phosphonomethyl)glycine, agriculturally acceptable salts of Glyphosate and ammonium DL-homoalanine-4-yl(methyl)phosphinate; and a method for controlling weeds which comprises applying an effective amount of said herbicide composition to weeds. According to the invention, particularly weeds in orchards, cornfields, soybean fields, cotton fields and non-crop lands can be effectively controlled. |
US07732601B2 |
Crystalline polymorphs of methanesulfonic acid addition salts of Imatinib
This invention relates to the methanesulfonic acid addition salts of Imatinib and to the synthesis thereof. In particular, this invention relates to the synthesis of crystalline α-form of Imatinib methanesulfonate. Furthermore, the invention is directed to a novel acid addition salt of 4-(4-methylpiperazin-1-ylmethyl)-N-[4-methyl-3-[(4-pyridin-3-yl)pyrimidin-2-ylamino)phenyl]benzamide with two molecules of methanesulfonic acid and to the polymorphic forms thereof, as well as to their pharmaceutical compositions. |
US07732597B2 |
Crystalline form of linezolid
The present invention relates to a novel crystalline form of linezolid, to processes for its preparation and to a pharmaceutical composition containing it. |
US07732595B2 |
Process for preparing an A2A-adenosine receptor agonist and its polymorphs
Disclosed is a synthesis suitable for large scale manufacture of an A2A-adenosine receptor agonist, and also relates to polymorphs of that compound, and to methods of isolating a specific polymorph. The A2A-adenosine receptor agonist has the following formula: This compound is prepared by reacting the ethyl ester with methylamine in a sealed pressure reactor. |
US07732587B2 |
Nucleic acids encoding truncated soluble tumor necrosis factor
Disclosed are novel proteins, referred to as tumor necrosis factor binding proteins, that modulate the activity of tumor necrosis factor. Also disclosed are processes for obtaining the tumor necrosis binding proteins by recombinant genetic engineering techniques. |
US07732585B2 |
Altered recombinases for genome modification
The present invention describes methods of identifying altered recombinases and compositions thereof, wherein at least one amino acid is different from a parent, wild-type recombinase and the altered recombinase has improved recombination efficiency towards wild-type and/or pseudo att site sequences relative to the parent, wild-type recombinase. The present invention also includes methods of modifying the genomes of cells using the altered recombinases, including methods of site-specifically integrating a polynucleotide sequence of interest in a genome of a eucaryotic cell. |
US07732578B2 |
Super humanized antibodies
Disclosed herein are methods for humanizing antibodies based on selecting variable region framework sequences from human antibody genes by comparing canonical CDR structure types for CDR sequences of the variable region of a non-human antibody to canonical CDR structure types for corresponding CDRs from a library of human antibody sequences, preferably germline antibody gene segments. Human antibody variable regions having similar canonical CDR structure types to the non-human CDRs form a subset of member human antibody sequences from which to select human framework sequences. The subset members may be further ranked by amino acid similarity between the human and the non-human CDR sequences. Top ranking human sequences are selected to provide the framework sequences for constructing a chimeric antibody that functionally replaces human CDR sequences with the non-human CDR counterparts using the selected subset member human frameworks, thereby providing a humanized antibody of high affinity and low immunogenicity without need for comparing framework sequences between the non-human and human antibodies. Chimeric antibodies made according to the method are also disclosed. |
US07732570B2 |
Alteration of Fc-fusion protein serum half-lives by mutagenesis
The present invention provides for a modified Fc-fusion protein in which at least one amino acid from the heavy chain constant region selected from the group consisting of amino acid residues 250, 314, and 428 is substituted with another amino acid which is different from that present in the unmodified Fc-fusion protein, thereby altering the binding affinity for FcRn and/or the serum half-life in comparison to the unmodified Fc-fusion protein. |
US07732569B2 |
Zein-based peptide tags for the expression and purification of bioactive peptides
Zein-based peptide tags, referred to here as inclusion body tags (IBTs), are disclosed useful for the generation of insoluble fusion peptides. The fusion peptides comprise at least one inclusion body tag operably linked to a peptide of interest. Expression of the fusion peptide in a host cell results in a product that is insoluble and contained within inclusion bodies in the cell and/or cell lysate. The inclusion bodies may then be purified and the protein of interest may be isolated after cleavage from the inclusion body tag. |
US07732568B2 |
Methods for preventing and treating Alzheimer's disease
The present invention relates to methods for preventing and treating Alzheimer's disease (AD). An Aβ42 mimotope is used for vaccination against AD. The mimotope induces the production of antibodies against Aβ42 but not against the native APP. The mimotope is functionally similar to, but not structurally identical with DAEFRH (SEQ ID NO: 1) which is a part of the naturally-occurring Aβ42 sequence. |
US07732566B2 |
Allergenic latex protein
The present invention relates to a protein found in natural rubber that can induce an allergic reaction in persons who have been sensitised to it. The invention provides for the process of isolating and purifying the protein and describes the characteristics of the protein, including its molecular weight, isoelectric point, amino acid sequence and allergenicity. The invention also describes the isolation and cloning a the DNA that encodes the protein. The production of the recombinant version of the protein using a protein expression vector is described. |
US07732565B2 |
Compositions and methods relating to elutable carbohydrate-binding proteins
Compositions and methods are provided for creating and identifying mutant carbohydrate-binding proteins that reversibly bind to carbohydrate substrates under conditions where the native protein remains bound. Examples of modified chitin-binding domains are provided which can be eluted from chitin in the presence of a reducing agent or at a pH within the range of 5-10. |
US07732559B2 |
Method of making halophthalic acids and halophthalic anhydrides
A method of preparing a halophthalic acid is disclosed which comprises the steps of contacting in a liquid phase reaction mixture at least one halogen-substituted ortho-xylene with oxygen and acetic acid at a temperature in a range between about 120° C. and about 220° C. in the presence of a catalyst system yielding a product mixture comprising less than 10 percent halogen-substituted ortho-xylene starting material, a halophthalic acid product, and less than about 10,000 ppm halobenzoic acid and less than about 1000 ppm halophthalide by-products based on a total amount of halophthalic acid present in the product mixture. In addition methods for the preparation of halophthalic anhydride, and recovery of high purity acetic acid from an aqueous acetic acid stream comprising HCl, which is generated during the preparation of the halophthalic acid are also disclosed. |
US07732551B2 |
Post-treatment for polymer pellets
A continuous process for minimizing the agglomeration of freshly manufactured polyolefin pellets comprising the steps of: feeding an aqueous stream containing polyolefin pellets to a tower, cooling said polyolefin pellets during their upward flow along said tower by means of a downward flow of a cooling agent having a density higher than said polyolefin, collecting the cooled pellets from the top of said tower after a residence time in the tower comprised between 2 and 20 minutes. |
US07732550B2 |
Stimuli-responsive polymer utilizing keto-enol tautomerization and stimuli-responsive separating material and chemical-releasing capsule comprising the same
A stimuli-responsive polymer derivative utilizing keto-enol tautomerization. Also disclosed are a simple process for producing an N-acyl(meth)acrylamide derivative which can be used as a monomer for the stimuli-responsive polymer, a process for the production of an intermediate thereof, and an intermediate thus produced. |
US07732546B2 |
Use of silylated sulfonate monomers to improve contact lens wettability
The present invention relates to polymeric compositions useful in the manufacture of biocompatible medical devices. More particularly, the present invention relates to certain hydrophilic monomers capable of polymerization to form polymeric compositions having desirable physical characteristics useful in the manufacture of ophthalmic devices. The polymeric compositions comprise polymerizable hydrophilic siloxanyl monomers. |
US07732543B2 |
Siloxanes and silanes cured by organoborane amine complexes
Curable compositions contain (i) a free radical polymerizable organosilicon monomer, oligomer or polymer; (ii) an organoborane amine complex; optionally (iii) an amine reactive compound having amine reactive groups; and optionally (iv) a component capable of generating a gas when mixed with a compound bearing active hydrogen and a catalyst. The curable compositions can be used as a rubber, tape, adhesive, foam, pressure sensitive adhesive, protective coating, thin film, thermoplastic monolithic molded part, thermosetting monolithic molded part, sealant, gasket, seal, or o-ring, die attachment adhesive, lid sealant, encapsulant, potting compound, or conformal coating. The compositions can also be used in composite articles of manufacture such as integrally bonded device including electrical and electronic connectors and scuba diving masks, in which substrates are coated or bonded together with the composition and cured. |
US07732533B2 |
Zwitterionic block copolymers and methods
Zwitterionic block copolymers having oppositely charged or chargeable terminal groups, and methods of making and using the same, are disclosed. The zwitterionic block copolymers can undergo microphase separation. |
US07732528B2 |
Water-absorbent crosslinked polymers
Water-absorbent crosslinked polymers bearing acid groups, some or all of the acid groups being present as carboxylate groups having at least two different types of cations as counterions, processes for their preparation and mixtures of water-absorbent crosslinked polymers. |
US07732518B2 |
Method for producing polyolefin composition
A method for producing a polyolefin composition, which comprises melt-kneading a particulate composition (A) containing a compound represented by formula (1): wherein R1 represents an alkyl group having 1 to 8 carbon atoms, X represents an n-hydric alcohol residue having 1 to 18 carbon atoms which may include a heteroatom and/or a cyclic group, and n is the integer 2 or 4, and a metal soap, and a particulate polyolefin (B), wherein the ratio (a/b) of the average particle diameter (a) of the particulate composition (A) and the an average particle diameter (b) of the particulate polyolefin (B) is adjusted to 3/1 to 1/3, and wherein average particle diameter means the central cumulative value determined from a weight-based particle diameter cumulative distribution for residue on a sieve measured in accordance with JIS K 0069. |
US07732516B2 |
Flame retardant polyimide/polyester-polycarbonate compositions, methods of manufacture, and articles formed therefrom
A composition is disclosed, comprising, based on the total weight of the composition, from 20 to 60 wt. % of a polyimide having a glass transition temperature above 180° C.; from 10 to 30 wt. % a polyester-polycarbonate copolymer; from 30 to 60 wt. % of a reinforcing filler; and at least two flame retardant additives selected from the group consisting of from 0.01 to 0.5 wt. % of a first sulfonate salt, from 0.01 to 0.5 wt. % of a second sulfonate salt, from 0.5 to 5 wt. % of a siloxane copolymer, and combinations thereof. An article molded from the composition attains an improved UL94 rating, as compared to an article molded from the same composition without the at least two flame retardant additives. |
US07732501B2 |
Fullerene based proton conductive materials
A fullerene-based proton conductor including a proton conductive functional group connected to the fullerene by an at least partially fluorinated spacer molecule. Also, a polymer including at least two of the proton conductors that are connected by a linking molecule. Further, an electrochemical device employing the polymer as a proton exchange membrane, whereby the device is able to achieve a self-humidifying characteristic. |
US07732492B2 |
Nateglinide-containing preparation
The present invention provides a small-sized preparation that is easy to take, containing 26% or more of nateglinide and 28% or more of at least one disintegrant selected from the group consisting of carmellose or salts thereof, sodium carboxymethyl starch, croscarmellose sodium, crospovidone, partly pregelatinized starch and low-substituted hydroxypropyl cellulose, based on the total mass of the preparation. The preparation of the present invention has high contents of nateglinide, which can be absorbed immediately to exhibit a hypoglycemic action. |
US07732490B2 |
Methods of treating cancer
The present invention provides methods of selectively inducing terminal differentiation, cell growth arrest and/or apoptosis of neoplastic cells, and/or inhibiting histone deacetylase (HDAC) by administration of pharmaceutical compositions comprising potent HDAC inhibitors. The oral bioavailability of the active compounds in the pharmaceutical compositions of the present invention is surprisingly high. Moreover, the pharmaceutical compositions unexpectedly give rise to high, therapeutically effective blood levels of the active compounds over an extended period of time. The present invention further provides a safe, daily dosing regimen of these pharmaceutical compositions, which is easy to follow, and which results in a therapeutically effective amount of the HDAC inhibitors in vivo. |
US07732483B2 |
DNA-PK inhibitors
A compound of formula I: and isomers, salts, solvates, chemically protected forms, and prodrugs thereof, wherein: R1 and R2 are independently selected from hydrogen, an optionally substituted C1-7 alkyl group, C3-20 heterocyclyl group, or C5-20 aryl group, or may together form, along with the nitrogen atom to which they are attached, an optionally substituted heterocyclic ring having from 4 to 8 ring atoms; Q is —NH—C(═O)— or —O—; Y is an optionally substituted C1-5 alkylene group; X is selected from SR3 or NR4R5, wherein, R3, or R4 and R5 are independently selected from hydrogen, optionally substituted C1-7 alkyl, C5-20 aryl, or C3-20 heterocyclyl groups, or R4 and R5 may together form, along with the nitrogen atom to which they are attached, an optionally substituted heterocyclic ring having from 4 to 8 ring atoms; if Q is —O—, X is additionally selected from —C(═O)—NR6R7, wherein R6 and R7 are independently selected from hydrogen, optionally substituted C1-7 alkyl, C5-20 aryl, or C3-20 heterocyclyl groups, or R6 and R7 may together form, along with the nitrogen atom to which they are attached, an optionally substituted heterocyclic ring having from 4 to 8 ring atoms; and if Q is —NH—C(═O)—, —Y—X may additionally be selected from C1-7 alkyl. |
US07732482B2 |
Compound from Antrodia camphorata and the use thereof
The present invention relates to novel compounds from Antrodia camphorata and the use thereof. |
US07732478B2 |
Methods for facilitating metabolic control
The present invention provides methods for facilitating metabolic control in a subject by decreasing the level of Il-1β in the GCF. The present invention further provides methods for decreasing the level of circulating TNF in a subject. Also provided are uses of anti-inflammatory agents in these methods. |
US07732475B2 |
Histone deacetylase inhibitors
Compounds, pharmaceutical compositions, kits and methods are provided for use with HDAC that comprise a compound selected from the group consisting of: wherein the substituents are as defined herein. |
US07732467B2 |
Method for reducing amyloid deposition, amyloid neurotoxicity and microgliosis
The present invention provides methods for reducing β-amyloid deposition, β-amyloid neurotoxicity and microgliosis in animals or humans afflicted with a cerebral amyloidogenic disease, such as Alzheimer's disease (AD), by administering therapeutically effective amounts of the dihydropyridine calcium channel antagonist, nilvadipine. The present invention also provides methods for diagnosing cerebral amyloidogenic diseases in animals or humans. Further provided are methods for reducing the risk of β-amyloid deposition, β-amyloid neurotoxicity and microgliosis in animals or humans suffering from traumatic brain injury by administering nilvadipine immediately after the traumatic brain injury and continuing treatment for a prescribed period of time thereafter. Finally, methods are provided for treating transplantable neuronal stem cells by administering nilvadipine to the neuronal stem cells prior to transplantation in the central nervous system of an animal or human afflicted with a cerebral amyloidogenic disease, such as AD. |
US07732465B2 |
Substituted benzimidazoles and methods of their use
New substituted benzimidazole compounds, compositions, and methods of inhibition of kinase activity associated with tumorigenesis in a human or animal subject are provided. In certain embodiments, the compounds and compositions are effective to inhibit the activity of at least one serine/threonine kinase or receptor tyrosine kinase. The new compounds and compositions may be used either alone or in combination with at least one additional agent for the treatment of a serine/threonine kinase- or receptor tyrosine kinase-mediated disorder, such as cancer. |
US07732463B2 |
4-(2-phenylsulfanyl-phenyl)-piperidine derivatives as serotonin reuptake inhibitors
The invention provides compounds represented by the general formula (I) wherein the substituents are defined in the application. The compounds are useful in the treatment of an affective disorder, including depression, anxiety disorders including general anxiety disorder and panic disorder and obsessive compulsive disorder. |
US07732456B2 |
Pyridone derivative
The invention provides pyridone derivatives represented by a general formula (I) [in the formula, R1 and R2 may be same or different and stands for H, etc., or R1 and R2 may form an aliphatic nitrogen-containing heterocyclic group together with the N to which they bind; X1-X3 may be same or different and stand for methine or N, provided not all of them simultaneously stand for nitrogen; X4-X7 may be same or different and stand for methine or N, provided that three or more of them do not simultaneously stand for N; Y1 and Y3 may be same or different and stand for single bond, —O—, —NR—, —S—, etc; Y2 stands for lower lkylene, etc.; R stands for H, etc., L stands for methylene; Z1 and Z2 may be same or different and stand for single bond or lower alkylene; or R1, L and Z2 may form an aliphatic nitrogen-containing heterocyclic group with the N to which R1 binds; and Ar stands for aromatic carbocyclic group, etc.]. |
US07732455B2 |
Substituted 8-heteroaryl xanthines
Selective antagonists of A2B adenosine receptors like those of formula I are provided. These compounds and compositions are useful as pharmaceutical agents. |
US07732454B2 |
Inhibitors of Bruton's tyrosine kinase
Disclosed herein are imidazo[1,5-f][1,2,4]triazine compounds that form covalent bonds with Bruton's tyrosine kinase (Btk). The imidazo[1,5-f][1,2,4]triazine compounds described are irreversible inhibitors of Btk. Methods for the preparation of the imidazo[1,5-f][1,2,4]triazine compounds are disclosed. Also disclosed are pharmaceutical compositions that include the imidazo[1,5-f][1,2,4]triazine compounds. Methods of using the imidazo[1,5-f][1,2,4]triazine Btk inhibitors are disclosed, alone or in combination with other therapeutic agents, for the treatment of autoimmune diseases or conditions, heteroimmune diseases or conditions; cancer, including lymphoma, and inflammatory diseases or conditions. |
US07732453B2 |
Pyrido[2,3-B] pyrazin-3(4H)-ones for use as stearoyl CoA desaturase inhibitors
The present invention discloses pyrido[2,3-B]pyrazin-3(4h)-ones for use as inhibitors of stearoyl-CoA desaturase. The compounds are useful in treating and/or preventing various human diseases, mediated by stearoyl-CoA desaturase (SCD) enzymes, especially diseases related to abnormal lipid levels, cardiovascular disease, diabetes, obesity, oily skin conditions, metabolic syndrome, and the like. |
US07732445B2 |
Myosin light chain kinase inhibitor compounds, compostions and related methods of use
Pyridazinyl compounds, compositions and related methods of use. |
US07732442B2 |
Chemokine receptor antagonist and medical use thereof
The present invention relates to a compound represented by formula (I), a salt thereof, an N-oxide thereof, a solvate thereof or a prodrug thereof, and medical use thereof (the symbols in the formula are as described in the specification). The compound represented by formula (I) has chemokine receptor (especially in CCR4 and/or CCR5) antagonistic activity. Therefore it is useful for prevention and/or treatment of a chemokine receptor-mediated disease such as inflammatory and/or allergic diseases [systemic inflammatory response syndrome (SIRS), anaphylaxis, anaphylactoid reaction, allergic angiitis, transplant rejection reaction, hepatitis, nephritis, nephropathy, pancreatitis, rhinitis, arthritis, inflammatory ocular disease, inflammatory bowel disease, disease in cerebro and/or circulatory system, respiratory disease, dermatosis, autoimmune disease, and the like], infection [viral disease (human immunodeficiency virus infection, acquired immunodeficiency syndrome, SARS, etc.), and the like], and the like. |
US07732439B2 |
Biologically active methylene blue derivatives
The present invention relates to a pharmaceutical composition which contains a compound of formula in which R1, R2, R3 and R4 are each n-butyl, where XP− is a counteranion and P is 1, 2 or 3, together with a pharmaceutically acceptable carrier, excipient or adjuvant. |
US07732436B2 |
Preparation of hymenialdisine derivatives and use thereof
The synthesis and biological activity of indoloazepines and acid amine salts thereof which are structurally related to naturally-occurring hymenialdisine is disclosed. Naturally-occurring hymenialdisine obtained from the sponge is a potent inhibitor of production of cytokines interleukin-2 (IL-2) and tumor necrosis factor-α (TNF-α). The chemically-synthesized indoloazepines of the invention also inhibit production of IL-2 and TNF-α. The indoloazepines are useful for treating inflammatory diseases, particularly diseases associated with kinases NF-κB or GSK-3β activation or NF-κB activated gene expression products. The indoloazepines are useful for the treatment of cancer by the inhibition of kinases CHK1 and CHK2. |
US07732435B2 |
Chromone derivatives useful as antagonists of VR1 receptors
The invention relates to novel heterocyclic compounds of the formula in which all of the variables are as defined in the specification, in free form or in salt form, to their preparation, to their use as medicaments and to medicaments comprising them. |
US07732432B2 |
17-carbamoyloxy cortisol derivatives as selective glucocorticoid receptor modulators
The present invention encompasses compounds of Formula (I) or pharmaceutically acceptable salts or hydrates thereof, which are useful as selective glucocorticoid receptor ligands for treating a variety of autoimmune and inflammatory diseases or conditions. Pharmaceutical compositions and methods of use are also included. |
US07732430B2 |
Drug delivery system comprising a tetrahydroxilated estrogen for use in hormonal contraception
A method of contraception in mammalian females, which method comprises the oral administration of an estrogenic component and a progestogenic component to a female of childbearing capability in an amount effective to inhibit ovulation, wherein the estrogenic component is selected from the group consisting of substances represented by the following formula (1) in which R1, R2, R3, R4 independently are a hydrogen atom, a hydroxyl group or an alkoxy group with 1-5 carbon atoms; each of R5, R6, R7 is a hydroxyl group; and no more than 3 of R1, R2, R3, R4 are hydrogen atoms; precursors capable of liberating a substance according to the aforementioned formula when used in the present method; and mixtures of one or more of the aforementioned substances and/or precursors. Another aspect of the invention concerns a pharmaceutical kit comprising oral dosage units that contain the aforementioned estrogenic component and/or a progestogenic component. |
US07732426B2 |
Isocyclomaltooligosaccharide (S) , isocyclomaltooligosaccharide-forming enzyme, their preparation and uses
The present invention have objects to provide an option of non-reducing saccharide by providing a novel non-reducing saccharide composed of glucose as constituents and to provide a novel enzyme forming the non-reducing saccharide, a method and process for producing the same, a DNA encoding the enzyme, a recombinant DNA and transformant comprising the DNA, a composition comprising the non-reducing saccharide, and uses thereof. The present invention solves the above objects by providing an isocyclomaltooligosaccharide(s) having a structure represented by General Formula 1, a novel isocyclomaltooligosaccharide-forming enzyme, a method and process for producing the same, a DNA encoding the enzyme, a recombinant DNA and transformant comprising the DNA, a composition comprising the isocyclomaltooligosaccharide(s) or a saccharide composition comprising the same, and uses thereof. Cyclo{→6)-[α-D-Glcp-(1→4)]n-α-D-Glcp-(1→} General Formula 1 (In General Formula 1, “n” means a number of 4 or 5). |
US07732425B2 |
Pharmaceutical composition for ophthalmic use
An ophthalmic pharmaceutical composition comprising trehalose as an effective ingredient and a pharmaceutically-acceptable carrier. The pharmaceutical composition is a safe, long-term continuously-administrable, therapeutic and/or prophylactic agent for the ophthalmologic clinical symptoms and signs in Sjögren syndrome. |
US07732422B2 |
TRPM-2 antisense therapy
Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration. |
US07732412B2 |
Methods of treatment using novel LHRH antagonists having improved solubility properties
The invention relates to peptides which contain N-methylated amino acid units and have improved water solubility. The invention also relates methods for treating a hormone-dependent tumor or a non-malignant indication that is treatable by LH-RH suppression, the method comprising administering to a patient in need of the treatment a therapeutically effective amount of a compound of the invention. Hormone-dependent cancers that can be treated with the methods of the invention include prostate cancer, breast cancer, ovarian cancer, endometrial cancer, and pancreatic cancer. Non-malignant indications which can be treated by the methods of the invention include benign prostate hyperplasia (BPH), endometriosis, acne, polycystic ovarian disease, dysmenorrhea, precocious puberty, and uterine fibroids and other leiomyomas. |
US07732399B2 |
Sustained release formulations
The present invention relates broadly to the field of sustained release formulations. More specifically, the invention describes compositions and methods relating to formulating proteins and/or peptides with purified gallic acid esters. In one example, the gallic acid ester is PentaGalloylGlucose (PGG) and in anther example the gallic acid ester is epigallocatechin gallate (EGCG). |
US07732397B2 |
Use of cardiotrophin in liver diseases
Use of cardiotrophin in liver diseases. The invention describes the increased expression of cardiotrophin (CT-1) during the process of hepatic regeneration coinciding with maximum proliferation of hepatocytes and the role of CT-1 as a stimulator of hepatic regeneration. Furthermore, it describes the hepatoprotective role of CT-1 in various models of acute liver damage.The importance of using CT-1 in the manufacture of compositions for use in the treatment of hepatopathies is demonstrated. The invention describes such use in various forms and methods, including the recombinant protein and the use of the gene sequences that code for CT-1. |
US07732396B2 |
Process for producing a granular anionic surfactant
The invention provides a granular anionic surfactant and a detergent composition blended with the same. Disclosed are a process for producing a granular anionic surfactant, which including stirring particles containing 50 to 100 wt % of an anionic surfactant at a temperature at which the anionic surfactant exhibits thermoplasticity at a stirring Froude number as defined below by equation (i) of 0.1 or more and less than 2.0; a granular anionic surfactant obtained by the process; a granular anionic surfactant having a surface roughness (Ra) of 1.0 μm or less; and a detergent composition comprising the granular anionic surfactant. Fr=V/[(R×g)0.5] (i) wherein Fr is Froude number, V is the peripheral speed at the top of a stirring blade [m/s], R is the radius of gyration of a stirring blade [m], and g is the acceleration of gravity [m/s2]. |
US07732388B2 |
Phospholipid lubricant for coating moving webs
Lubricant formulations comprising a phospholipids such as lecithins and a low hydrophobic lipophilic balance (HLB) surfactant provide improved rheological properties for coating a rapidly moving web, such as a paper web. The low hydrophobic lipophilic balance (HLB) surfactant is preferably an alcohol ethoxylate having an HLB value of between 7 and 10 or more preferably between 7.5 and 9.5. The lubricant formulations of the invention are preferably applied to the paper web as part of a coating mixture. The lubricant is well-suited for short-dwell coating methods. |
US07732387B2 |
Preparation of aromatic polysulfonic acid compositions from light cat cycle oil
A method for the preparation of a stream rich in aromatic polysulfonic acid compounds from light catalytic cycle oil. The preparation involves the polysulfonation of the light catalytic cycle oil using more than a stoichiometric amount of sulfuric acid. The aromatic polysulfonic acid compositions are preferably aromatic polynuclear compositions. |
US07732384B2 |
Solid borozirconate and borotitanate cross-linkers
A process is provided to prepare solid borozirconate and solid borotitanate cross-linkers, which comprises contacting zirconium or titanium complex with alkanolamine at particular mole ratios of boron, zirconium or titanium and alkanolamine. Use of the cross-linkers in compositions for oil field applications such as hydraulic fracturing and plugging of permeable zones are also disclosed. |
US07732379B2 |
Non-damaging manganese tetroxide water-based drilling fluids
A water-based drilling fluid containing Mn3O4 has been found to be effective in providing petroleum reservoirs with the ability to flow naturally and achieve a return permeability of 90% or greater without the need for acidizing treatments. |
US07732373B2 |
Reversible thermosensitive recording medium, as well as reversible thermosensitive recording label, reversible thermosensitive recording member, image processing apparatus and image processing method
To provide a reversible thermosensitive recording medium comprising a support, a thermosensitive recording layer formed on the support, and a protective layer formed on the thermosensitive recording layer, wherein the thermosensitive recording layer contains an electron donative coloring compound and an electron acceptive compound, and the color tone reversibly changes depending on the temperature, and the protective layer contains a polymer of a composition containing two kinds of acrylate compounds selected from an acrylate compound having a pentaerythritol group and an acrylate compound having a dipentaerythritol group. |
US07732366B2 |
Honeycomb structure and exhaust gas purifying device
A honeycomb structure comprises a porous ceramic which is composed of several cells aligned across a cell wall longitudinally. The cell has either one end sealed. The gas permeability coefficient k of the cell wall is between about 0.5 μm2 and about 1.5 μm2. |
US07732351B2 |
Manufacturing method of semiconductor device and laser processing apparatus
In a manufacturing process of a semiconductor device, a manufacturing technique and a manufacturing apparatus of a semiconductor device which simplify a lithography step using a photoresist is provided, so that the manufacturing cost is reduced, and the throughput is improved. An irradiated object, in which a light absorbing layer and an insulating layer are stacked over a substrate, is irradiated with a multi-mode laser beam and a single-mode laser beam so that both the laser beams overlap with each other, and an opening is formed by ablation in part of the irradiated object the irradiation of which is performed so that both the laser beams overlap with each other. |
US07732350B2 |
Chemical vapor deposition of TiN films in a batch reactor
Titanium nitride (TiN) films are formed in a batch reactor using titanium chloride (TiCl4) and ammonia (NH3) as precursors. The TiCl4 is flowed into the reactor in temporally separated pulses. The NH3 can also be flowed into the reactor in temporally spaced pulses which alternate with the TiCl4 pulses, or the NH3 can be flowed continuously into the reactor while the TiCl4 is introduced in pulses. The resulting TiN films exhibit low resistivity and good uniformity. |
US07732347B2 |
Semiconductor device and fabrication process of semiconductor device
A method of fabricating a semiconductor device on a Si substrate includes a first step of forming an insulation film containing an oxide of Zr or Hf on a Si substrate, a second step of forming a gate electrode film on the insulation film, a third step of patterning the gate electrode film by an etching process, a fourth step of annealing, after the third step, the insulation film in a processing gas ambient containing halogen, and a fifth step of removing the insulation film applied with the annealing process. |
US07732346B2 |
Wet cleaning process and method for fabricating semiconductor device using the same
A wet cleaning process is provided. The wet cleaning process includes at least one first rinse process and a second rinse step. The first rinse step includes rinsing a substrate using deionized water containing CO2, and then draining the water containing CO2 to expose the substrate in an atmosphere of CO2. The second rinse step includes rinsing the substrate using deionized water containing CO2. |
US07732344B1 |
High selectivity etching process for metal gate N/P patterning
A method for fabricating a integrated circuit with improved performance is disclosed. The method comprises providing a substrate; forming a hard mask layer over the substrate; forming protected portions and unprotected portions of the hard mask layer; performing a first etching process, a second etching process, and a third etching process on the unprotected portions of the hard mask layer, wherein the first etching process partially removes the unprotected portions of the hard mask layer, the second etching process treats the unprotected portions of the hard mask layer, and the third etching process removes the remaining unprotected portions of the hard mask layer; and performing a fourth etching process to remove the protected portions of the hard mask layer. |
US07732342B2 |
Method to increase the compressive stress of PECVD silicon nitride films
Compressive stress in a film of a semiconductor device may be controlled utilizing one or more techniques, employed alone or in combination. A first set of embodiments increase silicon nitride compressive stress by adding hydrogen to the deposition chemistry, and reduce defects in a device fabricated with a high compressive stress silicon nitride film formed in the presence of hydrogen gas. A silicon nitride film may comprise an initiation layer formed in the absence of a hydrogen gas flow, underlying a high stress nitride layer formed in the presence of a hydrogen gas flow. A silicon nitride film formed in accordance with an embodiment of the present invention may exhibit a compressive stress of 2.8 GPa or higher. |
US07732338B2 |
Method of fabricating semiconductor device with reduced pitch
A method of fabricating a semiconductor device includes depositing a first film on a workpiece film so that a resist is formed on the first film, processing the first film with the resist serving as a mask, depositing a second film along the first film, processing the second film so that the second film is left only on a sidewall of the first film, depositing a third film on the substrate, exposing a sidewall of the second film, depositing a fourth film along the sidewall and an upper surface of the third film, removing the fourth film except for only its part on the sidewall of the second film, depositing a fifth film on the substrate, planarizing the second to fifth films so that the upper surfaces of the films are exposed, and processing the workpiece film while the second and fifth films serve as a mask. |
US07732336B2 |
Shallow trench isolation process and structure with minimized strained silicon consumption
A method of manufacturing an integrated circuit (IC) utilizes a shallow trench isolation (STI) technique. The shallow trench isolation technique is used in strained silicon (SMOS) process. The strained material is formed after the trench is formed. The process can be utilized on a compound semiconductor layer above a box layer. |
US07732333B2 |
Process for producing and apparatus for improving the bonding between a plastic and a metal
A semiconductor having a leadframe is disclosed. In one embodiment, a leadframe is disclosed to be fitted with a semiconductor chip and is to be encapsulated with a plastic compound has a metallic single-piece base body, to which an interlayer is applied. The interlayer has a surface including a matrix of islands of remaining material of substantially uniform height, with voids extending between said islands. |
US07732332B2 |
Chemical mechanical polishing method with inspection pre and post processing
The invention is directed to a chemical mechanical polishing process. The chemical mechanical polishing process comprises steps of providing a wafer disposed at a wafer handling region of a chemical mechanical polishing apparatus and then moving the wafer into a buffer region of the chemical mechanical polishing apparatus. A first detecting process is performed for obtaining a pre-polishing condition of the wafer by using a detector in the buffer region and the wafer is moved into a chemical mechanical polishing region and performing a chemical mechanical process. A second detecting process is performed, in the buffer region, for obtaining a post-polishing condition of the wafer by using the detector of the buffer region. |
US07732328B2 |
Method of fabricating semiconductor package structure
A semiconductor package structure and a method of fabricating the same are disclosed. A method of fabricating the semiconductor package structure can be characterized as including forming semiconductor chips on a semiconductor substrate. Each of the semiconductor chips includes chip pads. Through-vias are formed through the semiconductor chips. Redistribution structures and a chip selection interconnection layer are formed on the semiconductor chips, which connect the through-vias with the chip pads. The chip selection interconnection layers are patterned to form chip selection interconnection lines having different structures on at least one of the semiconductor chips. The semiconductor chips are stacked and electrically connected using the through-vias. |
US07732325B2 |
Plasma-enhanced cyclic layer deposition process for barrier layers
In one embodiment, a method for depositing materials on a substrate is provided which includes forming a titanium nitride barrier layer on the substrate by sequentially exposing the substrate to a titanium precursor containing a titanium organic compound and a nitrogen plasma formed from a mixture of nitrogen gas and hydrogen gas. In another embodiment, the method includes exposing the substrate to the deposition gas containing the titanium organic compound to form a titanium-containing layer on the substrate, and exposing the titanium-containing layer disposed on the substrate to a nitrogen plasma formed from a mixture of nitrogen gas and hydrogen gas. The method further provides depositing a conductive material containing tungsten or copper over the substrate during a vapor deposition process. In some examples, the titanium organic compound may contain methylamido or ethylamido, such as tetrakis(dimethylamido)titanium, tetrakis(diethylamido)titanium, or derivatives thereof. |
US07732319B2 |
Interconnection structure of integrated circuit chip
An interconnection structure includes an integrated circuit (IC) chip having internal circuitry and a terminal to electrically connect the internal circuitry to an external circuit, a passivation layer disposed on a top surface of the IC chip, the passivation layer configured to protect the internal circuitry and to expose the terminal, an input/output (I/O) pad, where the I/O pad includes a first portion in contact with the terminal and a second portion that extends over the passivation layer, and an electroless plating layer disposed on the I/O pad. |
US07732312B2 |
FUSI integration method using SOG as a sacrificial planarization layer
A method for making a transistor 20 that includes using a transition metal nitride layer 200 and/or a SOG layer 220 to protect the source/drain regions 60 from silicidation during the silicidation of the gate electrode 90. The SOG layer 210 is planarized to expose the transition metal nitride layer 200 or the gate electrode 93 before the gate silicidation process. If a transition metal nitride layer 200 is used, then it is removed from the top of the gate electrode 93 before the full silicidation of the gate electrode 90. |
US07732310B2 |
Sidewall memory with self-aligned asymmetrical source and drain configuration
A method of forming a semiconductor structure includes providing a semiconductor substrate and forming a memory cell at a surface of the semiconductor substrate. The step of forming the memory cell includes forming a gate dielectric on the semiconductor substrate and a control gate on the gate dielectric; forming a first and a second tunneling layer on a source side and a drain side of the memory cell, respectively; tilt implanting a lightly doped source region underlying the first tunneling layer, wherein the tilt implanting tilts only from the source side to the drain side, and wherein a portion of the semiconductor substrate under the second tunneling layer is free from the tilt implanting; forming a storage on a horizontal portion of the second tunneling layer; and forming a source region and a drain region in the semiconductor substrate. |
US07732304B2 |
Method of manufacturing semiconductor device
A method of manufacturing a semiconductor device according to embodiments includes forming an interlayer dielectric film with a damascene pattern over a semiconductor substrate having a lower metal wire. A seed layer may be formed over the interlayer dielectric film including the damascene pattern. Impurities generated during the formation of the seed layer be removed through an annealing process using H2. A copper wire may then be formed by filling the damascene pattern. |
US07732292B2 |
Bipolar transistor with self-aligned retrograde extrinsic base implant profile and self-aligned silicide
Disclosed is a method of forming a transistor in an integrated circuit structure that begins by forming a collector in a substrate and an intrinsic base above the collector. Then, the invention patterns an emitter pedestal for the lower portion of the emitter on the substrate above the intrinsic base. Before actually forming the emitter or associates spacer, the invention forms an extrinsic base in regions of the substrate not protected by the emitter pedestal. After this, the invention removes the emitter pedestal and eventually forms the emitter where the emitter pedestal was positioned. |
US07732290B2 |
Carbon nanotube transistor process with transferred carbon nanotubes
During fabrication of single-walled carbon nanotube transistor devices, a porous template with numerous parallel pores is used to hold the single-walled carbon nanotubes. The porous template or porous structure may be anodized aluminum oxide or another material. A gate region may be provided one end or both ends of the porous structure. The gate electrode may be formed and extend into the porous structure. |
US07732289B2 |
Method of forming a MOS device with an additional layer
A method of forming MOS devices is provided. The method includes providing a semiconductor substrate, forming a gate dielectric over the semiconductor substrate, forming a gate electrode over the gate dielectric, forming a source/drain region in the semiconductor substrate, forming an additional layer, preferably by epitaxial growth, on the source/drain region, and siliciding at least a top portion of the additional layer. The additional layer compensates for at least a portion of the semiconductor material lost during manufacturing processes and increases the distance between the source/drain silicide and the substrate. As a result, the leakage current is reduced. A transistor formed using the preferred embodiment preferably includes a silicide over the gate electrode wherein the silicide extends beyond a sidewall boundary of the gate electrode. |
US07732285B2 |
Semiconductor device having self-aligned epitaxial source and drain extensions
A method of forming a transistor with self-aligned source and drain extensions in close proximity to a gate dielectric layer of the transistor comprises forming a gate stack on a substrate, implanting a dopant into regions of the substrate adjacent to the gate stack, wherein the dopant increases the etch rate of the substrate and defines the location of the source and drain extensions, forming a pair of spacers on laterally opposite sides of the gate stack that are disposed atop the doped regions of the substrate, etching the doped regions of the substrate and portions of the substrate subjacent to the doped regions, wherein an etch rate of the doped regions is higher than an etch rate of the portions of the substrate subjacent to the doped regions, and depositing a silicon-based material in the etched portions of the substrate. |
US07732282B2 |
Transistor of the I-MOS type comprising two independent gates and method of using such a transistor
The transistor comprises a source and a drain separated by a lightly doped intermediate zone. The intermediate zone forms first and second junctions respectively with the source and with the drain. The transistor comprises a first gate to generate an electric field in the intermediate zone, on the same side as the first junction, and a second gate to generate an electric field in the intermediate zone, on the same side as the second junction. |
US07732276B2 |
Self-aligned patterning method by using non-conformal film and etch back for flash memory and other semiconductor applications
A method for fabricating a memory device with a self-aligned trap layer which is optimized for scaling is disclosed. In the present invention, a non-conformal film is deposited over the charge trapping layer to form a thick film on top of the core source/drain region and a pinch off and a void or a narrow channel at the top of the STI trench. An etch is performed on the non-conformal film to open pinch-off or widen the narrow channel in the non-conformal. The trapping layer is then completely or partially etched between the core cells. The non-conformal film is removed. And a top oxide is formed. The top oxide converts the remaining trap layer to oxide if the trapping layer is partially etched and thus isolate the trap layer. |
US07732270B2 |
Device having enhanced stress state and related methods
The present invention provides a semiconductor device having dual nitride liners, which provide an increased transverse stress state for at least one FET and methods for the manufacture of such a device. A first aspect of the invention provides a method for use in the manufacture of a semiconductor device comprising the steps of applying a first silicon nitride liner to the device and applying a second silicon nitride liner adjacent the first silicon nitride liner, wherein at least one of the first and second silicon nitride liners induces a transverse stress in a silicon channel beneath at least one of the first and second silicon nitride liner. |
US07732254B2 |
Semiconductor multi-package module having package stacked over die-up flip chip ball grid array package and having wire bond interconnect between stacked packages
A semiconductor multi-package module having stacked second and first packages, each package including a die attached to a substrate, in which the first and second package substrates are interconnected by wire bonding, and in which the first package is a flip chip ball grid array package in a die-up configuration. Also, a method for making a semiconductor multi-package module, by providing a first package including a first package substrate and having a die-up flip chip configuration, affixing a second package including a second package substrate an upper surface of the first package, and forming z-interconnects between the first and second package substrates. |
US07732252B2 |
Multi-chip package system incorporating an internal stacking module with support protrusions
The present invention provides a multi-chip package system that includes: providing a package substrate; attaching a base semiconductor die to the package substrate; connecting an interconnect between the base semiconductor die and the package substrate; and encapsulating at least portions of the package substrate, the base semiconductor die, and the interconnect with an encapsulant defining a support protrusion adjacent to the interconnect and substantially perpendicular to the package substrate, a cavity bounded by the support protrusion, and a gap linking the cavity to the edge of the encapsulant. |
US07732249B2 |
Organic EL light emitting display device and method of manufacturing the same
Disclosed is a method for manufacturing an organic EL light emitting display device, comprising forming an anode electrode above a substrate, forming an organic light emitting layer above the anode electrode, performing a fluorinating treatment on a surface of the organic light emitting layer, and forming a cathode electrode directly on the fluorinated surface of the organic light emitting layer. |
US07732245B2 |
Photodiode of CMOS image sensor and method for manufacturing the same
A photodiode of a CMOS image sensor and a method for manufacturing the same are provided, in which ions implanted in the vicinity of a device isolation film are prevented from being diffused into a photodiode region to reduce a dark current. The photodiode of a CMOS image sensor includes a heavily doped P-type semiconductor substrate, a lightly doped P-type epitaxial layer formed on the semiconductor substrate, a gate electrode formed on the epitaxial layer, a device isolation film and an N-type photodiode region formed in the epitaxial layer, an insulating film formed on the epitaxial layer to open a portion between the device isolation film and the photodiode region, and a heavily doped P-type diffusion region formed in the epitaxial layer between the device isolation film and the photodiode region. |
US07732240B2 |
Formation of through-wafer electrical interconnections and other structures using a thin dielectric membrane
Providing through-wafer interconnections in a semiconductor wafer includes forming a sacrificial membrane in a preexisting semiconductor wafer, depositing metallization over one side of the wafer so as to cover exposed portions of the sacrificial membrane facing the one side of the wafer, removing exposed portions of the sacrificial membrane facing the other side of the wafer, and depositing metallization over the other side of the wafer so as to contact the previously deposited metallization. Techniques also are disclosed for providing capacitive and other structures using thin metal membranes. |
US07732237B2 |
Quantum dot based optoelectronic device and method of making same
A method of forming an optically active region on a silicon substrate includes the steps of epitaxially growing a silicon buffer layer on the silicon substrate and epitaxially growing a SiGe cladding layer having a plurality of arrays of quantum dots disposed therein, the quantum dots being formed from a compound semiconductor material having a lattice mismatch with the silicon buffer layer. The optically active region may be incorporated into devices such as light emitting diodes, laser diodes, and photodetectors. |
US07732229B2 |
Formation of solar cells with conductive barrier layers and foil substrates
Methods and devices are provided for absorber layers formed on foil substrate. In one embodiment, a method of manufacturing photovoltaic devices may be comprised of providing a substrate comprising of at least one electrically conductive aluminum foil substrate, at least one electrically conductive diffusion barrier layer, and at least one electrically conductive electrode layer above the diffusion barrier layer. The diffusion barrier layer may prevent chemical interaction between the aluminum foil substrate and the electrode layer. An absorber layer may be formed on the substrate. In one embodiment, the absorber layer may be a non-silicon absorber layer. In another embodiment, the absorber layer may be an amorphous silicon (doped or undoped) absorber layer. Optionally, the absorber layer may be based on organic and/or inorganic materials. |
US07732221B2 |
Hybrid MRAM array structure and operation
This invention relates to MRAM technology and new variations on MRAM array architecture to incorporate certain advantages from both cross-point and 1T-1MTJ architectures. The fast read-time and higher signal-to-noise ratio of the 1T-1MTJ architecture and the higher packing density of the cross-point architecture are both exploited by combining certain characteristics of these layouts. A single access transistor 16 is used to read the multiple MRAM cells in a segment of a column, which can be stacked vertically above one another in a plurality of MRAM array layers arranged in a “Z” axis direction. |
US07732216B2 |
System and method for testing chromatography media and devices
Methods for testing the chromatography type and/or the integrity of a chromatography membrane or monolith, preferably, for testing the chromatography type and integrity of a chromatography device comprising a chromatography membrane or chromatography monolith while the membrane or monolith is sealed in a housing, are disclosed. |
US07732214B2 |
Differentiation of acute and chronic myocardial necrosis in symptomatic patients
The present invention provides methods for diagnosing an acute cardiovascular event and for differentiating between an acute cardiovascular event and chronic heart failure based on measuring a cardiac troponin and a natriuretic peptide in a sample from a patient and comparing the measured amounts with reference amounts, as well as devices and kits for carrying out such methods. |
US07732212B1 |
Method of management of analytical data and system for management of analytical data
A communication unit (12) of a service center (10) transmits and receives information such as analysis information to and from a plurality of automatically analyzing apparatuses (100). A database (16) stores the information such as the analysis information. An analysis information parsing unit (14) evaluates and parses results of analyses made by the automatically analyzing apparatuses using the analysis information stored in the database. The reagent parameter registration unit (18) registers information on reagents in the database (16). The communication unit (12), responsive to a request from an automatically analyzing apparatus, retrieves information on analysis parameters related to managed reagents from the database for transfer to the automatically analyzing apparatus. In this way, analysis parameters can be readily set for a testing item to be analyzed using a reagent. |
US07732204B2 |
Cell culture method and apparatus for mechanically stimulating cells
A cell culture assembly and a method for culturing cells that provide mechanical stimulation to cells. The cell culture assembly can include a flow chamber positioned in a fluid path and a support comprising cells positioned within the flow chamber to expose the cells to the fluid path. The cell culture assembly can further include a means for producing a steady flow of fluid in the fluid path, and a means for producing an oscillatory flow of fluid in the fluid path simultaneously with producing the steady flow of fluid in the fluid path to mechanically stimulate the cells. The method can include transporting fluid in the fluid path at a substantially steady flow rate, and transporting fluid in the fluid path at a substantially oscillatory flow rate simultaneously with transporting fluid in the fluid path at a substantially steady flow rate. |
US07732203B2 |
Method for transdifferentiating mesenchymal stem cells into neuronal cells
This inventive discloses a method for transdifferentiating mesenchymal stem cells into neuronal cells, which comprises increasing the level of a basic helix-loop-helix (bHLH) transcription factor in the mesenchymal stem cells, said cells being useful in cell therapy or gene therapy for treating brain neurological diseases such as Parkinson's disease, Alzheimer disease, Hungtington's disease, amyotrophic lateral sclerosis, cerebral paralysis and brain ischemia; and spine disfunction caused by a traumatic injury. |
US07732198B2 |
Device for the regeneration of tissue, specifically bone regeneration by means of callus distraction
The device incorporates a structurally stable membrane (4, 4′, 34, 35) that incorporates a surface (15) to be bonded to a tissue to be regenerated, specifically a vital bone (2, 22, 38, 39). Means (9, 5, 6, 25, 36) are additionally provided whereby the membrane (4, 4′, 24, 35) is movable for the regeneration with a certain pulling force and speed. According to the invention the membrane (4, 4′, 24, 35) has, on its surface facing the tissue or bone, means (16) for the biological anchoring and adhesion for tissue or bone cells. These means (16) for the biological anchoring of tissue cells are specifically bone cells, protein molecules and/or osteoblasts (17), as well as indentations (45, 46, 48) and surface peaks (50) of the membrane. |
US07732195B2 |
Tethered vectors for cell surface immunoglobulin display
Disclosed are mammalian cell surface display vectors for isolating and/or characterizing immunoglobulins and various uses thereof. |
US07732185B2 |
Plasmid having response to dioxins, transgenic cell for measuring dioxins, dioxins sensing method and biosensor using the same
A plasmid comprising a gene, which is reactive with dioxins and/or polycyclic aromatic hydrocarbons to thereby be activated (hereinafter referred to as DRE gene), and a secretory marker protein expressing gene disposed understream of the DRE gene. Further, there is developed a transgenic cell having this plasmid introduced therein which when exposed to dioxins and/or polycyclic aromatic hydrocarbons, secretes a secretory marker protein. Still further, there is developed a biosensor utilizing this transgenic cell. |
US07732184B2 |
Liquid starter cultures having an improved storage stability and use thereof
Liquid microbial starter culture that retains its initial metabolic activity during storage for extended periods of time. Such liquid starter cultures are useful in the manufacturing of food and feed products. Starter cultures of the invention include culture of lactic acid bacteria, e.g. Lactococcus species. |
US07732183B2 |
Method for refolding enzymes
The invention provides methods for efficient recombinant expression, refolding, and purification of Beta-site APP cleaving enzyme (BACE) polypeptides. In various aspects, the method includes the steps of expressing a recombinant construct in bacteria, dissolving inclusion bodies with a denaturant at high pH in the presence of a reducing agent, diluting the solubilized BACE polypeptide in an aqueous solution at a temperature of about 1° C. to 15° C., and incubating the diluted sample at a temperature of about 4° C. to 15° C. until the recombinant BACE polypeptide folds into an active enzyme. |
US07732172B2 |
Process for producing glycolic acid from formaldehyde and hydrogen cyanide
A process is provided for producing glycolic acid from formaldehyde and hydrogen cyanide. More specifically, heat-treated formaldehyde and hydrogen cyanide are reacted to produce glycolonitrile having low concentrations of impurities. The glycolonitrile is subsequently converted to an aqueous solution of ammonium glycolate using an enzyme catalyst having nitrilase activity derived from Acidovorax facilis 72W (ATCC 57746). Glycolic acid is recovered in the form of the acid or salt from the aqueous ammonium glycolate solution using a variety of methods described herein. |
US07732168B2 |
Fusion partner for production of monoclonal rabbit antibodies
The invention provides a rabbit-derived immortal B-lymphocyte capable of fusion with a rabbit splenocyte to produce a hybrid cell that produces an antibody. The immortal B-lymphocyte does not detectably express endogenous immunoglobulin heavy chain and may contain, in certain embodiments, an altered immunoglobulin heavy chain-encoding gene. A hybridoma resulting from fusion between the subject immortal B-lymphocyte and a rabbit antibody-producing cell is provided, as is a method of using that hybridoma to produce an antibody. The subject invention finds use in a variety of different diagnostic, therapeutic and research applications. |
US07732166B2 |
Detection method for human pappilomavirus (HPV) and its application in cervical cancer
Embodiments of the invention provide methods, assays, and kits for detecting HPV infection and HPV associated epithelial cell abnormalities, most notably those associated with pre-malignant and malignant epithelial cell lesions. Detection of HPV DNAs, genomes, and/or oncoproteins by nucleic acid hybridization assays and immunological assays can be used in early clinical screening for HPV infection and diagnosis for cervical cancer. The polypeptides, recombinant proteins, antibodies, nucleic acids, and various detection methods thereof are particularly useful for diagnosing carcinomas of the uterine cervix and those at risk of developing cervical cancer. |
US07732159B2 |
Assays for cancer patient monitoring based on levels of analyte components of the plasminogen activator system in body fluid samples
The present invention describes clinically and medically important methods of examining, screening over time, and monitoring the outcome of a cancer patient who is undergoing treatment or therapy for his or her disease. More specifically, the invention provides a method of monitoring the progression of disease, or the effectiveness of cancer treatment, in a cancer patient by measuring the levels of one or more analytes of the plasminogen activator (uPA) system, namely, uPA, PAI-1 and the complex of uPA:PAI-1, in a sample taken from the cancer patient, preferably, before treatment, at the start of treatment, and at various time intervals during treatment. As a result of performing the method, an increase or elevation in the levels of one or more of the PA system analytes in the cancer patient compared with the levels one or more of the respective PA system analytes in normal control individuals serves as an indicator of cancer advancement or progression and/or a lack of treatment effectiveness for the patient. |
US07732158B2 |
Method of high-speed detection for biological analyte
This invention provides a method to detect analyte which comprises preparing fine particles which have a chargeable group in their core and a hydrophilic polymer chain in their shell; obtaining an agglutinated matter by forming a biologically specific bond between a specific residue on the surface of fine particles and analyte, and by simultaneously forming a bond by the electrostatic interaction between impure protein and said particles; and subsequently cleaving only the latter bond by raising ionic intensity. Thus, this invention provides a method to detect analyte with rapidity and high sensitivity with use of agglutination reaction. |
US07732150B2 |
Lambdoid bacteriophage vectors for expression of foreign proteins
Lambdoid phage comprising a matrix of proteins encapsulating a genome encoding first and second polypeptides of an autogenously assembling receptor and a receptor comprised of the first and second polypeptides surface-integrated into the matrix via a lambdoid phage tail protein matrix anchor domain fused to at least one of the polypeptides. |
US07732146B2 |
Method for screening an agent that modulates activity of macrophage migration inhibitory factor
Inhibitors of MIF are provided which have utility in the treatment of a variety of disorders, including the treatment of pathological conditions associated with MIF activity. The inhibitors of MIF have the following structures: including stereoisomers, prodrugs and pharmaceutically acceptable salts thereof, wherein n, R1, R2, R3, R4, X, Y and Z are as defined herein. Compositions containing an inhibitor of MIF in combination with a pharmaceutically acceptable carrier are also provided, as well as methods for use of the same. |
US07732145B2 |
Method and devices for rapid diagnosis of foot-and-mouth disease
A rapid immunoassay method and apparatus for detecting foot and mouth disease virus are disclosed. The method and test device permit pen-side testing of animals and provide test results within a relatively short time period. In a preferred embodiment, the method and apparatus provide a means for differentiating between FMDV-infected and FMDV-vaccinated animals. |
US07732142B2 |
Sequences diagnostic for shrimp pathogens
Primers have been isolated that are diagnostic for the detection of the infectious hypodermal and hematopoietic necorsis virus (IHHNV). The primers are based on a new portion of the IHHNV genome and may be used in primer directed amplification or nucleic acid hybridization assay methods. |
US07732141B2 |
Methods for evaluating drug-resistance gene expression in the cancer patient
The methods of the invention detect in a qualitative or quantitative fashion drug-resistance RNA and DNA in blood plasma, serum, and other bodily fluids. The methods of the invention thereby enable the assessment of drug resistance in a neoplasm without the requirement of a tissue biopsy. The inventive methods are useful for the evaluation, monitoring, and selecting of drug treatment regimens, and for determining a predisposition for or prognosis of chemoresistant neoplastic disease. |
US07732137B2 |
Selecting animals for desired genotypic or potential phenotypic properties
The invention relates to methods to select animals, such as mammals, particularly domestic animals, such as breeding animals or animals destined for slaughter, for having desired genotypic or potential phenotypic properties, in particular, related to muscle mass and/or fat deposition lean meat, lean back fat, sow prolificacy and/or sow longevity. Provided is a method for selecting an animal for having desired genotypic or potential phenotypic properties comprising testing the animal, a parent of the animal or its progeny for the presence of a nucleic acid modification affecting the activity of an evolutionary conserved CpG island, located in intron 3 of an IGF2 gene and/or for the presence of a nucleic acid modification affecting binding of a nuclear factor to an IGF2 gene. |
US07732136B2 |
Device for thermo-dependent chain reaction amplification of target nucleic acid sequences, measured in real-time
The present invention concerns a device for amplifying target nucleic acids, reaction cartridges for use in the device, and modes of use of the device. |
US07732126B2 |
Integrin CD18 is a novel stromal stem cell marker and functions to promote osteogenesis
The present invention is directed to a new bone marrow stromal stem cell (BMSSC) marker, CD18, for use in selecting a population of cells enriched in BMSSCs, from bone marrow cells, adipose cells, or peripheral blood. The invention is further directed to methods for selecting a population of cells enriched in BMSSCs based on the selective expression of CD18 on their surface, using techniques known in the art such as fluorescent assisted cell sorting, an immunomagnetic method, flow microfluorimetry, immunofluorescence, immunoperoxidase staining, radioimmunoassay and immunoaffinity chromatography. The invention is further directed to the BMSSCs isolated based on CD18 expression, and their use to treat various diseases. In one aspect, the HMSSCs are transformed with a vector having a normal gene for CD18, and the transformed BMSSCs are administered to treat bone degenerative diseases and diseases of bone involving abnormal expression of CD18 expression of CD18. |
US07732120B2 |
Method for making soft pellicles
The present invention relates generally to the fields of semiconductor lithography. More particularly, it concerns methods, compositions, and apparatuses relating to 157 nm and 193 nm soft pellicles and the use of perfluorinated polymers in the creation of pellicles. |
US07732119B2 |
Photosensitive self-assembled monolayer for selective placement of hydrophilic structures
A photosensitive monolayer is self-assembled on an oxide surface. The chemical compound of the photosensitive monolayer has three components. A first end group provides covalent bonds with the oxide surface for self assembly on the oxide surface. A photosensitive group that dissociates upon exposure to ultraviolet radiation is linked to the first end group. A second end group linked to the photosensitive group provides hydrophobicity. Upon exposure to the ultraviolet radiation, the dissociated photosensitive group is cleaved and forms a hydrophilic derivative in the exposed region, rendering the exposed region hydrophilic. Carbon nanotubes or nanocrystals applied in an aqueous dispersion are selectively attracted to the hydrophilic exposed region to from electrostatic bonding with the hydrophilic surface of the cleaved photosensitive group. |
US07732118B2 |
Negative-working imageable elements and methods of use
A radiation-sensitive composition includes a radically polymerizable component, initiator composition, a radiation absorbing compound, and a polymeric binder having recurring units that are derived from various ethylenically unsaturated polymerizable monomers provided that at least 40 mol % of the recurring units have a tertiary carbon atom in the backbone and the rest of the recurring units have a secondary or quaternary carbon atom in the backbone. This composition can be used to provide negative-working imageable elements that can be imaged and developed to provide lithographic printing plates that have desired imaging speed and excellent run length without the need for a post-exposure backing step. |
US07732115B2 |
Toners comprising modified pigments and processes for preparing the same
The present invention relates to toner compositions comprising a resin and a colorant. Various embodiments of the colorant used in the toner compositions are disclosed, including a modified pigment comprising a pigment having attached at least one organic group having the formula -X-I, wherein X, which is directly attached to the pigment, represents an arylene or heteroarylene group, or an alkylene group, and I represents a non-polymeric group comprising at least one ionic group or at least one ionizable group. Processes for preparing toner compositions are also described. |
US07732108B2 |
Method for OPC model generation
A method for generating or refining an OPC model for use in wafer fabrication. A predetermined feature layout is used to prepare a mask for use in, for example, a photolithographic process. The mask is used to create structures corresponding to mask features on a semiconductor wafer using the mask. Measurements of the actual mask features and wafer features may then be assessed and correlated, and the results used to generate an OPC model or refine an existing one. In addition, the OPC may be used to simulate a fabrication operation by applying the OPC tool to a predetermined layout to produce a mask image and a wafer image, and then comparing the predetermined layout to the simulated wafer image to determine at least one fitness value. |
US07732107B2 |
Mask pattern correction device, method of correcting mask pattern, light exposure correction device, and method of correcting light exposure
In view of realizing a lithographic process which makes it possible to estimate and correct flare with an extremely high accuracy, and causes only an extremely small dimensional variation in width, over the entire portion not only of a single shot region, but also of a single chip region, a mask pattern correction device of the present invention has a numerical aperture calculation unit calculating, for every single shot region, flare energy for a mask pattern corresponding to a transferred pattern, based on an exposure layout of a plurality of shot regions, or more specifically, while considering flare from a plurality of shot regions located around every single shot region. |
US07732094B2 |
Mesoporous carbon composite, method of preparing the same, and fuel cell using the mesoporous carbon composite
A mesoporous carbon composite includes mesoporous carbon having mesopores; a conductive polymer coated on only an outer surface of the mesoporous carbon; and an organic electrolyte. The mesoporous carbon composite may be prepared by impregnating an ordered mesoporous silica (OMS) with a mixture comprising a carbon precursor, an acid, and a solvent; heat-treating and carbonizing the impregnated OMS to form an OMS-carbon composite; mixing the OMS-carbon composite with a monomer that forms a conductive polymer and a solvent to provide a surface of the OMS-carbon composite with the monomer; polymerizing the monomer to obtain a conductive polymer-coated OMS-carbon composite; removing the OMS from the composite to obtain a conductive polymer-coated mesoporous carbon; and doping the conductive polymer-coated mesoporous carbon with an organic electrolyte. A supported catalyst and a fuel cell include the mesoporous carbon composite. |
US07732091B2 |
Lithium ion secondary battery
A lithium ion secondary battery in which at least one step portion is formed on an upper surface of a cap plate, and at least one step portion is formed on a lower or first surface of a battery part opposite to the upper or first surface of the cap plate so that the at least two step portions are complementary. The complementary step portions of the cap plate of the bare cell and the battery part provided at an upper part of the cap plate result in easy coupling of the battery part to the bare cell and stable maintenance of the coupling between the battery part and the bare cell. The coupling structure results in greater ease in performing subsequent manufacturing processes and protects the bare cells coupled to the battery part from dislodging. |
US07732086B2 |
Bonded polyimide fuel cell package
Described herein are processes for fabricating microfluidic fuel cell systems with embedded components in which micron-scale features are formed by bonding layers of DuPont Kapton™ polyimide laminate. A microfluidic fuel cell system fabricated using this process is also described. |
US07732081B2 |
Hydrophilic/hydrophobic patterned surfaces and methods of making and using the same
One embodiment includes a substrate having a plurality of molecular chains, each chain comprising a hydrophilic group, a hydrophobic segment, and a reversible crosslinker. |
US07732080B2 |
Catalytic membranes for CO oxidation in fuel cells
A hydrogen permeable membrane, which includes a polymer stable at temperatures of about 200 C having clay impregnated with Pt or Au or Ru or Pd particles or mixtures thereof with average diameters of less than about 10 nanometers (nms) is disclosed. The membranes are useful in fuel cells or any device which requires hydrogen to be separated from carbon monoxide. |
US07732074B2 |
Fuel cell system
The fuel cell system is equipped with a fuel cell for generating power by chemically reacting a fuel gas supplied to an anode and an oxygen containing gas supplied to a cathode; an anode off-gas discharge mechanism for discharging an anode off-gas from the anode; a combustion heater for combusting a combustion gas; a dilution mechanism for diluting the anode off-gas by the oxygen containing gas; a first path for introducing the anode off-gas into the combustion heater; a first flow rate adjustment mechanism for adjusting an introduction amount of the anode off-gas into the first path; a second path for introducing the anode off-gas into the dilution mechanism; a second flow rate adjustment mechanism for adjusting an introduction amount of the anode off-gas into the second path; and a control mechanism for controlling actuations of the first flow rate adjustment mechanism and the second flow rate adjustment mechanism. |
US07732065B2 |
Anthracene derivative compound and organic light-emitting device including the same
Provided are an anthracene derivative compound represented by Formula 1 below and an organic light-emitting device using the same: wherein Ar1 and Ar2 are each independently aromatic groups, R1 and R2 are each independently substituent groups, and X is a heteroatom or substituted heteroatom. The use of the anthracene derivative compound enables to produce an organic light-emitting device with better driving voltage, brightness, efficiency, and color purity. |
US07732064B2 |
Anthracene derivative, and light-emitting element, light-emitting device, and electronic appliance using the same
It is an object of the present invention to provide a light-emitting substance which is resistant to repetition of an oxidation reaction. It is another object of the invention to provide a light-emitting element which is resistant to repetition of a reduction reaction. An aspect of the present invention is an anthracene derivative represented by a general formula (1). In the general formula (1), R1 represents hydrogen or an alkyl group having 1 to 4 carbon atoms; R2 represents any one of hydrogen, an alkyl group having 1 to 4 carbon atoms, and an aryl group having 6 to 12 carbon atoms, which may have a substituent or no substituent; Ph1 represents a phenyl group, which may have a substituent or no substituent; and X1 represents an arylene group having 6 to 15 carbon atoms. |
US07732059B2 |
Heat exchanger tubing by continuous extrusion
A heat exchanger tube having enhanced corrosion resistance and improved resistance to high burst pressures. The heat exchanger tube comprises an aluminum alloy that consists essentially of about 0.01-1.5% silicon, up to about 1.2% copper, up to about 2.0% manganese, about 0.01-1.0% iron, about 0.01-5.0% zinc, up to about 0.02% titanium and the balance substantially aluminum and incidental elements and impurities. |
US07732038B2 |
Electromagnetic wave shielding filter
An electromagnetic wave shielding filter 10 comprises a transparent substrate 1, and a mesh layer 3 containing an electrically conductive layer 2, formed on the transparent substrate 1 with a transparent adhesive layer 9. A transparent colored resin layer 4 containing a coloring agent is formed on the mesh layer 3, with a transparent barrier layer 5 interposed between the two layers. An anticorrosive layer 6 and a blackening layer 7 are formed on the electrically conductive layer 2 in the mesh layer 3. The transparent colored resin layer 4 also serves as an adhesive layer, and a functional layer 8, such as an optical filter, a protective sheet, or a display front substrate, is further laminated to the transparent colored resin layer 4. |
US07732032B2 |
Lightweight, fiber-reinforced cementitious panels
Lightweight, fiber reinforced, cementitious panels possessing exceptional toughness for use as building components in applications such as roofing elements, siding elements, framing and sheathing elements, and substrate elements for installation of floor finishes in residential and other building construction types. The panels employ a continuous phase resulting from the curing of an aqueous mixture of inorganic binder, PVA fibers and lightweight filler. The inorganic binder may be, for example, hydraulic cement alone, or a combination of hydraulic cement and pozzolan/s, or a combination of hydraulic cement, alpha hemihydrate, active pozzolan and optionally lime. The PVA fibers reinforce the continuous phase and are randomly distributed throughout the composite. Typical panels of the invention have a density of 60-85 pcf. |
US07732011B2 |
Method to produce tone-controlled colors in colorless crystals
The embodiments of present invention provide method for imparting tone-controlled colors into colorless crystals such as gemstones or decorative objects by coating a atomically mixed thin film comprising of a color causing reagent and a toner material onto the surface of colorless gemstones or transparent crystals and subjecting them to a heat treatment to produce colors of desired shades in the crystals. The method employed is radiation-free, eco-friendly and avoid the use of any hazardous material. The method highlights that controlling the amount of toner material could easily control the shade of color induced by the colorant material. The coating of atomically mixed single film onto the surface of crystals results in reduction of diffusion time significantly at a reasonable temperature, to impart colors to crystals such as gemstones and colorless decorative objects. |
US07731978B2 |
Mutant forms of streptolysin O
Forms of GAS25 (streptolysin O) which are not toxic but which still maintain the ability to induce protection against S. pyogenes are useful in vaccine compositions to induce protection against S. pyogenes. |
US07731975B2 |
Chimeric filovirus glycoprotein
Chimeric GP molecules were constructed which contain portions of both the EBOV and MBGV GP proteins by swapping the subunits between EBOV and MBGV. The chimeric molecules were cloned into an alphavirus replicon which offers the advantage of high protein expression levels in mammalian cells and is a proven vaccine vector. These chimeric molecules fully protected guinea pigs from MBGV challenge, and conversely protected the animals from EBOV challenge. These results indicate that a protective epitope resides within the GP2 subunit of the MBGV GP protein and at least partially within the GP2 subunit of the EBOV GP protein. Additionally these results show that a construction of a single-component bivalent vaccine protective in guinea pigs is achievable. |
US07731968B2 |
Topical delivery of vaccines
The present invention provides improved methods for delivery of substances into the skin. It has been discovered that delivery of substances such as nucleic acids, amino acids, amino acid derivatives, peptides and polypeptides simultaneously with abrasion of the skin enhances delivery and the biological response as compared to application of the substance to previously abraded skin. |
US07731966B2 |
Monoclonal antibodies against β3 integrins
Monoclonal antibodies prepared against platelet β3 integrin useful in antithrombotic therapy or in models of thrombosis, thrombocytopenia, and anti-angiogenesis. The antibodies are prepared using β3 integrin deficient (β3−/−) mice immunized against platelets or β3 integrin fragments. |
US07731964B2 |
Antibodies specific for phosphorylated insulin receptor substrate-1/2 (Ser1101/Ser1149) and uses thereof
The invention discloses newly-discovered phosphorylation sites in human IRS-1 and IRS-2, serine 1101 (Ser1101) and serine 1149 (Ser1149) respectively, and provides antibodies, both polyclonal and monoclonal, that selectively bind to IRS-1 and/or IRS-2 when phosphorylated at these respective sites, but do not bind to IRS-1 and/or IRS-2 when not phosphorylated at these respective sites. The sites are relevant to insulin-resistance in type 2 diabetes. Also provided are methods for determining the phosphorylation of IRS-1/2 or activity of PKC theta in a biological sample, by using a detectable reagent, such as the disclosed antibodies, that binds to IRS-1/2 only when phosphorylated at Ser1101/Ser1149. Kits comprising the phosphor-IRS-1/2 (Ser1101/1149) antibodies of the invention are also provided. |
US07731963B2 |
TWEAK receptor agonists as anti-angiogenic agents
The present invention relates to methods of modulating angiogenesis and inhibiting tumor progression by using TWEAK receptor (Fn14) agonists. In particular, methods for inhibiting angiogenesis are disclosed. |
US07731962B2 |
Anti-ADDL monoclonal antibody and use thereof
The present invention relates to antibodies that differentially recognize multi-dimensional conformations of Aβ-derived diffusible ligands, also known as ADDLs. The antibodies of the invention can distinguish between Alzheimer's Disease and control human brain extracts and are useful in methods of detecting ADDLs and diagnosing Alzheimer's Disease. The present antibodies also block binding of ADDLs to neurons, assembly of ADDLS, and tau phosphorylation and are there useful in methods for the preventing and treating diseases associated with soluble oligomers of amyloid β 1-42. |
US07731961B1 |
Methods of increasing muscle mass or muscle strength using antibody inhibitors of GDF-8
The disclosure provides novel antibodies against growth and differentiation factor-8 (GDF-8), including antibody fragments, which inhibit GDF-8 activity in vitro and in vivo. The disclosure also provides methods for diagnosing, preventing, or treating degenerative disorders of muscle, bone, or insulin metabolism. |
US07731959B2 |
Antagonists of neuropilin receptor function and use thereof
The present invention relates to antagonists of neuropilin receptor fuction and use thereof in the treatment of cancer, particularly metastatic cancer, and angiogenic diseases. |
US07731958B2 |
Use of bromelain for the treatment of inflammatory diseases and for adjuvant therapy during wound healing processes
The present application pertains to the use of bromelain preparing a medicament for increasing the IL-(8) level in an individual so as to reduce or prevent inflammation in said individual and as an adjuvant therapy during wound healing processes. |
US07731955B2 |
Interleukin-6 suppressive agent
An interleukin-6 suppressive agent comprising lactoperoxidase as an active ingredient is used as a pharmaceutical preparation or the like for prevention and/or therapy of a disease caused by production of interleukin-6, such as thrombocytosis, myeloma, Castleman syndrome, rheumatoid arthritis, or influenza-virus infectious disease. |
US07731951B2 |
Viruses for the treatment of cellular proliferative disorders
Methods for treating cell proliferative disorders by administering virus to proliferating cells having an activated Ras-pathway are disclosed. The virus is administered so that it ultimately directly contacts proliferating cells having an activated Ras-pathway. Proliferative disorders include but are not limited to neoplasms. The virus is selected from modified adenovirus, modified HSV, modified vaccinia virus and modified parapoxvirus orf virus. Also disclosed are methods for treating cell proliferative disorders by further administering an immunosuppressive agent. |
US07731942B2 |
Cosmetic treatment for body-modelling with sun protection and modelling kit
The invention relates to a method for body shaping by means of a sun-protection agent and a corresponding cosmetic product. The inventive method consists in pre-treating by means of a preliminary product containing a caffeine, algae extract, pineapple extract, radical scavenger, copper gluconate, silylpropionic acid and a melanin-stimulating amino acid-containing agent, in subsequently treating by a main product containing, apart from an UVA- and UVB-Filter, at an ratio ranging from 30:70 to 70:30, a green coffee bean oil whose radical scavenger content is 30-60% less than this of the preliminary agent and in post-treating by means of an after-product which comprises the preliminary product constituents and whose silylpropionic acid content is of 2 to 10 times the content of the preliminary product. |
US07731941B2 |
Staining composition for staining an ophthalmic membrane
A staining composition for staining an ophthalmic membrane when performing the ophthalmic membrane removal, wherein the staining composition comprises a Brilliant Blue G (BBG) derivative as a primary component. |
US07731935B2 |
Steam reforming
An apparatus for steam reforming of hydrocarbons comprises a heat exchange reformer having disposed within a plurality of vertical catalyst-filled tubes, through which a gas mixture comprising hydrocarbon and steam may be passed, and to which heat may be transferred by means of a heat exchange medium flowing around the external tube surfaces, wherein heat exchange adapting means are provided within the reformer so that the tubes have a zone of lower heat exchange extending from the bottom of the catalyst up to 25% of the catalyst depth with no heat exchange enhancement means provided in that zone. A process for steam reforming of hydrocarbons employs this apparatus. |
US07731931B2 |
Storage materials for hydrogen and other small molecules
This invention relates to adsorbents useful for storing hydrogen and other small molecules, and to methods for preparing such adsorbents. The adsorbents are produced by heating carbonaceous materials to a temperature of at least 900° C. in an atmosphere of hydrogen. |
US07731930B2 |
Carbon nanotube assembly and manufacturing method thereof
A method for manufacturing a carbon nanotube assembly including the steps of: forming metallic fine particles, having a predetermined particle diameter, on a substrate; heating the metallic fine particles to a predetermined temperature of 300° C. to 400° C. in a reducing atmosphere to cause reduction at surfaces thereof; heating the metallic fine particles to a predetermined reaction temperature in a reactor; and introducing an organic compound vapor into the reactor to grow carbon nanotubes on the metallic fine particles in such a way that a time during which the temperature of the metallic fine particles exceeds 450° C. is 600 seconds or fewer for the period of time before the growth of the carbon nanotubes is started after the heating of the metallic fine particles is started. |
US07731925B2 |
Process for reducing agent control in an exhaust gas aftertreatment system
Methods of reducing agent control in an exhaust gas aftertreatment system of a combustion engine with an exhaust gas pipe in which in the direction of flow of the exhaust gas there is an SCR catalyzer. A reducing agent generating system has an NOx and CO/H2 generating unit, an oxidation catalyzer, and a combined NOx storage/ammonia generating unit in the standard gas path of the reducing agent generating system. Ammonia is introduced as a reducing agent for the reduction of nitric oxides before the SCR catalyzer of the reducing agent generating system. Precursor materials for generation of ammonia are directed at least temporarily to the NOx and CO/H2 generating unit through a fuel feed and an air feed. A CO/H2 reducing agent stream is temporally modulated during a rich phase. A CO/H2 concentration is primarily held constant at a high level. |
US07731914B2 |
Ozone infection control device
An infection control device includes a plurality of air inlets spaced around the device's peripheral skirt. A negative ion ozone generator having a plurality of spaced pointed projections is inwardly of the peripheral skirt with a ground disk inwardly of the generator. Air flows through the inlets to the generator, to the disk and to a catheter exit site. |
US07731910B2 |
Microfluidic mixing assembly
A microfluidic mixing assembly includes at least first and second liquid sources, a microfluidic manifold, a first capillary valve between the first liquid source and the manifold, and a second capillary valve between the second liquid source and the manifold, wherein the first capillary valve is configured to open and provide a first liquid flow to the microfluidic manifold in response to an external force and the second capillary valves is configured to be opened by the first liquid flow. |
US07731909B1 |
Reaction surface array diagnostic apparatus
A reaction surface array diagnostic apparatus and method of making the same includes a substrate carrying a plurality of reaction surfaces, a plate and a gasket, each having a plurality of through bores, alignable with one of the reaction surfaces and forming a fluid tight well about each reaction surface when the gasket and the plate are sealingly affixed to the substrate to form a stack. Clamp members engage opposite side edges of a stack to compress the gasket. A plurality of side-by-side disposed clamped stacks of plates, gaskets and substrates are mounted in a tray in the standard footprint of a microtiter plate. Alternately, the plate and the gasket are combined into a single plate formed of a flexible material having an adhesive on one surface. |
US07731904B2 |
Method for making probe support and apparatus used for the method
A liquid discharging device includes a plurality of liquid discharge sections. Each liquid discharge section includes a reservoir, a nozzle that discharges a solution supplied from the reservoir, and discharge energy generating means that generates energy to discharge the solution from the nozzle. The number of the liquid discharge sections corresponds to the number of probe types to be formed. The nozzles are two-dimensionally arranged. Using this liquid discharging device, probe liquids are discharged from the corresponding reservoirs onto a solid-phase substrate to form a predetermined two-dimensional probe array of high-purity probes on the substrate. This process exhibits high reproducibility and processability, and the resulting probe array has high array density. |
US07731893B2 |
Method for making anodes for electrolytic capacitor with high volumetric efficiency
A method for manufacturing valve metal anodes of electrolytic capacitors by deoxidizing the anodes using Mg vapor in a deoxidizing furnace, removing the anodes from deoxidizing furnace, placing them in sintering furnace, sintering at temperature lower than the temperature conventionally used for sintering in vacuum, and leaching of Mg oxide off the anode surface. The process limits free oxygen and improves morphology of valve metal anodes, which results in improved performance of electrolytic capacitors with these anodes. The process does not require any special equipment or maintenance operations and, thereby, is highly productive due to performing deoxidizing and sintering separately in traditional deoxidizing and sintering furnaces. |
US07731883B2 |
Method for making a tread assembly
A method for making an article of footwear is disclosed. The method can include a number of steps where various molds are used to attach or mold a tread element onto a substrate or matrix lining. The tread element can be formed by compressing a rubber block between various molding members to liquefy and cause the resulting rubber material to flow into at least one lug cavity disposed near the matrix lining. The rubber material eventually enters the lug cavity and becomes attached to the matrix lining. |
US07731882B2 |
Connection between members
A method for preparing a more reliable connection between two members (2, 4) is provided. The method involves the use of a gas-removal layer (6), which allows for gas transport in a number of overall directions in a plane of the gas-removal layer. The gas-removal layer comprises a resin (12) and during consolidation the gas-removal layer is deformed to form a collection substantially free from entrapped gas voids. Furthermore, a gas-removal layer is provided as well as a mould for casting of gas-removal layers and a method for preparing such a mould. The method and the gas-removal layer provided are particularly useful for manufacturing of wind turbine blades and spars for such blades. |
US07731875B2 |
Sacrificial anodes in concrete patch repair
High performance proprietary cementitious concretes or mortars developed for use as patch repair materials for corrosion damaged concrete often have high resistivities that inhibit the performance of sacrificial anodes located within the patch repair areas. A method of repair is disclosed which comprises removing the corrosion damaged concrete to form a cavity to receive a concrete repair material and forming within this cavity a smaller distinct cavity for assembling a sacrificial anode assembly and placing within this second cavity a pliable viscous ionically conductive backfill and a sacrificial anode and an activating agent to form a sacrificial anode assembly and connecting the anode to the steel and covering the anode and the backfill in the second cavity with a repair material to restore the profile of the concrete structure. In this arrangement a high resistivity repair material promotes the flow of protection current to steel in adjacent contaminated concrete that is at risk of corrosion. |
US07731872B2 |
Methods and systems for forming ophthalmic lens mold assemblies
Methods and systems are provided for making an ophthalmic lens. The present methods and systems are effecting in coupling two mold sections together at two or more discrete regions. Embodiments of the methods and systems form a bore that extends completely through one of the mold sections and only partially through the other mold section. During formation of the bore, the mold material in proximity to the bore being formed becomes molten and diffuses from the bore. A portion of the molten mold material is provided at a contact point between the two mold sections and when the molten material cools, the material forms a spot weld between the mold sections. By forming multiple hollow spot welds in a mold assembly, the two mold sections can be securely coupled to each other during the manufacture of an ophthalmic lens, such as a silicone hydrogel contact lens. |
US07731871B2 |
Optical disk and method for producing the same
An optical disk is constructed such that a thin film including a reflective layer is formed on a substrate, or on a thermoplastic resin layer on the substrate. A stamper having an asperity pattern corresponding to information signals is directly pressed against the thin film to transfer the asperity pattern on the thin film. Heat-pressing the stamper against the thin film makes it possible to further accurately transfer the asperity of the stamper to the reflective layer with less pressing force in the case where the reflective layer is formed on a thermoplastic resin layer. |
US07731863B2 |
Magnetorheological fluid with a fluorocarbon thickener
A magnetorheological fluid formulation comprising magnetizable particles dispersed in carrier fluid and a thixotropic agent wherein the thixotropic agent comprises a fluorocarbon grease. |
US07731855B2 |
Septic tanks
A method of determining whether a septic tank containing a liquid and sludge or scum mixture needs to be emptied, comprising locating a sensor in the mixture wherein the sensor is adapted to measure a parameter which can be used to determining the depth of sludge or scum in the septic tank and generating a warning signal when a signal from the sensor is indicative of a depth of sludge or scum exceeding a predetermined limit. |
US07731842B2 |
Submerged fixed film anoxic bioreactor
A constant velocity serpentine anoxic reactor incorporates a multiple cell vertical serpentine path, as well as a horizontal serpentine path, through the anoxic chamber. A fixed film media is mounted within each cell of the anoxic chamber to provide a structure on which the bacteria can grow to sustain the biological reaction, which convert nitrates into nitrogen gas. The fixed film media can be a cross-flow media and can optionally include a web of textile material integrated within the fixed film media to enhance bacterial growth within the fixed film media or optionally the anoxic vertical serpentine configuration could be applied to an activated sludge operation. A nitrate recycle pump recycles about 75% of the effluent from the aerobic chamber back into the anoxic chamber to provide a nitrate source for the digestion of the BOD within the influent wastewater. |
US07731835B2 |
Electrochemical sensor and method for continuous analyte monitoring
Sensors and a method for detecting an analyte are described. Sensors each have a volume of a hydrophilic medium that retains an amount of analyte proportionate to the concentration of analyte in a biological fluid, electrodes and a redox enzyme in contact with medium, and an electron transfer mediator. The fluid contacts sensors and at initially predetermined intervals intermittently applies a potential to electrode sufficient to oxidize the mediator and sensing current through electrode as a function of the duration of the applied potential. The applied mediator oxidizing applied potential is maintained for a period of time sufficient to determine the rate of change of current with time through electrode. The current flow is correlated with the current flow for known concentrations of the analyte in medium. |
US07731820B2 |
Compositions of fluorescent whitening agents
The invention relates to a composition comprising a) at least one water-soluble fluorescent whitening agent, b) a polymer formed from an ethylenically unsaturated monomer or monomer blend, characterized in that at least one monomer is acrylamide and the water-soluble polymer has an average (weight average) molecular weight of between 500 and 49,000, optionally, c) polyethylene glycol with a weight average molecular weight of between 500 and 6000 and d) water and the use of the composition for the fluorescent whitening of paper in coating and size press or film press applications. |
US07731812B2 |
Thick film conductor case compositions for LTCC tape
Methods of forming a multilayer circuit comprising: a) forming a patterned array of vias in a plurality of layers of green tape; b) filling the vias in one or more of the green tape layers from (a); c) printing over at least one surface of the green tape layers from step (b) with at least one patterned layer of a thick film composition consisting essentially of: i) electrically conductive powder; ii) an inorganic binder wherein the inorganic binder is selected from TiO2 and any compounds that can generate TiO2 during firing and any one of the following compounds: Sb2O3, Co3O4, PbO, Fe2O3, SnO2, MnO, CuO and mixtures thereof; and iii) an organic medium, wherein the total inorganic binder is in the range of 0.6 wt. % to about 2 wt. % of the total composition. d) laminating the printed green tape layers from step (d) to form an assemblage comprising a plurality of unfired interconnected functional layers separated by unfired green tape; and e) cofiring the assemblage from step (d). |
US07731811B2 |
Analytic substrate coating apparatus and method
An apparatus and method for producing a coated analytic substrate using a compact and portable automated instrument located in the laboratory setting at the point of use which can consistently produce one or a plurality of coated analytic substrates “on demand” for using the analytic substrate immediately after coating, preferably without a step of rinsing the coated analytic substrate before use. The apparatus preferably uses applicator cartridges having a reservoir containing the coating compositions used to form the coatings. Preferably the cartridges are removable and interchangeable to facilitate the production of individual analytic substrates having different coatings or different coating patterns. These coated analytic substrates have superior specimen adhesion characteristics due to the improved quality of the coatings applied by the coating apparatus and due to the quickness with which the coated analytic substrates can be used in the lab after production. |
US07731803B2 |
Descaling and corrosion inhibiting method
The present invention is directed to a composition, and a process employing same, for descaling, cleaning and inhibiting the corrosion of process equipment made of steel by including an inhibitory effective amount of acridine orange in the composition. |
US07731801B2 |
Semiconductor wafer treatment method and apparatus therefor
In the ozone water treatment process, the silicon wafer is treated with the first ultra-pure water that includes ozone. The first ultra-pure water is refined by the ultraviolet ray sterilization method. The first ultra-pure water includes total organic carbon content of more than 1 μg/liter and not more than 20 μg/liter, so that the silicon wafer of the predetermined degree of cleanliness is obtained. The silicon wafer is treated by using the second ultra-pure water that has a lower TOC value than the first ultra-pure water in the ultra-pure water rinsing process (including the chemical solution cleaning process as required). The second ultra-pure water is refined by the ultraviolet ray oxidization method, and includes total organic carbon content with a concentration of 1 μg/liter or less. Thus the silicon wafer of the predetermined degree of cleanliness is obtained. |
US07731798B2 |
Heated chuck for laser thermal processing
A chuck for supporting a wafer and maintaining a constant background temperature across the wafer during laser thermal processing (LTP) is disclosed. The chuck includes a heat sink and a thermal mass in the form of a heater module. The heater module is in thermal communication with the heat sink, but is physically separated therefrom by a thermal insulator layer. The thermal insulator maintains a substantially constant power loss at least equal to the maximum power delivered by the laser, less that lost by radiation and convection. A top plate is arranged atop the heater module, supports the wafer to be processed, and provides a contamination barrier. The heater module is coupled to a power supply that is adapted to provide varying amounts of power to the heater module to maintain the heater module at the constant background temperature even when the wafer experiences a spatially and temporally varying heat load from an LTP laser beam. Thus, heat from the laser is transferred from the wafer to the heat sink via the heater module and the insulator layer. In the absence of any laser heating, heat is also transferred from the heater module to the wafer as needed to maintain the constant background temperature. |
US07731791B2 |
Use of pyrimido[5,4-g]pteridines as shading component in color filter colorant compositions
The present invention relates to the field of color filters and LCDs. More specifically, the invention relates to a colorant composition for making color filters comprising pyrimido[5,4-g]pteridine derivatives of formula (I) wherein A1, A2, A3, and A4 are each independently of the others —NR1R2, wherein R1 and R2 are each independently of the others hydrogen, CrC8alkyl, —CO—C1-C8alkyl, —CO—Ce—Cuaryl, —COO—C1-C8alkyl, —COO—Ce—CMaryl, —CONH-d-Cβalkyl or —CONH—Ce-CMaryl, Or A1, A2, A3, and A4 are each independently of the others —OH, —SH, hydrogen, CrC8alkyl, CrC8alkoxy, or C6-C14aryl or —O—C6-C14aryl each unsubstituted or mono- or poly-substituted by halogen, nitro, cyano, —OR10, —SR10, —NR10R11, —CONR10R11, —COOR10, —SO2R10, —SO2NR10R11, —SO3R10, —NR11COR10 or by —NR11COOR10, wherein R10 and R11 are each independently of the others hydrogen, CrC8alkyl, C5-C12cycloalkyl or C2-C8-alkenyl; and to their use for color filter production and to color filters comprising said pyrimido[5,4-g]pteridine derivatives of formula (I). |
US07731784B2 |
Membrane air dryer with sweep air control
The membrane air dryer includes a housing with an air inlet adjacent a first end of the housing, an air outlet adjacent a second end of the housing, a sweep air inlet and a sweep air outlet. A membrane separator has surfaces extending between and connected to the air inlet and the air outlet. A first sweep air passage in the housing extends between the first and second ends of the membrane along and including surfaces of the membrane. The first sweep air passage has an inlet adjacent the air outlet and an outlet adjacent the air inlet and connected to the sweep air outlet. The sweep air inlet and outlet is adjacent the air inlet. A second sweep air passage in the housing extends between the first and second ends of the membrane. The second sweep air passage has an inlet that is connected to the sweep air inlet and is adjacent the air inlet and has an outlet that is adjacent the air outlet and in fluid communication with the inlet of the first sweep air passage. The membrane air dryer may be mounted to extend into the reservoir. |
US07731774B2 |
Honeycomb structured body
A honeycomb structured body of the present invention is a honeycomb structured body in which a plurality of porous ceramic members are combined with one another through an adhesive layer, each of the porous ceramic members having a plurality of cells which are allowed to penetrate in a longitudinal direction with a wall portion therebetween and either one end of which is sealed, with a catalyst supporting layer being adhered to the wall portion, wherein, supposing that the rate of the pore volume of pores having a pore diameter of 10 μm or less to the entire pore volume of the porous ceramic member is X1 (%), the porosity is Y1 (%) and the weight of the catalyst supporting layer is Z1 (g/l), these X1, Y1 and Z1 are allowed to satisfy the following expressions (1) and (2): X1≦20−Z1/10 (1), and Y1≧35+7Z1/40 (2) (where about 20≦Z1≦about 150). |
US07731772B2 |
Rotor unit of a centrifugal separator
Rotor unit for a centrifuge for purifying flowing fluids, which rotor unit (12) comprises a plurality of disk elements (14) which are stacked concentrically one on another and provided with at least one centrally located fluid flow-through hole, where the disk elements (14) have lead-through openings by means of which the disk elements (14) are pushed onto a number of essentially axially elongate guide elements (16) distributed in the circumferential direction for guiding the disk elements in the circumferential direction and radially. The disk elements (14) are held together by a first and a second end element (18, 20) at the ends of the stack of disk elements. A central portion of at least some of the guide elements (16) are interconnected by means of a cross-stay construction (36) in order to prevent deflection of the rods owing to the centrifugal force during rotation of the rotor unit (12). |
US07731767B2 |
Vegetable lipid-based composition and candle
A vegetable lipid-based composition and candle comprised of a vegetable lipid component and a petroleum wax is described. The vegetable lipid component may include a triglyceride or a free fatty acid/triglyceride mixture. The vegetable lipid-based composition has properties that make it advantageous in candle production. |
US07731757B2 |
Obesity treatment
A food intake-limiting device for peroral implantation in the stomach adjacent a gastroesophageal junction is disclosed. The device can have an inner basket nested in an outer basket, a proximal entry opening and a distal exit opening to limit a rate of efflux, mesh openings in the outer basket for protrusion of stomach lining into the outer basket, and a plurality of spikes mounted tangentially on the inner basket for transfixing the protruding stomach lining. The inner basket is rotatable with respect to the outer basket to effect the transfixation. Also disclosed are an implantation/extraction tool, and methods for implanting and removing the device in a patient in need of obesity treatment. |
US07731753B2 |
Prosthetic intervertebral discs
Prosthetic intervertebral discs, systems including such prosthetic intervertebral discs, and methods for using the same are described. The subject prosthetic discs include upper and lower endplates separated by a compressible core member. The subject prosthetic discs exhibit stiffness in the vertical direction, torsional stiffness, bending stiffness in the saggital plane, and bending stiffness in the front plane, where the degree of these features can be controlled independently by adjusting the components, construction, and other features of the discs. |
US07731750B2 |
Sheaths for implantable fixation devices
Sheaths for implantable fixation devices and methods of using the sheaths are disclosed. Sheaths have a flexible body with a perforated wall, and an interior of the body is sized and shaped to receive the fixation device. Sheaths include a plurality of flexible or inflexible tubes arranged to form a ring, where the central cavity defined by the ring is sized and shaped to receive the fixation device. |
US07731745B2 |
Flexible, stretchable coiled-sheet stent
A coiled-sheet stent includes a tubular body having a longitudinal axis and a circumference, and a plurality of cylindrical bands formed in the tubular body, each band having a zig-zag pattern including a series of sequential diagonal elements connected to one another and extending about the circumference. A plurality of longitudinal connectors extend between and connect adjacent bands. The diagonal elements have an arcuate shape, all diagonal elements in each band being oriented in either a clockwise or counter-clockwise direction about the circumference. The tubular body is expandable between contracted and enlarged conditions, and the zig-zag pattern is expandable between unstretched and unstretched conditions, the zig-zag pattern being biased towards the stretched condition above a transition temperature, thereby at least partially defining the enlarged condition. A multi-cellular stent structure is also provided that includes a plurality of bat shaped cells formed in a tubular body, each cell defining a head region, a tail region and opposing curved wing regions, and a plurality of connectors extending between and connecting adjacent cells. The head and tail regions of adjacent cells are directly connected to one another, and connectors extend between adjacent wing regions of adjacent cells. |
US07731737B2 |
Methods and apparatuses for fixation of the spine through an access device
In a method of treating the spine of a patient, an access device is inserted into the patient with the access device in a first configuration having a first cross-sectional area at a distal portion thereof. The access device is actuated to a second configuration having an enlarged cross-sectional area at the distal portion thereof such that the distal portion extends across at least a portion of each of two adjacent vertebrae. A stabilization of the vertebrae is then achieved using either translaminar facet screw fixation or transfacet pedicle screw fixation. |
US07731736B2 |
Fastening system for spinal stabilization system
Bone fixation systems for stabilizing bones such as vertebral bodies are disclosed. The fixation systems include fixation connectors that preferably are equipped with bone anchors (e.g., screws, hooks, pins or like structures) for securing the fixation connectors to bones desired to be stabilized. The fixation systems also include linking elements (e.g., rods, plates or other members) for linking the fixation connectors together to form a stabilizing construct capable of maintaining a desired spacial relationship between bones desired to be stabilized. |
US07731733B2 |
Expanding orthopedic pacifier
An orthopedic pacifier defining a shield adapted to remain outside of the mouth, a bulb adapted to be located in the mouth and on which the child sucks. The bulb is adapted to expand or move upward and outward as the child sucks on it, to counteract inward pressure of the cheeks and the lateral portion of the lips caused by the suction or sucking action. |
US07731732B2 |
Closure medical device
A closure device for closing a puncture wound has a distal section that can be placed against the interior wall of a vessel and a proximal section that bunches in the tissue tract to close the wound. One variation of the device provides for removing the distal section from the vessel so that it resides also in the tissue tract after the proximal section has been securely bunched and lodged within the tissue tract in order to provide unobstructed fluid flow in the vessel. |
US07731729B2 |
Method and apparatus for penetrating tissue
A tissue penetrating system includes a plurality of penetrating members each having a tip. A penetrating member driver is coupled to the plurality of penetrating members. Each tip of a penetrating member is uncovered during launch of the penetrating member by the penetrating member driver. A support is provided with a plurality of openings. Each opening receives a penetrating member. |
US07731725B2 |
Surgical instrument with improved handle assembly
A modular clip applier includes a cartridge containing multiple surgical clips, and a handle assembly for operating the cartridge to crimp one of the clips onto body tissue of a patient. The handle assembly has a scissors configuration with a bayonet coupling, and flange pairs widely separated to provide a high degree of stability. The bayonet coupling enables the handles of the assembly to be fully separated for cleaning. Snap fittings between the cartridge and handle assembly are provided at the fulcrum and also at a spaced location where an operating pin of the cartridge engages intersecting slots in the flanges. Overdrive protection of three different types is contemplated along with a structure facilitating operation of the handle assembly by palming a pair of handle bars. |
US07731714B2 |
Instrument for endoscope and instrument system for endoscope
An instrument for an endoscope including a flexible insulative insertion section inserted in an endoscope channel, a tubular first electrode section arranged at a distal end of the insertion section with an insertion hole formed along the axis of the insertion section, a conductive electric wire inserted in the insertion section and movable forward/backward, a control section arranged on the proximal end side of the insertion section and controlling forward/backward movement of the electric wire along the axis, a rod-shaped second electrode section connected to a distal end of the electric wire and inserted so as to be movable forward/backward in the insertion hole, and an external connecting section electrically connected to a proximal end side of the electric wire and applying external currents with predetermined frequencies to the electric wire and the second electrode section. |
US07731711B2 |
Cryosurgical instrument and its accessory system
The invention proposes a cryosurgical instrument and its accessory system operating on the base of a refrigerant evaporation. The invention comprises combination of some technical solutions. Flow in a central lumen of the cryosurgical instrument has oscillating character; the refrigerant is provided on the internal surface of the distal cryotip in the form of separated portions. 2. The internal surface of the distal cryotip of the cryosurgical instrument is covered by a porous coating, which soaks completely one portion of the refrigerant. 3. Vapors obtained as a result of the refrigerant boiling on the porous coating of the cryotip are removed through the central lumen into the atmosphere. Combination of these technical solutions allows to construct a safely cryosurgical instrument with high freezing power and small outer diameter. The proposed cryosurgical instrument may be designed as a flexible cryocatheter or as a rigid cryoprobe. |
US07731710B2 |
Surgical wide-angle illuminator
A high-efficiency, wide-angle illumination surgical system is disclosed, one embodiment comprising: a light source for providing a light beam; an optical cable, optically coupled to the light source for receiving and transmitting the light beam; a handpiece, operably coupled to the optical cable; an optical fiber, operably coupled to the handpiece, wherein the optical fiber is optically coupled to the optical cable to receive and transmit the light beam; an optical element, optically coupled to a distal end of the optical fiber, for receiving the light beam and scattering the light beam to illuminate an area, wherein the optical element comprises a compound parabolic concentrator (“CPC”) cone; and a cannula, operably coupled to the handpiece, for housing and directing the optical fiber and the optical element. The optical element can be a small-gauge, diffusive optical element comprising a sculpted distal end of the optical fiber or a machined or injection-molded plastic CPC-cone. For example, the optical element can be a 19, 20 or 25 gauge optical element. The CPC-cone optical element angularly spreads the light beam out to a high off-axis angle and emits the light out of the distal end of the cannula with high efficiency. |
US07731709B2 |
Optical height zeroing device
A leveling device for determining the zero pressure point of an external draining system with respect to a patient is provided. The leveling device generally includes a body having a viewing element defining a field of vision, and a reference point indicator spaced apart from the viewing element and disposed within the line of vision. The viewing element and the reference point indicator define a line of sight. The device further includes a horizontal level indicator mated to the body and oriented parallel to the line of sight established by the viewing element and the reference point indicator. The horizontal level indicator is effective to indicate the horizontal alignment of the body with respect to a particular reference point viewed through the viewing element and indicated by the reference point indicator. The device can optionally include a reflector element disposed adjacent the horizontal level indicator and within the field of vision, such that the horizontal level indicator is visible through the viewing element via the reflector element. |
US07731704B2 |
Method and apparatus for delivering an agent to the abdomen
A method and apparatus for treating gas for delivery into a body cavity, body space or body surface of an animal. The apparatus comprises a housing defining a chamber having an entry port and an exit port. One or more agents are released into the gas stream that flows through the chamber so that the gas stream carries the agent to the animal. Also shown, for use with, or without, the chamber, is an agent chamber adapted to be coupled to at least one structure defining at least one fluid flow path extending at least a portion of the distance between an insufflation device and the body cavity, body space or body surface. |
US07731698B2 |
Device for administering an injectable product in doses
A device for administering an injectable product in doses including a casing having a receptacle for a container which contains the product and accommodates a piston such that the piston can advance towards an outlet for delivering a selected product dosage, a dosing member, with which a dosing movement can be performed relative to the casing for selecting the product dosage, a drive unit, which can be coupled to the casing and the dosing member such that the drive unit can be adjusted relative to the casing from a dosing starting position to a dosing end position by the dosing movement of the dosing member, an operating mechanism which causes the drive unit to perform a delivering movement by which the piston is advanced towards the outlet, and a restoring spring, which is secured in a tensioned state and is coupled to the drive unit by a release for causing a restoring movement of the drive unit towards its dosing starting position. |
US07731692B2 |
Device for shielding a sharp tip of a cannula and method of using the same
A safety device for shielding a sharp tip of a tubular needle includes a shaft sized and shaped for being received into the passage of the tubular needle through a first end of the passage and extending to a second end of the passage. A shield is associated with the shaft and is constructed for receiving and substantially shielding the sharp tip of the needle. A catch is associated with the shaft. The catch prevents the withdrawal of the shaft from the passage of the needle when the shield is shielding the sharp tip of the needle. |
US07731688B2 |
Warming apparatus with heater produced by PCB
The disclosed invention relates to a heating apparatus having a PCB-type heater capable of allowing the temperature of Ringer's solution or blood which is introduced into a blood vessel, when transfusing a blood thereto, to be equal to that of the human body to thereby provide an accurate resistance value. The present invention comprises 1. A heating apparatus according to an embodiment of the invention comprises a body including a first connecting portion having a tube which is connected to the first connection portion and receives a fluid supplied from an instillation room, a path having the shape of a spiral screw thread to enable the fluid to flow and a second connecting portion for supplying the fluid flowing through the path to an injection syringe; an inner cover inserted into the body and fixedly attached thereto in a prescribed adhesive manner for preventing the fluid from flowing out; a middle cover for closely fixing the body and the inner cover against each other; a PCB-type heater inserted into the inside of the top and bottom surfaces of the middle cover for heating the fluid flowing through the path so that the fluid is maintained at a prescribed temperature; a bottom case having a box portion to receive the body having the heater and the middle cover coupled thereto; and a upper case coupled to the bottom case. |
US07731687B2 |
Safety spring catheter introducer assembly
A catheter introducer assembly is disclosed whereby the safety spring clip moves into position to block the needle tip occurs as a direct consequence of the withdrawal of the needle from the catheter bore. The catheter introducer assembly according to the present invention comprises a needle and a needle hub, a catheter and a catheter hub, and a safety spring clip assembly. The safety spring clip assembly being designed to permit the needle to slide inside the spring clip assembly until the needle stop located on the needle meets the proximal wall to thereby prevent further movement of the safety spring clip. A method of using the catheter introducer assembly according to the present invention is also provided. |
US07731685B2 |
Coated medical device
A coated medical device adapted for introduction into a passage or vessel of a patient is provided. The medical device is preferably an implantable balloon with a bioactive deposited or within the balloon. The balloon can further include a hydrophilic material positioned between the balloon and a bioactive material posited on the balloon. |
US07731681B2 |
Catheter positioning system
The present invention relates to a system adapted to position a medical device, such as an ablation catheter, at a location where a pulmonary vein extends from an atrium. The system optimally includes a deflectable catheter and a sheath. An ablation member is disclosed for use with the positioning system, wherein the deflectable catheter and the sheath cooperate so as to facilitate positioning of the ablation member at the location. |
US07731672B2 |
Massage device
A massage device of the invention includes a base cover, a guiding device formed in the base cover and a moving base movably engaged with the guiding device. The moving base includes a bottom and a shield covered thereon to form a compartment therebetween. The moving base includes a massage system rotatably placed on the shield of the moving base; a first transmission system adapted for moving the moving base along the guiding device and a second transmission system adapted for driving the massage system, both the first and second transmission systems being contained in the compartment and driven individually. |
US07731666B2 |
Apparatus and method for delivery of an aerosol
An apparatus for measuring lung ventilation, comprising: a pressure device to measure volume of air flow; an aerosol-generating device that provides aerosol particles to be released at a determined point in a breathing cycle; a mouthpiece with a detector that measures the concentration of aerosol particles for a given volume during the breathing cycle; and a computing device configured to provide lung ventilation data as a function of time constants. |
US07731662B2 |
Compressive surfaces for ultrasonic scanning and associated method
An apparatus and related methods for ultrasonically scanning a tissue sample are described, the apparatus comprising an ultrasound transducer and a taut fabric sheet compressing the tissue sample, the ultrasound transducer contacting the taut fabric sheet and ultrasonically scanning the tissue sample therethrough. Preferably, the taut fabric sheet is substantially porous with respect to an acoustic couplant. In another embodiment, an ultrasound transducer and a vented membrane are provided, the vented membrane having a first surface contacting the tissue surface and a second surface opposite the first surface, the ultrasound transducer contacting the second surface and being translated across the second surface for ultrasonically scanning the tissue volume. An acoustic couplant is applied to one of the tissue surface, the first surface, and the second surface, the vented membrane being provided with a void pattern such that it is substantially porous with respect to the acoustic coupling agent. |
US07731659B2 |
Method for predicting a user's future glycemic state
A method for predicting a user's future glycemic state includes measuring a user's glucose concentration at intervals over a time duration, thereby generating a plurality of glucose concentrations as a function of time. First and second glucose prediction equations that are fits to the plurality of glucose concentrations based on first and second non-identical mathematical models, respectively, are then derived. The method also includes calculating first and second predicted glucose concentrations at a future time using the first and second glucose prediction equations, respectively. Thereafter, an average predicted glucose concentration and a merit index are calculated based on the first and second predicted glucose calculations. The plurality of glucose concentrations as a function of time, the merit index and average predicted glucose concentration are input into a trained model (for example, a Hidden Markov Model) that outputs a set of glucose concentration probabilities. The user's future glycemic state is then predicted based on the set of glucose concentration probabilities. |
US07731655B2 |
Tissue retractor and method for using the retractor
A tissue retractor includes a body having proximal and distal ends. The retractor also includes a retraction device having a head connected to the distal end of the body and defining two opposing openings, a connector movably disposed in the body, and two flexible needles of a shape memory material having a memory shape. The needles are fixedly connected to the connector for traveling through a respective one of the openings. The memory shape of the needles includes a portion with an arcuate shape. A one-handed actuation device is connected to the proximal end of the body and is operatively connected to the connector through the body. Upon actuation of the actuation device, the connector can be moved to selectively extend the needles out of the head and withdraw the needles into the head. Methods for using the tissue retractor, in particular for the treatment of Gastroesophageal Reflux Disease, are also provided. |
US07731645B2 |
Method for forming a container blank including a seal
The preset invention relates to a method, use of the method and a device for making a seal in a portion of a material web. The material web includes a first elongate section with a first number of layers of material and a second elongate section with a second number of layers of material, at least one of the layers of material being included in both the first and the second section, the portion having an extent that intersects a transition from the first section to the second section of the material web, the method including connecting, in the portion, opposite surfaces of the layers of material of the material web to each other. The method including forming ridges and valleys in the portion, and orienting the ridges and valleys in such a manner that they have an extent intersecting the transition. |
US07731642B2 |
Training apparatus
A training apparatus including an operation part to which a load is applied for performing a training of a front deltoid muscle, a pectoralis major muscle and a triceps brachii muscle. The training apparatus includes a pair of armrests on which trainee's forearms are to be rested, and a pair of grips provided to the operation part and having lower end sections. In the training apparatus, the armrests have surfaces on which the trainee's forearms are to be rested, at a height of the lower end sections of the grips. |
US07731639B1 |
Compact weight bench with lifting assistance
Weight bench having a frame that rests on the floor, a seat mounted on the frame, a backrest pivotally mounted on the frame to the rear of the seat for movement between horizontal, inclined, and declined positions relative to the seat, a plurality of resilient elements which can be selectively connected between the backrest and the frame for lifting the backrest toward the inclined position, a swinging arm pivotally mounted to the frame in front of the seat for movement between raised and lowered positions, a weight bar extending laterally from a free end of the swinging arm for engagement by the legs of a person doing leg exercises, a handle attached to the swinging arm for engagement by the hands of a person sitting on the seat for doing upper body and arm exercises, and weights stored in holders attached to the frame for attachment to the weight bar and for manual use in doing exercises that do not involve the weight bar. |
US07731633B1 |
Exercise glove for intrinsic muscles and method of use
An exercise glove for intrinsic muscles and method of use. The exercise glove incorporates rigid ribs having rib distal end angles corresponding to patient metacarpal phalangeal joint angles. The ribs passively hold the patient metacarpal phalangeal joint angles in extension, while the patient actively flexes the proximal interphalangeal joints and distal interphalangeal joints to obtaining optimal intrinsic muscle stretching. The rib distal end angles may be set by a physical therapist to correspond to individual patient metacarpal phalangeal joint angles, or alternately an array of ribs of different rib distal end angles may be provided with the exercise glove, from which rib assortment the physical therapist may choose ribs having appropriate rib distal end angles ribs to attach to the exercise glove. The method includes the steps of using the exercise glove to passively hold metacarpal phalangeal joints in extension, while actively flexing proximal and distal interphalangeal joints. |
US07731629B2 |
Control apparatus for vehicle and method of controlling vehicle
An engagement-pressure control portion and a first torque decrease control portion are provided. The engagement-pressure control portion controls an engagement pressure for a friction engagement element to be engaged when an automatic transmission upshifts so that the engagement pressure increases to a standby pressure at which an inertia phase does not start on the condition that torque output from a power source is equal to a first predetermined value, and then the engagement pressure is maintained at the standby pressure. The first torque decrease control portion controls the torque output from the power source so that the torque gradually decreases from the first predetermined value after the engagement pressure for the friction engagement element is maintained at the standby pressure, and a predetermined condition is satisfied. |
US07731623B2 |
Automatic transmission
An automatic transmission includes two clutches that are disposed such that they overlap in an axial direction and occupy different positions in a radial direction. Each of the two clutches includes a clutch drum, a piston that forms a working fluid chamber for which a portion of the clutch drum serves as a cylinder, a plurality of friction plates that engage the clutch drum, and a cancel oil chamber that is disposed on a rear face side of the piston and that cancels a centrifugal oil pressure that acts on the working fluid chamber. |
US07731608B2 |
Golf ball
A golf ball having an indicia composed of a novel metallic ink is disclosed herein. The first indicia is preferably composed of a vacuum metallized pigmented ink having a particle size ranging from 10 microns to 12 microns. The ink is preferably an aluminum based ink. The golf ball is preferably a two-piece solid golf ball or a three-piece solid golf ball. The novel ink preferably has a viscosity above about 300 centipoise. |
US07731607B2 |
Golf balls having at least two core layers formed from HNP compositions
The present invention is directed to golf balls consisting of a multi-layer core and a cover. The multi-layer core consists of a center and an outer core layer that are both soft relative to a hard intermediate core layer. The outer core layer is preferably thin relative to the center and the outer core layer. The multi-layer core includes at least one layer formed from a relatively soft HNP composition and at least one layer formed from a relatively hard HNP composition. |
US07731597B1 |
Golf training device
The present invention provides a sport training device for improving technique by providing resistance within the context of a sporting movement. The invention comprises an arcuate frame worn on the thigh of a user, which is secure to the user's thigh with an adjustable belt or cuff coupled to the frame. A lever coupled to the frame extends away from the frame in front of the user's body and an elastic cord is anchored to the lever. An attachment means is coupled to the other end of the elastic cord to allow the user's arms to extend the cord, thereby providing resistance to the user's movement. The attachment means attaches the cord to a wrist strap or glove worn by the user or to the handle of a sport implement such as a golf club. |
US07731596B1 |
Billiard ball rack and use thereof
The improved billiard rack is an invention that allows a user to quickly and easily rack or position a set of billiard balls without the inconvenience or necessity of actuating an auxiliary ball positioning device. The rack includes NEOPRENE or the like compressible members that cause a compressive load to be placed upon a group of billiard balls when the rack is positioned on a set of balls which further causes the group of balls to be tightly and properly grouped or racked. The rack further includes angled walls that provide for removal of the rack from a group of balls without the walls colliding with the balls. The rack further includes feet upon which the rack may be rotatingly removed from a set of balls by rotating the rack in an upwards rearwards rotation motion away from the group of balls. The feet preferably include alignment marks that may be aligned with corresponding marks on a playing surface so as to properly, accurately, and consistently position the rack. |
US07731595B2 |
Waterslide amusement device
A slide (104) supports and directs a user along a predetermined path. A conveyor system (102) is coupled to the slide to accelerate the user along the predetermined path. |
US07731593B2 |
Composite transmission shaft joint
A fiber reinforced composite shaft bearing a metallic flanged end coupling (Fl) attached to the outside diameter through a concentric cylindrical torsional joint, comprising: a) a cylindrical end region comprising a wedge shaped inner layer of fiber (Hp) composite; b) a layer of outer helical composite plies (He) forming the shaft and extending over the wedge shaped inner layer, wherein the layer of outer helical plies has a tapered end part overlying wedge shaped inner layer to form the cylindrical end portion, wherein all helical plies of fibre layers are exposed on an outer surface; and c) a metallic flanged end coupling attached to the outer surface of the cylindrical end region through a primary mechanically interface (Sp) which may be splined. The joint may be strengthened by internally reinforcing the main shaft with an interference fit tubular plug (Pg) and protected from environmental degradation by inboard secondary adhesive bond (Ad). |
US07731590B2 |
Creation of ranking table for competitive game
Game apparatuses connected in a peer-to-peer manner play a competitive game with each other. Each of the game apparatuses stores a ranking table ranking points of multiple users based on past games of the users. When finishing playing the game, the game apparatuses respectively calculate points obtained by the respective users based on the result of the game, and update the ranking tables based on the newly calculated points. The game apparatuses transmit and receive information on the updated ranking table to and from each other. Each game apparatus integrates the ranking table locally stored with the ranking table transmitted from the other game apparatus to generate a new ranking table, and displays the new ranking table on a display device. |
US07731588B2 |
Remote vehicle control system
An apparatus for remotely controlling the movements of a vehicle includes a user input means, such as a gamepad with a plurality of joystick-controlled and button-controlled outputs, a tracker, and optional sliding foot pedals; a processor for running a control mapping algorithm; and a remote vehicle controller. A control mapping algorithm maps the outputs to the remote-controlled vehicle's course, heading, displacement, and camera view, with the joysticks mapped to provide open loop directional control over the vehicle's course and heading, the tracker providing open loop control over the camera view, and the optional sliding foot pedals providing open loop control over the vehicle's displacement. The remote vehicle controller sends commands to on-board controls to direct the vehicle's movement. A video stream from an on-board camera is transmitted back to the operator station for viewing on a computer desktop display or a head mountable display. |
US07731572B2 |
CMP head
A CMP head includes a membrane support and a membrane. The membrane support is disk-shaped, having an origin and a radius R. The membrane support has at least a ventilator disposed in a central region within the range between origin and (⅔) R, and at least a diversion opening disposed in a peripheral region within the range between (⅔) R and R. The membrane includes a disk-shaped part disposed on the first surface of the membrane support, and an annular part surrounding the annular sidewall of the membrane support. |
US07731562B2 |
Toy helices having variable rates of movement
Toy helices each having a variable rate of movement. The toy helices, such as springs and coils, for example, may be formed of at least two different types of material each having different properties such as elasticity, flexibility, and attraction. In one embodiment, a first portion of a toy helix may be constructed of a first material having a first elasticity and a second portion of a toy helix may be coupled to the first portion and constructed of a second material having a second elasticity. The first elasticity and second elasticity are not identical and, thus, have different restoring forces acting to return the toy helix to its original shape. After such a toy helix is stretched, for example, the helix has a variable rate of movement during return to the compressed state because the first portion returns to its original shape at a different rate than the second portion. |
US07731560B2 |
Motorized interactive figure
The present invention provides for an interactive figure with a head, body and waist cavities, arms, legs and two motorized wheelbases. The body and waist cavities include a gear mechanism. The motorized wheelbases control the movements of the interactive figure via a relationship between the gear mechanism and motors housed within the motorized wheelbases by distributing power to the motors based on a user's input or a preprogrammed response. |
US07731542B2 |
Wire containment cap
A wire containment cap includes a first side having a plurality of retainers for retaining wires, and a second side opposite the first side. Two sidewalls extend between the first side and the second side, and a support rib extends between the two sidewalls. The support rib includes two pair separators for separating wire pairs. In one embodiment, a plurality of sloped pair splitters is located between two of the retainers and includes a sharp point for cutting through insulation material on a pair of bonded wires. A communication jack assembly including a front portion and the wire containment cap is also described. |
US07731540B2 |
Electrical power delivery system and method of manufacturing same
In some embodiments, an electrical power delivery system including: (a) a base having: (1) a first surface; and (2) a second surface spaced apart from the first surface by a first sidewall; (b) a platform extending away from the second surface of the base, the platform having a third surface spaced apart from the second surface by a second sidewall; (c) a first electrical power outlet at the third surface; (d) a second electrical power outlet at the second sidewall; and (e) an electrical power cord. The first electrical power outlet and the second electrical power outlet are electrically coupled to the electrical power cord such that the first electrical power outlet and the second electrical power outlet receive electrical power from the electrical power cord when the electrical power cord receives electrical power. |
US07731538B2 |
Card connector
A card connector is disclosed that includes a housing for accommodating a first card, a second card, and a third card; a first contact member arranged to be connected to the first card; a second contact member arranged to be connected to the second card, which has a larger width than the first card and a smaller thickness than the first card; a third contact member arranged to be connected to the third card, which has a smaller width than the first and second card and a smaller thickness than the first and second card; and a connection control mechanism that selectively connects one of the first card, the second card, or the third card. When one of the first card, the second card, or the third card is connected, the connection control mechanism prevents the other cards from being connected. |
US07731537B2 |
Impedance control in connector mounting areas
A high speed connector with reduced crosstalk utilizes individual connector support frames that are assembled together to form a block of connector units. Each such unit supports a column of conductive terminals in two spaced-apart columns. The columns have differential signal terminal pairs separated from each other by larger intervening ground shields that serve as ground terminals. The ground shields are arranged in alternating fashion within the pair of columns and they are closely spaced together so as to face a differential signal terminal pair. In areas where the terminals are mounted to the connector units, window-like openings are formed in the large ground shield terminals to reduce the amount of broadside coupling between the differential signal terminal pair and the signal terminal pair are narrowed to increase their edge-to-edge distance to account for the change in dielectric constant of the connector unit material filing in the area between the signal terminal pair. |
US07731529B1 |
Connector including compressible ring for clamping a conductor of a coaxial cable and associated methods
A connector is for attachment to a coaxial cable having an inner conductor, an outer conductor, and a dielectric therebetween. The connector includes a connector housing defining a radially outer ramp to receive the outer conductor thereagainst and a back nut. A compressible ring compressibly clamps against the outer conductor opposite the radially outer ramp as the connector housing and back nut are engaged. The connector also includes a center contact to be coupled to the inner conductor and an insulator member in the connector housing for carrying the center contact and having a radially outer support portion to radially support the outer conductor opposite the compressible ring. |
US07731528B2 |
Electrical termination device
An electrical termination device includes an electrically conductive shield element, an insulator disposed within the shield element, and one or more electrical contacts supported within and electrically isolated from the shield element by the insulator. The insulator includes one or more insulative spacer bars configured to guide the one or more electrical contacts during their insertion into the insulator. The one or more spacer bars may be configured to enable straight pull injection molding of the insulator. The insulator may be positioned away from the one or more electrical contacts along at least a major portion of the length of the one or more electrical contacts in an impedance controlling relationship. The electrical termination device can be included in an electrical connector. |
US07731517B2 |
Inherently sealed electrical connector
An entirely wearable electrical connector for power/data connectivity. The principal element of a modular network is the wearable electrical connector, which is integrated into a personal area network with USB compatibility. An embodiment comprises a non-conductive elastomeric environmental seal. |
US07731516B2 |
Connector system for engaging a portion of a plug within a receptacle
An cable connector system is provided. A receptacle for the connector system includes a pair of opposing compression plates and at least one rotatable member configured to move the opposing compression plates as the rotatable member rotates. The compression plates cause contact with a portion of the plug inserted therebetween. |
US07731515B2 |
High voltage wet mateable electrical connector
An electrical connector is provided for use in establishing watertight connections, such as for subsea applications. The connector comprises a receptacle component (100) that includes a fluted, insulated male contact pin (52) with an isolation tube (5) substantially surrounding the insulated male contact pin over at least part of its length and containing oil therein, and a plug component (200) that includes a sliding contact pin assembly (19) and a release mechanism (40). The release mechanism (40) enables linear tolerance sliding action between the receptacle component and the plug component after establishing electrical communication between the mating components. The sliding contact pin assembly further includes a shuttle pin (24) that is urged rearwardly during mating to operate the release mechanism, thereby allowing the male contact pin and front contact band (20) to move relative to the central spring support rod (30) of the plug component. |
US07731513B1 |
Conductive assembly and electrical connector having the same
An electrical connector and a conductive assembly thereof are disclosed. The electrical connector includes an insulating body disposed with a plurality of receiving spaces, a first conductor correspondingly received in a receiving space and one end of the first conductor is hollowed out to form a receiving cavity, a liquid conductor stored in the receiving cavity, a second conductor, and a compressive elastic member. The second conductor having a main body that part thereof exposes outside of the receiving cavity, a guiding connection part extended from one end of the main body and located in the receiving cavity, and a stopper disposed between the main body and the guiding connection part. The compressive elastic member is arranged between the stopper and the bottom of the receiving cavity while the maximum compression distance of the compressive elastic member is larger than the distance between the rear end of the guiding connection part and the liquid conductor. Compared with the prior art, the conductive assembly and the electrical connector with the conductive assembly provide stable electrical connection. |
US07731511B2 |
Panel mounted power module
A panel mounted power module is disclosed having an insulating housing and a conductive jacket. The insulating housing and the conductive jacket have corresponding flanges which oppose each other and are profiled to trap therebetween a panel. The power module includes a spring positioned between the insulating housing and conductive jacket, to spring load the flanges towards each other. The power module has at least one ground terminal and the spring commons the ground terminal and the conductive jacket together. |
US07731500B2 |
Vascular-access simulation system with three-dimensional modeling
The illustrative embodiment is a simulation system for practicing vascular-access procedures without using human subjects. The simulator comprises a data-processing system and a haptics device. The haptics device provides the physical interface at which an end effector, which is representative of a medical instrument (e.g., a needle, catheter, etc.), is manipulated with respect to a haptics-device base to simulate instrument insertion. The data-processing system, by exchanging signals with the haptics device, provides a three-dimensional simulation that includes the resistive forces that a medical practitioner would experience if the simulated procedure were an actual procedure that was being performed on a real anatomy (e.g., human arm, etc.). The simulator displays the ongoing simulation and assesses the performance of its user. |
US07731499B2 |
Ultrasound simulator for craniosynostosis screening
An ultrasound simulator to train radiologists and technologists to locate and recognize patent and fused cranial sutures. The model is formed, for example, using specially fabricated heads or from life-sized plastic doll heads. Simulated suture lines are cut in the heads in anatomically correct positions. The typical end-to-end morphology of the sagittal and metopic sutures and the typical beveled appearance of the paired coronal and lambdoid sutures are created by angling the cutting blade. The hypoechoic appearance of patent sutures in ultrasound images is simulated by filling the gaps that were formed by cutting with a hypoechoic material. Fused echoic sutures are simulated by leaving that portion of the doll's head uncut, or by filling the openings with an echoic material. When imaged using ultrasound, the portions cut and filled with a hypoechoic material are readily distinguishable from uncut portions, and from portions cut and filled with an echoic material. |
US07731498B2 |
Endododontic file with multi-tapered flutes
A multi-tapered endodontic file is provided, formed from shaft of material having a shaft. The shaft includes a working portion having one or more tissue-removing edges, points and/or surfaces. The working portion includes at least a first flute and a second flute. The first flute is tapered along its length in accordance with a first predetermined taper function. The second flute is tapered along its length in accordance with a second predetermined taper function. |
US07731497B2 |
Method for manufacturing a dental prosthesis and an appliance for implantation thereof
A method of manufacturing a dental prosthesis to be implanted in a jaw of a patient, including the production of a radiological guide whose image, when the guide is placed in position on the jaw of the patient, can be processed for introducing virtual implants and guide cylinders in a surgically appropriate position; drilling holes into the guide on the basis of information obtained from the processing and placing real guide cylinders into the holes in order to form a surgical guide; placing the surgical guide on a pattern of the patient's jaw and drilling holes into the pattern through the guide cylinders; placing implant analogues into the holes drilled into the pattern; and producing the dental prosthesis on the pattern. Also, an appliance for carrying out the manufacturing method. |
US07731494B2 |
System for use in a vertical furnace
A system used in a vertical furnace is provided that includes a tube. The tube includes a tube flange at its lower end. The tube flange provides a first sealing surface at its lower end. Further, there is a structural member at the lower surface of the tube flange. This structural member extends vertically away from the lower surface of the tube flange at a position that is displaced inwardly from the first sealing surface. The system also includes a removable door plate that provides a second sealing surface at its upper surface. The second sealing surface of the removable door plate is sealed with the first sealing surface of the tube flange. |
US07731491B2 |
Fuel storage devices and apparatus including the same
A fuel storage device in accordance with a present invention includes a fuel containing substance and a heater in thermal communication with the fuel containing substance. |
US07731489B2 |
Valve for co-injection molding apparatus
A coinjection molding apparatus includes at least one manifold having a first manifold melt channel and a second manifold melt channel. A hot runner nozzle is located between the manifold and a mold gate. The nozzle has melt channels communicating with the first manifold melt channel and the second manifold melt channel. A valve has a movable valve member for increasing and decreasing flow of melt in one of the melt channels of the nozzle. The valve member receives a pressure force from the melt. An actuator provides a control force to the valve member. The valve member moves in response to a difference between the pressure force and the control force. |
US07731478B2 |
Method and apparatus for variable clearance packing
Methods and apparatus for a packing ring segment assembly for sealing a turbine gas path are provided. The assembly includes a sealing portion including radially inwardly directed teeth, and a dovetail mounting portion including a hollowed out portion including a biasing member internal to the packing ring segment. The biasing member is coupled to the packing ring segment and configured to engage a pair of annular shoulders of a dovetail groove in the turbine such that the packing ring segment is biasing radially outward at relatively low turbine loads and low working pressure, and at relatively high turbine loads and high working pressure a working fluid overcomes the radial biasing member forces and urge the packing ring segment radially inward. |
US07731475B2 |
Tilted cone diffuser for use with an exhaust system of a turbine
An exhaust system for a turbine includes an annular diffuser and a collector. The annular diffuser is positioned adjacent to a final stage of the turbine and includes a hub portion surrounding a turbine shaft and an outer cone having a substantially frusto-conical shape that is radially symmetrical about a central longitudinal axis thereof that is tilted relative to the turbine shaft. The collector has an inlet extending from the annular diffuser and an outlet. The collector is configured to include a turn that causes the collector to turn exhaust gases approximately 90° from the longitudinal axis of the turbine shaft. The outer cone of the annular diffuser is tilted in a direction of the turn of the collector. |
US07731473B2 |
Medicine tray supply apparatus
A medicine tray storage member (100) capable of storing medicine trays (7) in a stacked condition includes: a tray support member (101) for supporting the medicine trays (7); a tray transport member (102) having a transport mechanism for transporting the medicine trays (7), the tray transport member constituting a part of the tray transport line (3); and a control portion for allowing the tray support member (101) to move down to put the stacked medicine trays (7) on the tray transport member (102), thereby allowing the tray support member (101) to support and move up the next medicine tray (7) positioned above the lowermost one, and allowing the tray transport member (102) to supply the medicine tray (7) situated at the lowermost position to the tray transport line (3). The tray transport member (102) includes cut out portions (11) receiving movable leg portions (125) of a carrier (123) on which the medicine trays (7) in a stacked state are loaded. |
US07731453B2 |
Method and device for trenchless laying of pipelines
Described is a method for the trenchless underground laying of pipes. According to said method, a shield tunnel boring machine and then subsequently pipes are driven through the ground starting from a starting shaft. The shield tunnel boring machine produces a borehole whose diameter is slightly greater than the outer diameter of the pipes. The annular space between the borehole wall and the pipes thereby obtained is filled with a supporting and lubricating agent. During advance, a continuous and periodical examination of the composition of the ground is carried out in the area of the shield tunnel boring machine or the first pipe following the shield tunnel boring machine or the first lubricating point. Depending on the result of the examination, the ground in the examined area is sealed off and/or solidified by a sealing and/or solidifying agent and/or the composition of the supporting and lubricating agent is adjusted. |
US07731448B2 |
Portable rumble strip
A portable rumble strip that is adapted to conform to a roadway having a base portion, grips that adhere to the roadway, and a plurality of vibrators protruding away from the roadway. The vibrators are effective to cause a vibration in a tire when engaged by a moving vehicle and effectively alerting the driver of the vehicle. |
US07731444B2 |
Device for coupling a plastic part and a body shell structure
A system to couple a plastic part and a body structure includes a plate and an elastic member as part of the body structure. Additionally, the plastic part includes an opening and an oblique stop at an end of the opening. The plate is received within the opening. The elastic member includes a first end that is free and a second end that is fixed to the plate. The elastic member biases the plate with respect to the plastic part. In a first position, the first end of the elastic member contacts the oblique stop. In a second position, the first end of the elastic member contacts the oblique stop such that the first end of the elastic member is displaced in a vertical direction and a horizontal direction compared to the first position. Additionally, the elastic member is slideable along the oblique stop. |
US07731442B2 |
Adjustable tab divider
Embodiments of the invention relate to dividers with tabs adjustable along at least two edges of the binder. One embodiment is directed to a divider for use in a binder. The divider comprises a panel, the panel comprising a binding edge and a plurality of non-binding edges, and a tab. The panel comprises at least one binding feature adjacent the binding edge and at least one tab mating feature adjacent at least first and second edges of the plurality of non-binding edges. The tab is configured to mate with the at least one tab mating feature. The at least one tab mating feature is configured such that the tab is positionable in at least two longitudinal positions along the first non-binding edge and in at least two longitudinal positions along the second non-binding edge. |
US07731440B2 |
Application material extruding container and forming method of application material extruding container
To reduce manufacturing cost of an extruding container, a female thread member (5) integrally has an outer tube (5a) and an inner tube (5b) with an annular space (5s) between them being open to one side in an axial direction, and the inner tube (5b) has a female thread (5e) formed on an inner peripheral surface from one side and to extend in the axial direction and slits (5n) extending in the axial direction and being open to one side, while a core pin including a male thread corresponding to the female thread (5e) and a protruding portion corresponding to the slits (5n), is drawn out from an outer mold after a middle mold having a convex portion corresponding to the space (5s), whereby the core pin can be drawn out without breaking the female thread (5e) as the inner tube (5b) is expanded by the slit (5n). |
US07731433B1 |
Optoelectronic surface-mounted device and method for forming an optoelectronic surface-mounted device
An optoelectronic surface-mounted device is provided comprising a premolded casing having a first cavity and a second cavity and a leadframe to which a first electrooptical element and a second electrooptical element are mounted. The leadframe is embedded in the premolded casing. The first cavity is adapted for providing a first electromagnetic radiation path between a first waveguide and the first electrooptical element, wherein the second cavity is adapted for providing a second electromagnetic radiation path between a second waveguide and the second electrooptical element. The first cavity and the second cavity are formed in the premolded casing to decouple electromagnetic radiation propagating along the first electromagnetic radiation path from electromagnetic radiation propagating along the second electromagnetic radiation path. |
US07731425B2 |
Polywoven pinch bottom open mouth bag
A pinch bottom open mouth bulk material bag fabricated from polywoven material has closures at one or both ends that are non-sewn and which comprise a strip of tape running in the cross-bag direction. The tape is folded over the respective bag end, which may be modified, and is glued in place to close the end. The closure has no holes or other openings through which contaminants may enter the bag interior. |
US07731421B2 |
Fluid level indication system and technique
A technique that is usable with a well includes changing the temperature of a local environment of a distributed temperature sensor, which is deployed in a region of the well and using the sensor to acquire measurements of a temperature versus depth profile. The region contains at least two different well fluid layers, and the technique includes determining the depth of a boundary of at least one of the well fluid layers based at least in part on a response of the temperature versus depth profile to the changing of the temperature. |
US07731418B2 |
Thermometer calibration
A method for calibrating a thermometer is provided. The method includes deriving values of at least two different reference calibration coefficients of a reference calibration equation. The reference calibration equation relates temperature of a reference temperature sensor to at least two different calibration coefficients and a measured characteristic of the reference temperature sensor. A primary temperature sensor of the thermometer is calibrated using the derived values of the at least two different reference calibration coefficients. In another method for calibrating a thermometer, value of at least one reference calibration coefficient is derived from a reference calibration equation. The reference calibration equation is a non-linear equation relating the temperature of the reference temperature sensor to the at least one calibration coefficient and a measured characteristic of the reference temperature sensor. |
US07731400B2 |
Lighting or signaling device comprising a curved light guiding plate
A lighting or signaling device for a motor vehicle which is capable of emitting a linear beam in the direction of an optical axis and which comprises a point light source that emits light rays radially around a source; a light ray guiding plate; wherein the light guiding plate is shaped so that the light rays generally propagate in incident propagation planes normal to the plate between the light source and the reflection edge and in reflected propagation planes normal to the plate between the reflection edge and the output edge. |
US07731399B2 |
Illumination in the area of aircraft cabins
The present invention relates to an illumination strip for illuminating a handrail recess that itself at the same time forms a handrail; to a hatrack for installation in an aircraft cabin with a correspondingly designed handrail recess that at least in sections can be illuminated; as well as to the use of an illumination strip or a hatrack in an aircraft. The illumination strip comprises a carrier module for accommodating the illumination unit and illumination units accommodated by the carrier module. The carrier module is strip shaped and includes a positive locking member to secure the carrier module of the illumination strip into the handrail in an exchangeable manner. |
US07731394B2 |
Display device
The present invention provides a display device including: a transparent plate having at least one recessed portion formed on a rear surface side thereof, the recessed portion forming a pattern corresponding to a design to be displayed; a first reflecting member which is disposed on the rear surface side of the transparent plate and on a region except for the recessed portion of the transparent plate, and has light reflectivity at a surface facing the transparent plate; a second reflecting member which is disposed on the rear surface side of the transparent plate and on a region including the recessed portion of the transparent plate, and has light reflectivity at a surface facing the transparent plate; and a light emitting device for emitting light, when illuminated, to a front surface side of the transparent plate through the recessed portion of the transparent plate without exiting light from the region except for the recessed portion of the transparent plate to the front surface side of the transparent plate, the light source being disposed on the rear surface side of the transparent plate. |
US07731376B2 |
Lighting device for display device and display using the same
A backlight device includes a light guide plate opposed to fluorescent tubes, a diffusion sheet stacked on the light guide plate, and lens sheets further stacked on the diffusion sheet. A tip end of a corner portion of the diffusion sheet has a shape defined by removing a portion of the sheet along a straight line spanning between two sides constituting the corner portion. In first of the lens sheets, a tip end portion of a corner portion formed by two sides has a shape defined by removing a portion of the sheet in a larger amount than in the diffusion sheet by a circular arc which projects outward. In a second of the lens sheets, a tip end of a corner portion formed by two sides has a shape defined by removing a larger amount than in the first of the lens sheets along a straight line. |
US07731374B2 |
Reconfigurable instrument cluster
An illuminated gauge for a vehicle instrument panel includes a single LCD having at least a first display configuration and a second display configuration different from the first display configuration. A pointer is selectively actuatable to operate within one of the first and the second display configurations. A selector is used to switch between the first and second display configurations. |
US07731373B2 |
Window with resistance heating element
An electrically heated window intended to be fitted with an imaging device which views an object through a viewing area of the window. A resistance heating element comprises at least one electrically conductive wire extending across the viewing area a plurality of times along a plurality of arc-shaped path. |
US07731360B2 |
Portable video oculography system
A goggle based light-weight VOG system includes at least one digital camera connected to and powered by a laptop computer through a firewire connection. The digital camera may digitally center the pupil in both the X and Y directions. A calibration mechanism may be incorporated onto the goggle base. An EOG system may also be incorporated directly into the goggle. The VOG system may track and record 3-D movement of the eye, track pupil dilation, head position and goggle slippage. An animated eye display provides data in a more meaningful fashion. The VOG system is a modular design whereby the same goggle frame or base is used to build a variety of digital camera VOG systems. |
US07731357B2 |
Method for designing group of bi-aspherical type progressive-power lenses, and group of bi-aspherical type progressive-power lenses
There is provided a group of bi-aspherical type progressive-power lenses for which the processing costs are reduced. In a bi-aspherical type progressive-power lens(es), the relationships DHf+DHn |
US07731352B2 |
Image forming apparatus capable of allowing easy maintenance
An image forming apparatus includes a door which is disposed on a rear surface of the image forming apparatus that allows a portion of the rear side thereof to open. The image forming apparatus further includes an image forming unit. The door is disposed at a position accessible to the image forming unit. The door includes a swelling portion which outwardly swells and receives parts and devices therein, for example, cables and tubes of the image forming apparatus. The swelling portion has an arc shape. The door on the rear surface of the image forming apparatus serves as a door for maintenance. The image forming unit includes an inkjet type image forming unit. The image forming unit includes a gel-inkjet type image forming unit. |
US07731349B2 |
Printing machine
A printing machine includes a transfer device including a conveyor having suction holes formed therethrough for transferring cardboard sheets one by one, a suction device for applying a suction force on one of the two surfaces of each of the cardboard sheets, which one of two surfaces faces the conveyor, and ink jet heads located to face the other of the surfaces of each of the cardboard sheets to be spaced apart therefrom. The ink jet heads are located in such a manner that a desired distance is maintained between tips of the ink jet heads and the other surface to be printed and include ink jet nozzles from each of which ink is jetted out toward said the other surface. The ink jet heads have skirts located upstream and downstream of the transferring direction of the cardboard sheets in such a manner that the skirts extend from the ink jet heads toward the other surface and have a width which covers the ink jet nozzles so as to form a partition in a space between the ink jet nozzles and the other surface. |
US07731348B2 |
Inkjet recording apparatus
An inkjet recording apparatus comprising: a conveyance belt for conveying a recording medium; a cleaning roller kept in contact with the conveyance belt to clean the conveyance belt; and a controller for controlling the cleaning roller so as to be able to select between two modes for its driving, wherein the two modes are the mode in which the cleaning roller is driven by the movement of the conveyance belt and the mode in which the cleaning roller is driven independently of the movement of the conveyance belt. |
US07731335B2 |
Data storage device mounting arrangement for printing device
The present invention provides a pedestal that protrudes from a fluid reservoir device that retains fluid for a fluid-ejection printing device. A data storage device may be mounted on the pedestal such that when the fluid reservoir device is inserted into a supporting structure, the pedestal and data storage device mounted thereon protrude into or through an opening in a surface of the supporting structure. Consequently, a disconnectable connection to the data storage device may be made at a location other than the inside of the supporting structure. Accordingly, connection to the data storage device is simplified and the risk of damage or a reduction in performance to the data storage device or its electrical contacts from fluid leaks from the fluid reservoir device is reduced. |
US07731329B2 |
Drum-mounted roller spittoon system and method
Various embodiments of a system and method for spitting are disclosed. |
US07731328B2 |
Wiper and cleaning device, and inkjet image forming apparatus including the same
A wiper, a cleaning device, and an inkjet image forming device including the wiper and the cleaning device. The cleaning device includes a carrier moving in a lengthwise direction of a nozzle unit, the length of the nozzle unit corresponding to a width of a printing medium, a driving element moving the carrier forwards and backwards, and a wiper mounted on the carrier and removing ink adhered to the nozzle unit, wherein the wiper includes a belt member which is supported by a plurality of pulleys and circularly moves along a predetermined path and a cleaning member which is attached to an outer circumference of the belt member and removes the ink adhered to the nozzle unit while rotating in contact with the nozzle unit. Accordingly, an absorption capacity of the wiper is increased using the belt type wiper. Furthermore, since the absorption capacity of the wiper is increased, a replacement cycle for replacing the wiper is extended, thereby increasing the life span of the wiper. The ink absorbed into the cleaning member is removed again using a second pressing unit or a cleaning roller, and hence the absorbency of the cleaning member can be maintained and the replacement cycle can be extended. |
US07731327B2 |
Desktop printer with cartridge incorporating printhead integrated circuit
A desktop printer unit having a printhead cartridge, capping mechanism, a media input assembly, a media output assembly and a transfer mechanism. The printhead cartridge defines an ink reservoir and has a pagewidth printhead integrated circuit having a plurality of micro-electromechanical nozzle arrangements and the capping mechanism for the nozzles. The transfer mechanism transfers printing media from the input assembly past the printhead integrated circuit to the output assembly. |
US07731326B2 |
Storage system
Various embodiments of a storage system are disclosed. |
US07731317B2 |
Liquid jetting device
A liquid jetting device includes a plurality of nozzles provided in a liquid jetting head, a charge-discharge actuator provided in correspondence with each nozzle, and a driving section for applying a driving signal to the charge-discharge actuator to jet liquid from the corresponding nozzle. The liquid jetting device includes a driving wave-form signal generating section configured to generate a driving wave-form signal as a basis of a signal for controlling a drive state of the actuator. A driving signal generating section is configured to amplify the driving wave-form signal generated by the driving wave-form signal generating section using a charge-use transistor and a discharge-use transistor connected in a push-pull configuration, and output a driving signal. |
US07731311B2 |
Closing device
A closing device for a drawer comprising an elongate hollow housing which includes front and rear portions, a rotating member slidably mounted in the front portion and a resilient member mounted in the rear portion. The front portion includes first and second portions with the first portion having a rotation-preventing internal surface and the second portion having a rotation-admitting internal surface. A locking step is defined by the differing internal cross sections of the first and second portions. The rotation of the rotating member in the first portion is prevented by the internal shape of the first portion relative to the external shape of the rotating member. The rotating member has an angular slot for receiving a guiding pin which is downwardly extending from the bottom surface of a top roller guide. |
US07731310B2 |
Diagonally extending slideout drawer assembly and structure therewith
A bathroom fixture has slide-mounted pullout drawers that extend diagonally forward from its sides. The fixture can be a lavatory with a vanity base in which one or more drawers are slidably mounted. The slide mechanism for each drawer includes a fixed race and telescoping rail supporting the drawer from underneath and another fixed race and telescoping rail mounted between a side wall of the drawer and a vertical support member. Both telescoping slides are mounted diagonally with respect to the front and the associated side of the vanity. |
US07731309B2 |
Dishwasher
A dishwasher comprising a base structure on which a tub is mounted. It comprises a top structure connected to the base structure by the strut-shaped members providing a cage-shaped support structure around the tub. |
US07731302B2 |
Stability enhancing system for tow-vehicle towing trailer assembly
A system for providing enhanced force and motion stability and management for a tow-vehicle towing a trailer assembly is disclosed. The system includes a tow-vehicle with an electronic stability enhancing system in communication with a processor with memory, and sensors located on the tow-vehicle are used for detecting engagement with a trailer and communicating with a trailer electrical system and the processor. Computer instructions instruct the processor to identify specifications representing the tow-vehicle and the trailer and to calculate at least one force, at least one motion, and combinations thereof, affecting the tow-vehicle and trailer assembly. Computer instructions provide instructions for braking to at least one wheel of the tow-vehicle using the at least one force, the at least one motion, the electronic stability enhancing system, and the specifications of the tow-vehicle towing the trailer assembly. |
US07731301B2 |
Adjustable width drive axle and drive unit
Disclosed herein is an adjustable width drive axle including: a main axle body including a telescoping portion disposed at each end of the main axle body; a sprocket affixed to each end of the main axle body, the sprocket designed to engage a drive unit; a first spacer removably affixed to the sprocket, the first spacer disposed around the telescoping portion of the main axle body; and a hub removably affixed to an end of the first spacer opposite the sprocket, wherein one or more additional spacers may be interposed between the first spacer and the hub or between the sprocket and the first spacer to adjust the width of the axle. |
US07731300B2 |
Hubcap for heavy-duty vehicles
A hubcap for a wheel end assembly of a heavy-duty vehicle seals an outboard end of the wheel end assembly. The wheel end assembly includes a wheel hub formed with a cavity that contains lubricant, and the hubcap positively engages and mounts on the outboard end of the wheel hub to prevent the escape of lubricant and the ingress of contaminants. The integrally-formed hubcap includes a generally cylindrical sidewall and an outboard wall that extends generally perpendicular to the sidewall. A lip extends inboardly from and a shoulder extends radially outwardly from an inboard end of the sidewall, and the lip and shoulder cooperate to positively mechanically engage the outboard end of the wheel hub. An O-ring is disposed between the lip and the wheel hub to provide a seal. The hubcap also is adapted to accommodate components of a tire inflation system and other auxiliary components. |
US07731295B2 |
Chair having adjustable weight proportion accepting elements
A seat includes a tray, a net mounted on the tray and a supporting device provided between the tray and the net. Thus, when a user sits on the seat, the net takes a proportion of the user's weight while the supporting device takes another proportion of the user's weight. |
US07731291B2 |
Single frame sling chair
A sling chair includes a back frame member having side rails held in substantially parallel relation by a pair of cross bar members. In one embodiment, the cross bar members are generally curved so as to extend away from the back faces of the side rails, forming a concave back structure which can receive a sling member and, eventually, a seated occupant. The cross bar members are adapted to retain the sling member in secure fashion through upper and lower backrest assemblies, resulting in better support and more efficient assembly. This also facilitates separate provisioning of decorative features to improve the chair's aesthetic qualities. |
US07731289B2 |
Automotive seat reclining device
An automotive seat reclining device includes a first rotation member connected to one of a seat back and a seat cushion and having an internal gear and a bearing sleeve coaxial with the internal gear, a second rotation member connected to the other of the seat back and the seat cushion and having an external gear and a bearing bore coaxial with the external gear, a pair of wedge members disposed in a circular eccentric space between the bearing sleeve and the bearing bore and a drive member inserted in the eccentric space to move the mesh of the internal and external gears by pushing the wedge members and rotate the second rotation member relative to the first rotation member. Each of the wedge members has an inner circumferential surface formed with a recessed section and two contact sections for contact with an outer circumferential surface of the bearing sleeve. |
US07731287B2 |
Vibration absorber device for a seat in a vehicle, in particular an aircraft or the like
A framework fixed to the structure of a vehicle, which framework carries a generally planar seat proper via mobility structure for providing the seat proper with mobility relative to the framework. The seat proper is rigid and is suspended from the framework via a deformable structure which is deformable in at least one of the dimensions of the plane of the seat proper. The plane of the framework for supporting the seat proper is disposed above the plane of the seat proper that is supported by the framework, so as to impart a pendular type structure to the structure providing mobility to the seat proper relative to the framework. |
US07731284B2 |
Child restraint with swiveling juvenile seat having a seat-anchor guide channel
A child restraint includes a seat support and a juvenile seat mounted to swivel about an axis on the seat support. The seat support is adapted to set on a vehicle seat. |
US07731283B2 |
Seating accessory
A seating pad assembly is provided for use by travelers to increase the comfort for a seat on a public transportation vehicle or at a public transit terminal. The seating pad assembly includes a cushion formed from a viscoelastic foam and having dimensions substantially conforming to the dimensions of at least the hip/thigh support and the back support of the seat. Thus, the viscoelastic foam will bridge hard points and pinch points of the seat and will efficiently support the traveler across the gap. The seating pad assembly further includes a removable cover, straps for holding the pad in a coiled condition and a carrying bag for transporting the pad assembly. |
US07731281B2 |
Vehicle seat
An impact absorbing plate 31 is disposed between a front part 31z of the impact absorbing plate 31 and a vehicle body 11 so that a rupture generating part 44 ruptured by impact is extended in the front and rear direction of the vehicle, and the impact absorbing plate 31 is fixed to a front part 13a and a rear part 13b of the front seat bracket 13 provided in the vehicle body by rivets 33 and 33. A portion of front part 31z of the impact absorbing plate 31 is cut to form a cutoff part 45, and a front end 17a of a rail 17 provided in a seat section is attached to a convex part 35, which is molded so as to expand upward an inner side of the cutoff part 45, by a rivet 34. |
US07731273B2 |
Work vehicle viewing system
A work vehicle is provided including a frame structurally carrying a cab structure having a brim including a plurality of viewing openings. The cab structure structurally carries a window in close proximity to the brim and is disposed above an operating viewing position. The window and brim are in viewing alignment from the operating viewing position. The window is sufficiently disposed within the cab structure for protection from vertically falling objects. |
US07731268B2 |
Armrest support bracket for motorized vehicles
A support bracket for an armrest assembly having a pull-handle or pull-cup is provided for use in a motorized vehicle. The support bracket includes a generally horizontal support member configured to extend, at least in part, adjacent to or through an internal cavity of the pull-handle/pull-cup. The support bracket also includes at least two, but preferably three leg members spaced apart from one another and operatively attached at respective first ends to the support member. Each leg member extends downward from the support member in an oblique manner to attach at a respective second end to an inner support panel. The leg members are configured to sustain a predetermined minimum vertical loading condition, and controllably deform under a predetermined threshold lateral loading condition. The leg members create a load path for transferring vertical loads imparted to the armrest assembly to the vehicle interior surface as a substantially vertical force. |
US07731267B2 |
Convertible vehicle
A convertible car includes a mobile roof which can be retained on a windshield frame when closed. For retaining the roof, at least two mobile engaging elements and at least one actuating element for the same are provided. The actuating element is operatively coupled with the engaging elements via respective force transmitters which project with one component in the vehicle transverse direction. At least inward pointing ends of the force transmitters, for the purpose of force transmission, are movable in a purely translational manner and in parallel to their projecting component. |
US07731265B1 |
Auxiliary sun visor attachment and associated method
An auxiliary sun visor may include a body and bracket spaced therefrom. The bracket may be removably attached to an existing vehicle sun visor. The apparatus may further include a mechanism for freely articulating the body along an x-axis and a first y-axis and a z-axis, while simultaneously pivoting the bracket about a second y-axis respectively. The mechanism may include a ball joint and a hinge which connects the body and the bracket and permits the body to articulate while the bracket remains stationary. The bracket may be secured to the existing vehicle visor by a plurality of clips with teeth. The body may include a chamber housing a panel. The panel is preferably slidably interfitted into the chamber through a distal open end of the body. |
US07731262B2 |
Closure damper assembly
A closure assembly for a vehicle pivotable between a closed position and a full open position, and a method of controlling its movement includes a closure, a hinge mechanism attached to the closure, and a damper assembly. The damper assembly includes a damper actuator and a pneumatic closure damper, with the closure damper including a hollow bellows extending from a support base, an orifice and an end opposite the support base. The damper actuator is attached to the hinge mechanism and the support base is attached to the body structure such that the damper actuator is spaced from the end when the closure is in the closed position and the damper actuator is in contact with the end and compresses the bellows when the closure is in the full open position. |
US07731250B2 |
Electromechanical push to close latch
An electromechanical push to close latch has a pawl positioned for linear movement in a housing, with the pawl being biased to the outward extended position. An electric motor operates a cam to change the position of the pawl thereby retracting it into the housing. An electronic circuit board controls the operation of the electric motor under the direction of an outside control signal. The circuit board also senses the position of the pawl to stop the operation of the motor when the pawl is fully retracted. The pawl mounting can be reconfigured for the pawl to extend and thereby operate in a plurality of selectable directions. |
US07731249B2 |
Mechanism for locking a vent cover with a base
A vent assembly has a locking mechanism to retain its cover on its base. The locking mechanism includes a latch and linkage coupled with the latch to move the latch between a locked and an unlocked position. A post member extends from the cover to cooperate with the latch such that in a locked condition, the cover is locked with the base in a closed position. When the latch is moved to a second position, the cover is enabled to pivot away from the base to an open position. |
US07731247B2 |
Device for connecting and blocking hollow elements for the formation of fluid distribution plants
The invention relates to a device for connecting and blocking hollow elements used as piping for fluids, both gaseous and liquids, The hollow elements (11,13) are connectable by plugs or anchoring plates (19) and connecting plate (21), engaging at least one wall of adjacent elements and fixed by anchoring screws (22). At least the connecting plate (21) is provided with protrusions or contact grips (24) designed to physically penetrate into the surface of the elements to be connected when the connecting plate is anchored to the anchoring plate by the screws. |
US07731246B2 |
Pipe coupling system
A tubular coupling system and method; the system and method in at least certain aspects, using a coupling member with an interior protective ring that has at least one inner energizing member which, upon compression, forces the body of the coupling member against an interior wall of the coupling thereby inhibiting corrosive material from contacting the coupling's interior wall or, in the event some corrosive material does enter this area, holding the interior protective ring against the coupling's interior wall so that the corrosive material remains in and does not exit this area, thus inhibiting or preventing a continuous flow of corrosive material. |
US07731243B2 |
Coupling element for removably joining pipes
A female coupling element includes two superposed coaxial rings, a locking ring and safety ring which are rotatably mounted about a body of the coupling element. The locking ring is axially immobilized with respect to the body while the safety ring is able to slide with respect to the locking ring and with the body. The locking ring (2) has at least one locking slot for receiving a projection of a second element inserted within the coupling element and a notch to lock the projection axially with respect to the coupling element, and the safety ring includes at least one safety slot having a notch which locks the projection circumferentially in the notch of the locking ring. |
US07731236B2 |
Rotating joint with captured washer assembly and method
A rotating joint is provided having a washer with a through-hole, a base, and a shoulder; a rotatable member having a primary hole circumscribing the center hole and sandwiched between the shoulder and base; and a fastener having a shaft that is insertable into the through-hole and connected with a mating threaded receptacle for applying a clamping force on the washer for preventing axial movement of the member while allowing the member to rotate. The shoulder is rolled, and the fastener is non-shouldered and does not use a load distribution washer. The rotatable member includes an opening for connecting a seat belt when the joint is used as a seat belt anchor. The shoulder has a lip overhanging the base, and the rotatable member is positioned therebetween. A method is also provided wherein the joint is captured by the washer separately from the application of the clamping force. |
US07731234B2 |
Air bag module with diffuser
An apparatus (10) helps to protect an occupant of a vehicle. The apparatus (10) includes an inflatable vehicle occupant protection device (14), an inflation fluid source (26), and a diffuser plate (200). The inflation fluid source (26) provides inflation fluid for inflating the inflatable vehicle occupant protection device (14). The diffuser plate (200) is disposed between the inflation fluid source (26) and the inflatable vehicle occupant protection device (14). The diffuser plate (200) includes a main body portion (210) and a plurality of raised portions (230). The raised portions (230) define slots (232) for allowing inflation fluid to flow from the inflation fluid source (26) to the inflatable vehicle occupant protection device (14). |
US07731230B2 |
Air bag with deployment flap
An apparatus (10) for helping to protect an occupant (20) of a vehicle (12) includes an inflatable vehicle occupant protection device (14) inflatable from a stored condition to a deployed condition in which the protection device is positioned between an instrument panel (36) of the vehicle and the vehicle occupant. The protection device (14) includes upper portion (142) and a lower portion (144), each of which is at least one of rolled and folded. The upper portion (142) and the lower portion (144) are positioned overlying each other when in the stored condition. A deployment flap (120) includes a sheet of material having a first end portion (130) secured to the vehicle. The deployment flap (120) has a central portion (134) that wraps around the lower portion (144) and a second end portion (132), opposite the first end portion (130), that is tucked under the lower portion while the protection device (14) is in the stored condition. |
US07731228B2 |
Steering wheel for a motor vehicle with a gas bag module
A steering wheel for a motor vehicle has a gas bag module (12) including a covering cap (14) and a gas bag (22). At least one vent opening (18) for diverting the gas is provided in the covering cap (14), in a foam (16) surrounding the steering wheel skeleton or in the hub region (20) of the steering wheel. |
US07731227B2 |
Head protection airbag device
In a head protection airbag device according to the invention, non-inflating portions of an airbag includes a blocking portion which covers the vehicle interior side of windows when inflation of the airbag is completed. One blocking portion includes a downward movement inhibiting portion catching a passenger's head and inhibiting its downward movement when the head moves downward while moving toward the vehicle exterior and touches the blocking portion when inflation of the airbag is completed. The blocking portion comprises overlapping vehicle interior side and the vehicle exterior side portions which are mutually connected, with a portion of a vehicle interior member by the upper edge made to be the downward movement inhibiting portion. The downward movement inhibiting portion is connected at both the front and rear edges to the vehicle exterior member of the blocking portion, allowing the upper edge of the downward movement inhibiting portion to be a catching edge which can be separated from the vehicle exterior member when catching the head. |
US07731223B2 |
Airbag module
Disclosed is an airbag module which can improve working efficiency because it is easy to assemble, reduce weight while maintaining sufficient rigidity, and ensure sufficient safety. The airbag module comprises: a cushion assembly including an airbag cushion; an inflator for supplying gas to the airbag cushion to deploy the airbag cushion; a housing for containing the cushion assembly, and having a through hole for arranging the inflator therethrough; and a cushion support for supporting the cushion assembly, and including through rings for passing the inflator therethrough so as to be supported by the inflator arranged through the through hole. |
US07731219B2 |
Trailer tongue pivot hinge
Apparatus, methods, and other embodiments associated with a trailer tongue pivot hinge are described herein. In an embodiment, a pivot assembly for a tongue of a towing trailer includes a trailer arm adapter, a coupler arm adapter, and a pivot member. The trailer arm adapter includes an engagement face positioned at an angle, along with a pivot hinge member and a coupling hinge member extending from the engagement face, where the coupling hinge member is opposed to the pivot hinge member. The coupler arm adapter includes an engagement face positioned at an angle, along with a pivot hinge member and a coupler hinge member extending from the engagement face, where the second coupling hinge member is opposed to the second pivot hinge member. The pivot member is positioned to pivotally engage the trailer arm adapter to the couple arm adapter. |
US07731212B2 |
Vehicle side step
A step assembly for a vehicle comprising an elongated main body having a substantially straight portion and two end portions; a generally U-shaped step bar having a substantially straight portion parallel to the main body and two bent portions, the bent portions welded to the main body and a step surface having a plurality of apertures that is affixed to the step bar to provide traction to the user. The main body is preferably welded to at least one support bracket. The installation of the step assembly is a two step process that comprises engagably attaching at least one mounting bracket to a vehicle and then engagably attaching the support bracket, which is preferably welded to the main body, to the mounting bracket. |
US07731208B2 |
Tag axle operating system
A tag axle operating system comprises a gas circuit with gas at a prescribed pressure and a hydraulic circuit that delivers hydraulic fluid pressure to raise and establish the tag axle in an inactive condition and to lower and establish the tag axle in an active condition. The hydraulic circuit establishes a prescribed hydraulic pressure opposing the gas pressure and a resulting force forcing the tag axle tires to bear against a road surface and the tag axle to accept a predetermined load. A brake valve allows air pressure delivery to operate tag axle air brakes while the prescribed hydraulic pressure is maintained and prevents such delivery to disable the brakes when the prescribed hydraulic pressure is relieved. And the hydraulic circuit operates to relieve the prescribed hydraulic pressure to relieve the force on the tag axle and disable the brakes when the tag axle experiences a predetermined tilt angle. |
US07731201B2 |
Work fixing device
A work fixing device capable of stably fixing the work, without any biasing, in the longitudinal direction of the work, of the fastening force for fixing the work. The moving mechanism of clamps is constructed by comprising a scroll disc as working disc forming a circular hole in which to insert the work at the center and scroll guides in spiral shape the winding direction of which is opposite to each other from the center toward the outer circumference on the both side faces, a rotary drive mechanism for rotatably driving this scroll disc, and scroll pieces having a fitting portion to be engaged with the scroll guides of the scroll disc and disposed on both sides of the scroll disc in a way to correspond to a plurality of clamps respectively. |
US07731195B2 |
Video poker game having second draw option
A method of conducting a video poker game is disclosed. The method comprises offering players an option to draw cards a second time in response to an initial hand meeting certain pre-established requirements. For example, if an initial hand having five cards includes four cards to a royal flush or straight flush, or three cards to a four of a kind, the player may be provided with the second draw opportunity. The player may also have to hold the pre-established cards. To participate in the second draw opportunity the player places a second wager such that payouts are provided from a second pay table wherein certain payouts are decreased over those found in a pay table associated with one draw outcomes. In some versions, the second draw opportunity is only provided to players placing a first wager meeting or exceeding a minimum threshold value (e.g., maximum coins or units). |
US07731189B2 |
Paper guide adjusting mechanism and office machine using such mechanism
A paper guide adjusting mechanism of an office machine includes a main body, a plurality of elastic elements, a transmission member, a plurality of fixing elements and a pressing plate. The main body includes a plurality of confining elements, which have respective recess structures. The transmission member includes a roller axle and a plurality of rollers, wherein the roller axle is partially received in the recess structures and the rollers are sheathed around the roller axle. The fixing elements are disposed in respective recess structures of the confining elements, wherein each fixing element has a base and the base has a first surface sustained against a corresponding elastic element and a second surface sustained against the roller axle. The pressing plate is sustained against the elastic elements. |
US07731182B2 |
Sliding mechanism, sheet guide, sheet loading device, and image forming apparatus
A sliding mechanism includes a sheet position limiting member having a sheet position limiting surface, the sheet position limiting member being configured to slide in a direction perpendicular to the plane of the sheet position limiting surface; and a guide member configured to guide the sliding of the sheet position limiting member. |
US07731180B2 |
Sheet-feeding cassette and image forming apparatus
A sheet-feeding cassette includes a main body. A locked portion allows the main body to be locked to a locking portion in a cassette accommodating section by inserting the main body in the cassette accommodating section. An unlocking unit is provided for detaching the locked portion from the locking portion when the main body is drawn out of the cassette accommodating section. A handle is provided in the main body and includes fixed and movable grips. The fixed grip has a recess with a “]” shaped cross section open to the insertion direction. The movable grip is slidable to a fitted state in the recess of the fixed grip when the handle is gripped, and a projecting state projecting partially from the recess when gripping is released. The unlocking unit operates for unlocking in accordance with changing of states of the movable grip from the projecting state to the fitted state. |
US07731174B2 |
Paper pickup device and image forming apparatus having the same
Provided are a paper pickup device and an image forming apparatus having the same. The paper pickup device and the image forming apparatus having the same include a driving shaft whose end has a first combining portion and a driving shaft having a second combining portion configured to be integrally connected with the first combining portion. When the first combining portion and the second combining portion are combined with each other, the driven shaft bends and separates from the driving shaft. The first combining portion and the second combining portion may be screw-coupled to each other. |
US07731170B2 |
Open/close mechanism for paper tray for use in image forming apparatus
An open/close mechanism can be used for paper trays of an image forming apparatus. The open/close mechanism includes a plate member provided on a side of a housing of the image forming apparatus and configured to pivot upon an axis between an open position and a close position, and a box member that is arranged in the housing beneath the plate member and that can be drawn out of the housing from the side. The open/close mechanism includes also includes a restricting unit that is coupled to the plate member and that abuts against the box member when the box member is set in the housing and when the plate member is in the open position thereby restricting detachment of the box member from the housing. |
US07731169B2 |
Sheet finishing apparatus
Sheet finishing apparatus constructed to prevent sheet skewing during stacking conveyance, and stack-disarranging sheet slippage. A sheet-stacking tray is disposed forming a break in a discharge path below a discharge outlet. A first discharge roller unit is disposed at the discharge outlet, and a second discharge roller unit is arranged to convey, in cooperation with the first discharge roller unit, sheets downstream to the stacking tray. The second discharge roller unit is supported allowing it to rise and lower between an engage position where it catches sheet(s) on the storage tray, and a retracted position. A registering wall is provided in the stacking tray, for positionally registering the leading/trailing edge of the sheets. A gripper pressingly holds the uppermost sheet stacked on the storage tray, and a controller controls the movement of the gripper between an operational position where it engages the uppermost sheet, and a non-operational retract position. |
US07731166B2 |
Universal insert support for holding and positioning parts of complex shapes
The invention concerns a process and the associated universal device for supporting a part (1) of random and/or possibly complex shape in relation to a rigid base (11) while establishing a work reference. It consists of inserting between the part to be held and the rigid base (11), at least one deformable airtight enclosure (3) of constant volume full of incompressible particles (4). Then vacuum is applied inside the deformable enclosure (3) of constant volume using a vacuum source (5) which can be connected to the deformable enclosure (3). Thus the particles (4) amalgamate to constitute a solid block which at least partially rests on the rigid base (11) and holds the part (1) matching its shapes. |
US07731164B2 |
Vibration damper device comprising a flange ring capable of coming to a stop against a damper unit
The invention relates to a damping device, in particular for mounting a support plate (10) comprising a cylindrical damper unit (12) with a main axis (A) that comprises a top radial flange (20s) and a bottom radial flange (20i) which are cylindrical and each of which is accommodated by one side in a horizontal plate (18) of the plate (10), wherein the plate (10) comprises at least one cylindrical flange (26s, 26i) supported by the horizontal plate (18) which extends opposite the outer cylindrical surface (20e) of an associated flange (20s, 20i). characterized in that the flange ring (26s, 26i) comprises a concave inner cylindrical surface (26a) which is capable of resting radially against a convex outer cylindrical surface (20e) of the flange (20s, 20i), in at least one overall horizontal direction. |
US07731159B2 |
Continuous metallic system for safety barriers applicable as protection for motorcyclists made up of a bottom continuous horizontal metallic screen supported on the barrier by means of metallic arms arranged at regular intervals
The invention relates to a continuous metal system which is used to protect motorcyclists and which can be installed on a standard metal safety barrier. The invention comprises a continuous horizontal metal panel (4) which is disposed between the fence (1) and the ground (40). According to the invention, the panel (4) is suspended from the fence (1) by means of arms or support pieces (5) which are positioned at each post (2) and arms which are positioned at the centre of each bay (6) and which are solidly connected to clamps (7). In addition, both arms (5 and 6) are fixed to the fence (1) using the same screw (8). |
US07731153B2 |
Handle for valves
A handle (1) for valves (4) comprising a connecting region (2) for connecting the handle (1) to a spindle (5) of the valve (4), an actuating arm (3) for actuating the valve (4), a locking lever (8) arranged resiliently in the actuating arm (3) for engaging the actuating arm (3) and a locking and guide disc (16) for locking and guiding the handle (1), the locking and guide disc (16) having a greater external diameter than the connecting region (2) and being arranged to be able to be connected to a flange region (12) of the valve (4). |
US07731151B2 |
Pendulum vacuum gate valve
A pendulum vacuum gate valve comprised of a housing for enclosing a valve plate assembly having a pair of air pressure actuated floating seal plates disposed on opposite sides of the valve plate assembly which is actuated by a gate arm to reciprocate between open and closed positions and intermediate stop positions for controlling gas flow between intake and exhaust conduits connected to the housing. |
US07731150B2 |
Malleable mold and method of use thereof
A mold device including a body having a hollow, three-dimensional shape with at least one opening therein; the body being made from a material having a malleable characteristic, and having an axis extending vertically there through, wherein the inner surface of the body is, optionally, topographically contoured, with an upper limit of about five hundred (500) thousands of inch, has a reusable means for releasably positioning a wick stand. |
US07731144B2 |
Beverage container holder and basket
A beverage cup holder to contain drinking fluids, collect condensation and spilled fluids, and direct them to a self contained reservoir. The holder has an upper rim that is taller than the container being held, ribs to support the entire height of the held container utilizing an upper funnel, and a device which stores spilled fluids and condensation within a self contained reservoir for spilled fluids formed by the holder from a centered vertical support column as well as creating an area to add attachments including weights, a magnet, or lighting to its open bottom end. |
US07731135B2 |
Apparatus support console with adjustable support plate
In an apparatus support console comprising a pedestal having a foot, a support column extending from the foot and pivot joint structures supported on the column and carrying an apparatus or an apparatus holder, a telescopic member is longitudinally movably supported in the column and/or between the pivot joint structures so as to be extendable or insertable and the telescopic structure is provided with locking means for locking the telescopic member to permit secure positioning of the apparatus and locking it in any position convenient to a user of an apparatus supported by the support console. |
US07731132B2 |
Medication fluid tube stabilization device
An interactive fluid tube stabilization device for an intravenous feeding tube is formed of an acrylic material that has a cylindrical shape. A lengthwise slit forms two overlapping sides for the device that can be manually spread apart to fit over and clamp onto the top bed rail of a hospital bed. A flap formed in the side of the device that is opposite to the slit has an arcuate end and a fold line spaced from the end through a distance that is greater than the diameter of the intravenous feeding tube. When the arcuate end is bent toward the top of the bed rail, it forms a gap that accommodates the feeding tube between the device and the flap, enabling most of the drag applied by the feeding tube to be borne by the device and to permit relatively free movement of the tube transverse to the bed rail to accommodate the movement of the patient. |
US07731131B2 |
Roof block
The roof block is highly versatile in its applications, and includes recess-forming structure that segregates and cradles a multiplicity of transversely extending conduits and other elongate members; channel-forming and passage-defining structure that facilitates the assembly and stable support of threaded rods for the attachment of accessories; structure for securing, and facilitating affixation of, hold-down means for supported members; and elements that facilitate the unified, compact assembly of a multiplicity of like blocks. The roof block is of lightweight and strong construction, is convenient to use, and is practical and economical to manufacture in bulk. |
US07731128B2 |
Mobile leading edge flap for a main wing of the aerofoils of an aircraft and main wing provided with such a flap
The invention relates to a leading edge mobile flap (16) for a main wing of an aircraft, this flap including an aerodynamic skin (18) that has a bird impact-sensitive frontal area (24), and a rear skin (28) integral with the aerodynamic skin (18), the flap also comprising a plurality of ribs (34) spaced out along a leading edge longitudinal direction (X′). According to the invention, the flap additionally includes, between two directly consecutive ribs, a single rigid bird trajectory-deflecting wall (42) anchored to the skins (18, 28). Furthermore, in a cross-section taken along any plane orthogonal to the direction (X′), the wall (42) forms with a geometric chord (26) of the flap an angle (α1) with a value of less than 45°. |
US07731114B2 |
Device for producing and processing food
A device for producing and processing food, in particular meat, includes at least one perforated plate (P) having holes through which the food can be pressed. The perforated plate, (P) is made of two parts, for example, a carrier and an insert, and a press element, for example, a blade which is guided along the insert, is associated with the insert. The insert deviates, in a minimal manner, with heat arising between the insert and the press element. |
US07731113B2 |
Crushing and grinding device, a soybean milk maker including said device and a method for making soybean milk
The present application discloses a recirculating crushing and grinding device for crushing and grinding liquid-like materials or materials that contain liquid, said device comprises a motor, a hopper, a crushing and grinding part and a material recirculating part. Said crushing and grinding part includes a coarse-crushing section and a fine-grinding section, said fine grinding section comprises a pair of grinding components, and said material recirculating part comprises a pump and recirculating ducts provided downstream of said crushing-grinding part. The present application also discloses a soybean milk maker employing said recirculating crushing-grinding device, and a method for crushing and grinding a recirculated material and a method for producing soybean milk. The equipment disclosed in the present invention is easy to manufacture, with the advantages of a low noise during operation and low energy consumption. |
US07731105B2 |
Vibratory pump with adapter and high pressure mechanism
The present invention is a vibratory pumping apparatus that increases the ease and effectiveness of use of the apparatus. More specifically, the apparatus includes an adapter engageable with a conventional motive member, such as an electric drill, in order to enable the apparatus convert the rotational motion of the motive member into oscillatory motion for the pump, such that the pump can be operated using any number of different motive members. In addition, the mechanism within the apparatus is formed of a pair of piston-like members that operate in conjunction with one another to increase the pressure at which the fluid pumped by the mechanism is dispensed from the apparatus. |
US07731104B2 |
Texture sprayer
A hand-held apparatus for spraying texture material including a body, a pressurized air source mounted on the body, a texture material hopper mounted on the body, and a texture delivery nozzle for selectively spraying texture material from the hopper onto a surface to be coated by propelling the texture material using pressurized air from the pressurized air source wherein each of the air source and the hopper can be disconnected from the body without the use of tools. |
US07731101B2 |
Straw apparatus for mixing and drinking beverages
An expandable drinking and mixing straw apparatus that can be compactly stored and expanded when necessary to provide a deployed dual-functionality mixing and drinking apparatus. The several embodiments of the straw apparatus provide a unified apparatus as well as functionally equivalent embodiments with two straw sub-component members defined by an outer straw and an inner straw which sub-component members are bonded together at specified locations. When force is applied to the undeployed straw apparatus, a plurality of veins expands from the apparatus to provide mixing functionality without compromising suction functionality. Straw sub component bonding, vein bending and stopping, and method of deployment of the drinking and mixing straw apparatus are disclosed. |
US07731098B2 |
Thermostat responsive to inputs from external devices
A thermostat is provided that receives one or more inputs from at least one heating system of a climate control system, and initiates an appropriate action in response to the input. The thermostat can turn off a heat pump providing substandard heat and responsively turn on a fuel-fired auxiliary furnace. The thermostat may discontinue further operation of the auxiliary furnace upon receiving an operating error signal associated with the auxiliary furnace, and responsively turn on the heat pump to provide for continued heating. The thermostat may also discontinue operation of the fuel-fired furnace and turn on a circulating fan in response to an input signal indicating a furnace high-temperature or a carbon monoxide presence. |
US07731087B2 |
Systems and methods for generating transaction receipts
Systems and methods for electronically processing financial transactions involving corporate checks. A front end device at a location associated with a merchant and a check processing service configured to detect and process corporate checks. In one embodiment, the detection of the corporate check is achieved at the front end device by reading of an auxiliary on-us field in the check's magnetic ink character recognition (MICR) line. Such information denoting the check as a corporate check is used by the check processing service to at least partially base its assessment of whether to approve and process the corporate check electronically. |
US07731086B2 |
System and method for mass transit merchant payment
Methods, systems and computer program products are provided for enabling payment of transit system fees using a financial transaction instrument. Entry is permitted onto a transit system by recognition of information included in an identification number stored on a financial transaction instrument. The identification number stored on the financial transaction instrument is associated with a transit system fee registered for each use of the transit system. A plurality of transit system fees associated with the same identification number from use of the financial transaction instrument is aggregated, and payment for the aggregated transit system fees is requested from a transaction account associated with the financial transaction instrument. |
US07731085B2 |
Product display
A display for two or more products having two or more three-dimensional visual aspects providing visual information about two or more products. The visual aspect has a first visual product, a second visual product, a first sampling aspect for the first visual product, a second sampling aspect for the second visual product, product samples associated with both the first and the second sampling aspects, and a dispenser for dispensing the product samples. |
US07731081B2 |
Paper box structure
A paper box structure is formed of a paper material, and comprises a bottom plate and two side plates connected to both sides of the bottom plate. Each side plate comprises a top plate connected to one side of the side plate opposite to the bottom plate; and the other two sides of the side plate is connected with a main body fold plates respectively. Each main body fold plate comprises a frame plate having a central opening, a buffer plate; and at least one adjustable fold plate formed along both sides of the central opening. The frame plate is folded to form a U-shaped buffer space together with the top plate, the side plate and the bottom plate. The buffer plate is connected to one side of the frame plate near the side plate, and folded to form a step-like structure. |
US07731075B2 |
Welding of single crystal alloys
A blade member is oscillated in the direction of arrow A-A relative to a rim of a disc; a forge force is applied radially and a weld is formed along line; the blade member is formed from a face centred cubic (FCC) nickel based single crystal alloy, such as CMSX-4 of Cannon-Muskegon Corporation; the orientation of the single crystal blade member is controlled to maximize the stress on the slip plane; by maximizing the stress on the slip plane the in-plane friction forces and the forge force are minimized; minimizing the in-plane forces enables the single crystal blade member to be successfully welded to the rim of the disc. |
US07731073B2 |
Surgical stapler with firing lock mechanism
A surgical stapler is provided that maintains the jaws of the stapler in an open position and prevents firing of staples when a cartridge is not loaded in one of the jaws. Distinct positioning and sequencing of the jaws, capture pin and firing of the staples are provided by a latch mechanism. Such locking and latching mechanisms ensure proper operation of the stapler. |
US07731069B2 |
Enhanced forearm furniture leverage straps
Load carrying apparatus, comprising first and second elongated straps having end portions; multiple loops at each end portion, and located in planes defined by the end portions and spaced along the length of the strap, to define multiple openings, located in said planes, each strap having a mid-portion located between the strap end portions, and mid-portions of the two straps located to extend under a load to be carried, whereby the user can select which of the loops is to be extended over his forearm, for lifting the load by lifting force exertion to lift said strap mid-portions, there being at least four openings at the end portion or portions of at least one strap. |
US07731064B2 |
Water guns
A water gun may comprise a body having a front surface, a nozzle mounted on and extending from the body, an actuator, at least one fluid reservoir, and a pump. The nozzle may have at least a nozzle portion adapted to move between an extended position spaced away from the front surface and a retracted position closer to the front surface than the extended position. The actuator may be adapted to be moved relative to the body, and mechanically coupled to the nozzle for moving the nozzle between the retracted and extended positions when the actuator is moved between first and second positions. The fluid reservoir may comprise first and second end portions and a generally uniform elongate intermediate portion extending between the first and second end portions, which may have volumes that are larger than the volume of the intermediate portion. The pump may be fluidly coupled to the at least one reservoir and the nozzle, with the pump being operable to discharge fluid received from the at least one reservoir through the a nozzle. |
US07731062B2 |
Apparatus and method for dispensing liquids
An apparatus and method for discharging liquids such as vapocoolants in stream or mist form includes the use of a filter to remove contaminants from the liquid prior to dispensing through the nozzle opening. A streamlined flow of liquid is delivered to the nozzle to prevent after spray and the filter spaced from the nozzle to inhibit pulsation of the dispensed liquid stream. The filter and nozzle are provided as an assembly mounted in a passageway in the container actuator. |
US07731057B2 |
Moist towelette packaging
The new invention allows for easy retrieval of fall backs and eases the initial threading process upon initial opening/use of the package. Threading is done without removing the cap. Several of the embodiments allow refills to be inserted into the canister without removing the lid/cap. The layout of the dispensing system and the geometry and shape of the dispensing orifice/aperture minimize and mitigate product fall backs. The new invention improves performance of the orifices/apertures through unique geometry and shape as well as using different materials from existing products or the combination of multiple materials. Varying orifice diameter, co-molded density and stiffness or geometry of the actual lobes defining the dispensing aperture allows the precise amount of friction to be created in the dispensing opening for selectively grabbing or releasing the towelette, thereby tearing the towelette connecting perforations at just the right time. |
US07731055B2 |
Lid opening mechanism
A lid opening mechanism (A) for opening a lid element (1) on a first side (Y1) around the first axis of rotation (21) of the lid or selectively on the other side (Y1) around of the second axis or rotation (22), wherein each first (21) and second (22) axes of rotation are formed by the front (21a or 21b) or rear (22a or 22b) element of the axis of rotation and a lid actuating device (B) comprises hinge strips (30a, 30b) each of which is rotating mounted in the area or the first lid-opening side (11) on the thrust sides (6a, 6b) of the lid element (D) transversally with respect to the longitudinal sides (11, 12) and bearing devices (63a, 63b; 62a, 62b) for receiving the elements (21a, 21 or 22a, 22b) of the axes of rotation. |
US07731048B2 |
Closure assembly with breakaway sealing portion with gripping tab
A plastic lid for a can of the type comprising a tubular body (10) having an upper end (13) for the seating of the lid (20) comprising a sealing portion (21), removably seated on the tubular body (10) and provided with an upper edge (21b), a seal portion (25), to be ruptured upon the first opening of the lid (20), having an upper ring (25b) which is incorporated to a lower skirt (25a), said upper ring (25b) and said lower skirt (25a) being respectively seated onto and around part of the upper end (13), said upper ring (25b) being incorporated through radial bridges (26), to said upper edge (21b), the seal portion (25) presenting an interruption (25c) extending through the width of the upper ring (25b) and through at least part of the height of the lower skirt (25a). The sealing portion (21) incorporates a gripping tab (27) which is manually operable only when part of the seal portion (25) is ruptured. |
US07731039B1 |
Retail display
The disclosure shows a retail display stand that can be used to display products sold in tapered packages. The display stand has at least one row of upper product apertures and a corresponding row of lower product apertures. The lower product apertures have a lateral dimension that is smaller than the corresponding lateral dimension of the upper product apertures. The stand also has distinct forward and back sets of product apertures. The back apertures have a lateral dimension that is smaller than the corresponding lateral dimension of the forward apertures. The difference in sizing causes tapered packages in the back row to sit in an elevated position with respect to the packages in the forward row of apertures, improving purchaser visibility of the back row of products and creating a better retail display. |
US07731038B2 |
Promotional display system
By providing a pre-printed promotional system which employs two cooperating panels securely affixed to each other, with each panel being movable between a folded, compacted position and an unfolded, extended position, a unique, hands-on, printed, visually exciting and interest generating advertising/promotional product is attained. In addition, in the preferred construction of the present invention, the promotional system of the present invention is constructed to produce a snapping or cracking sound whenever the promotional system is moved between its two alternate positions. Although the creation or production of a sound is not required, it has been found that the sound produced further enhances consumer surprise and interest. |
US07731037B2 |
Separating sand from fluids produced by a well
A settling system may be used to separate and/or remove solid particles, such as sand, from fluids produced by wells. The container of the settling system may be cleaned without need for manned-entry. |
US07731036B2 |
Reversible vacuum filter cartridge
A reversible vacuum filter cartridge for connection to a pair of tubes or other entities to filter a liquid medium placed in one of the tubes or other entities is described. The filter cartridge is comprised of a male coupling and a female coupling. The couplings are interconnected to one another by simply pushing a mating projection of the male coupling into a mating cavity of the female coupling. A connecting port is provided in the male and female coupling and has a conduit communicating with tube connecting ends of each of the couplings which communicate with an open end of a tube connected to each of the couplings. The connecting port is identical in each of the couplings and serves either as vacuum port or an air intake port. A filter disk is retained captive between perforated outer walls of each of the couplings when interconnected together in fluid-tight relationship. |
US07731033B2 |
Six-sided corrugated rollover cushion
A method for using a rollover shipping cushion is presented. The cushion is formed by folding, in a specific manner, a single sheet of die-cut corrugated fiberboard to create the cushion. When properly folded, the cushion includes a central shipping cavity that is surrounded by shock-absorbing tubes on all six sides of the central shipping cavity. An item is then placed within the central shipping cavity for shipment. |
US07731032B2 |
Suspension packaging assembly
A packaging assembly includes a frame member and a retention member which is not permanently affixed to the frame member. The frame member can include a variety of features which allow the retention member to be tightened around an article to be packaged and thus protected from shocks and impacts during transport, display, and/or retail use. The retention member can be formed as a sleeve or with pockets for engaging the frame member. |
US07731028B2 |
Shipping package system for fragile panels
A product vulnerable to damage during shipping, such as an automobile windshield glass, for example, is mounted on a support pad and fixed onto the pad by wrapping a stretch wrapping film around the combination of the pad and glass. The borders of the pad extend beyond the borders of the glass so the package containing the glass can be stood on edge, but the edge of the glass is spaced away from the surface on which the package is stood. Thus the glass, secured to the pad, is suspended away from that surface. Multiple packages can be packed into a shipping container and the loaded container can be lifted and transported by a lift truck with lifting forks received in passageways formed in the container by notches in the bottom edges of the support pads. The pads and containers are made of die-cut corrugated fiberboard material although other material might also be used in the practice of the invention. |
US07731027B2 |
Package and blank and apparatus for forming such package
A package for containers such as bottles or cans, in particular beverage containers, folded from a blank, provided with: a substantially closed bottom panel (2); two side panels (4), upstanding from the bottom panel, on opposite sides thereof; two upper flaps (6) folded from the side panels over containers arranged on the bottom panel; end wall flaps (10) extending on both sides of each side panel while confining the containers; and top flaps (12) extending from the upper edges of the end wall flaps facing away from the bottom panel, below or between the upper flaps (6); wherein at least said two flaps (12) and/or the upper flaps (6) are attached to each other. |
US07731023B1 |
Portable storage and display case for military decorations and jewelry
A portable storage and display case for valuable items such as military decorations and jewelry having a rigid front member, and a rigid rear member, a spine joining the front member with the rear member, and an interior surface having first and second interior pockets, capable of holding an insert capable of slidably connecting into the first and second interior pockets. A portfolio further comprising at least one sheet of a recoverable plastic portfolio sheet capable of receiving pins and folded into halves. A padded protector panel having at least one pocket therein, and disposed between the two halves of the recoverable plastic portfolio sheet so that the two halves do not come into contact with one another. |
US07731021B2 |
Conveyor link chain with universal coupling joint
A conveyor chain with a universal coupling joint connecting consecutive chain links. The joint includes a joint member unitarily molded with a first link body engaged by a separately formed joint element insertable into a second adjacent link body to link the two link bodies at the joint. The insertable joint element may be made of a different material from the link body. The joint member has a convex or concave spherical bearing surface that engages a complementary concave or convex bearing surface on the joint element for universal pivoting. |
US07731020B2 |
Conveyor with attachments
A conveyor assembly is provided, which includes a link belt formed of a plurality of overlapping belt links. A plurality of engagement elements are attached to the link belt to form an upper surface. In one embodiment, the link belt includes a plurality of apertures and the engagement elements comprises connectors that cooperate with the apertures to connect the engagement elements to the link belt. The upper surface of the engagement elements may be configured in a variety of forms. In one embodiment, the engagement elements comprise a protuberance that projects upwardly to form a point of limited contact. |
US07731019B2 |
Downwardly conveying conveyor installation
A downwardly conveying conveyor installation, such as belt-conveyor installation, for transporting the conveyable articles along a conveying path from a geodetically higher location to a geodetically lower location. There is provided a motor drive, and a hydrodynamic coupling comprising a drive-side pump wheel and an output-side turbine wheel, which together form a toroidal operating space which is filled with operating medium. The pump wheel and the turbine wheel each have a blade arrangement with a multiplicity of blades which are arranged opposite one another such that the blades of the pump wheel are flush with the blades of the turbine wheel. The blades of the pump wheel, as seen in a circumferentially directed section through the operating space, are positioned obliquely, in the direction from the rotor base to the blade tip, counter to the driving direction of rotation of the pump wheel, and the blades of the turbine wheel are positioned obliquely, in the direction from the rotor base to the blade tip, in the driving direction of rotation of the turbine wheel. |
US07731004B2 |
Brake lining with damper plate
The invention relates to a brake lining (1) comprising a lining support plate (2) which is provided with a friction lining (7) arranged on the surface thereof. A damper plate (3) is placed on the opposite to the friction lining (7) second face of the lining support plate (2). Said damper plate (3) comprises integrated anchoring elements (4) for preventing lateral sliding thereof, wherein said anchoring elements (4) pass through a recess embodied in the lining support plate (2) and are engaged with the friction lining (7). Damping layer (6) on which a brake piston can act during braking is disposed on the damper plate (3) opposite to the lining support plate (2). An adhesive layer (8) is applied between the damper plate (3) and the lining support plate (2) in such a way that the damper plate (3) is fixable to the lining support plate (2). |
US07730999B2 |
Elevator group supervisory control system using target route preparation
An elevator group control system includes a reference route generating portion, which for each elevator, generates a reference route which the elevator should follow with respect to the time axis and position axis; and an assignment portion which selects an elevator for assignment to a generated hall call so as to make the actual trajectory of each elevator closer to its reference route. Reference routes which guide the cage's trajectory into temporally equal interval condition are generated, and car assignment is executed to allow the cages to settle in temporally equal interval condition over a long period of time. |
US07730996B2 |
Long fiber thermoplastic composite muffler system with integrated crash management
The present invention provides composite muffler systems formed of a long fiber thermoplastic. Long fiber thermoplastic technology allows the fibers, to maintain a length sufficient to provide structural strength at lower fiber loading. The long fiber thermoplastic material for forming composite muffler systems also provides increased impact strength and creep resistance as well as chemical and thermal resistance. Mufflers molded with long fiber thermoplastics demonstrate improved dimensional stability as compared to known short fiber based moldings. One suitable muffler structure is a multi-piece muffler assembly including at least one long fiber thermoplastic shell section. In accordance with the present invention, the long fiber thermoplastic material and moldings may also be combined with over-molding of preforms of unidirectional or woven inlays, which provide local structural performance. The use of such preforms is particularly suited to use in the manufacture of high temperature, structural articles such as bumper muffler combinations. |
US07730989B2 |
System to disconnect a control pedal from the device to which it is connected
System to disconnect a device control pedal (1) from the device to which it is connected, said pedal (1) being connected to the device by a rod (2) whose end (3) is attached to a first spinning body (4) coupled to the pedal (1) and rotatable around an axis (5), the system comprising a second spinning body (6) provided with a pusher element (7), so that when the second spinning body (6) rotates due to a head-on collision of the vehicle, the rod (2) is displaced due to the action of the pusher element (7) so that it is separated from the first spinning body (4) coupled to the pedal (1). |
US07730986B2 |
Electric component arrangement structure for vehicle, vehicle having the same, and method for arranging electric component in vehicle
An electric component arrangement structure for a vehicle includes a plurality of electric components, a support member, and a body frame of the vehicle. The plurality of electric components includes a battery and an ECU. Couplers of the electric components are arranged in the support member. The body frame includes a main frame which supports an engine. The plurality of electric components are arranged in the body frame. The main frame supports the support member at a front region located forward with respect to the engine. The main frame supports the battery and the ECU at a rear region located rearward with respect to the engine. |
US07730982B2 |
Oil pump driving control device for a hybrid vehicle
In general, an oil pump driving control device for a hybrid vehicle is described. A hybrid vehicle includes a drive-train configured and arranged to transmit power in the order of an engine, a first clutch, a motor generator, a second clutch and a drive wheel, and an oil pump operably configured and arranged at a location between the first clutch and the second clutch such that the oil pump is mechanically driven by at least one of the engine and the motor generator. The invention provides an oil pump driving control device that supplies the necessary oil pressure for an automatic transmission with only a single mechanical oil pump. For example, even when it is not possible to maintain tightening of the second clutch, oil pressure may be supplied by rotating the oil pump using the motor generator. In this way, the oil pressure may be supplied with a single oil pump. |
US07730980B2 |
Steering device for floor cleaning machine
A floor cleaning machine having a speed control and steering member which operates under operator-applied deformation thereof. The invention provides improved consumer convenience at steering and/or speed control. |
US07730977B2 |
Cutting tool insert and drill bit so equipped
A polycrystalline diamond abrasive cutting element consists generally of a layer of high grade polycrystalline diamond bonded to a cemented carbide substrate. The polycrystalline diamond layer has a working surface and an outer peripheral surface and is characterized by having an annular region or a portion thereof adjacent the peripheral surface that is lean in catalyzing material. A region adjacent the working surface is also lean in catalyzing material such that in use, as a wear scar develops, both the leading edge and the trailing edge thereof are located in a region lean in catalyzing material. |
US07730973B2 |
Housing arrangement for a drill rig
Housing arrangement 8 for a drill rig, especially adapted for damping sound, said drill rig comprising a feed beam holder 3, a feed beam 4 being movably attached to the feed beam holder 3 and having a drill end 41 and a rear end 42, and a drilling machine 5 being movably attached to and movable along the feed beam 4, said housing arrangement 8 comprising a casing 7, and said feed beam 4. The invention is characterized in that the casing 7 is directly attachable to the feed beam 4, such that the casing 7 and at least a part of the feed beam 4 enclose the drilling machine 5, and allows for mutual movement between the feed beam 4 and the feed beam holder 3. |
US07730962B1 |
Adjustable scraper assembly for planter gauge wheels
An adjustable scraper assembly for clearing mud and trash from the gauge wheel tires of an agricultural planter includes a support rod connected to the planter, a clamp assembly attached to the support rod, and a scraper blade attached to the clamp assembly. The clamp assembly has first and second clamping blocks that function together to allow pivotal adjustment of the scraper blade relative to the support rod about three nonparallel axes of rotation and sliding adjustment along at least one linear direction relative to the support rod. The support rod is attached to the planter using a third clamping block clamped to the hub of a gauge wheel arm. The third clamping block can be used to provide an additional adjustment of the support rod relative to the gauge wheel arm. |
US07730960B1 |
Turf aeration device
An improved turf aeration device is provided, where the device has a frame having a journalled drive shaft, and the frame is attachable to a pulling vehicle having a power take-off portion; where the device has a power transfer means, attachable between the drive shaft and the power take-off portion, for transferring power from the power take-off portion to the drive shaft; and a plurality of aerator mechanisms operatively attached to the drive shaft and the frame, each aerator mechanism having a lower link member, with a base end and a distal end, where the base end is pivotally attached to the frame; a tine holder pivotally attached to the distal end of the lower link member, where the improvement includes a roller frame rigidly attached to the frame, the roller frame having two spaced apart, and a slideable member adapted to allow limited rotation of the aeration device toward or away from the pulling device. |
US07730958B2 |
Method and apparatus to enhance hydrocarbon production from wells
This invention teaches methods and compositions to enhance oil and gas recovery from reservoirs. The methods and compositions disclosed enhance hydrocarbon recovery and fluid disposal in subterranean reservoirs by injecting microemulsion fluids with supercritical fluids, water, or an alternating injection phase of each fluid. |
US07730955B2 |
Grooved expandable recess shoe and pipe for deployment of mechanical positioning devices
A first, expandable casing member, in an unexpanded state, is provided with a lower axial end that has a radially expanded upset or recess shoe and a locating profile. The first casing member is run into a wellbore, expanded, and secured in place within the wellbore. A second expandable casing member is then provided in an unexpanded state and disposed into the wellbore through the first casing member using a running tool. The second casing member is located with respect to the first casing member and expanded using an expansion member carried by the running tool. |
US07730950B2 |
Methods for treating intervals of a subterranean formation having variable permeability
Methods of using water-soluble hydrophobically modified polymers to treat intervals of a subterranean formation having variable permeabilities. An exemplary embodiment provides a method of treating an interval of a subterranean formation having a permeability that varies. The method comprises contacting the interval with a water-soluble hydrophobically modified polymer capable of selectively reducing the effective permeability of the interval to water without a comparable reduction of the effective permeability of the interval to hydrocarbons. The hydrophobically modified polymer modifies the interval to have a more uniform permeability without substantially preventing the flow of fluids through the interval. The method further comprises introducing a treatment fluid into the interval. The more uniform permeability of the interval allows for a more uniform treatment of the interval by the treatment fluid than would be allowed without treatment of the interval with the hydrophobically modified polymer. |
US07730940B2 |
Split body swelling packer
A swelling packer system uses modules that can be joined together and mounted over a tubular using a vertical split that can be drawn closed with a tapered pin in overlapping loops. The pins are circumferentially spaced apart as between adjacent modules. End rings can protect the modules for run in and act as extrusion barriers during and after the swelling is complete. The module ends can be overlapped in an interlocking fashion which allows multiple elements to be joined together to make a packer assembly as long as desired with any combination of swelling elements in a single packer assembly. Optionally, interior grooves in the swelling material can hold split ring seals or o-ring type seals that are slipped over a tubular end before a module is clamped on. The sealing elements can be triggered with water or hydrocarbons or with other materials already in the wellbore or introduced to it or other surface or locally actuated triggers. |
US07730932B1 |
Screen assembly
The present invention broadly includes a screen assembly including a U-shaped channel, a plurality of channels, and a plurality of retainer clips. Each channel in the plurality of channels includes respective first and second walls forming an L-shape and a respective third wall hingedly connected to the respective first wall. The respective first, second, and third walls form a U-shape when the respective third wall is in a closed position. The plurality of channels are arranged to receive a screen frame when the respective third wall is in an open position and the plurality of channel elements is arranged to restrain the screen frame when the respective third wall is in the closed position. The plurality of retainer clips is arranged to releasably engage the plurality of channels to maintain the respective third wall in the closed position. |
US07730930B2 |
Device for fixing a pulley
A device (10) for fixing a pulley (40) includes a rotating pin (12) on the outer surface of which the pulley (40) may be fixed. The rotating pin (12) has at least one locking element (50) movable between a first locking position where it retains the pulley (40) and a second releasing position where it does not retain it. The locking element (50) is coupled with at least one element (60) which can be operated by the user so that the displacement of said at least one element (60) which can be operated by the user causes the displacement of the at least one locking element (50) between the first and second position. |
US07730921B2 |
Belt welding apparatus and method
Apparatus and method are disclosed for the welding of thermoplastic endless belts (28). Direct current is passed through a ni-chrome wire (27) to produce enough heat such that the thermoplastic melting point of the belt material is reached. The wire is mechanically moved through the abutting thermoplastic belt. The free ends being welded are securely held together with clamping members (2) and (4). In another embodiment a ni-chrome ribbon (54) is embedded in an electrically insulated screen to produce a heated planar surface. The invention is particularly suitable for the welding of polyurethane thermoplastic belts. Because the invention is hand held and it uses battery power, it is especially adapted for welding belts in the food processing industry. |
US07730917B2 |
Apparatus for card receival and wallet with the same
An apparatus for card receival comprises a foldaway portion; a leather element; and two fence elements; wherein the foldaway portion has its two ends to connect with the two ends of the leather element; the two fence elements connecting with the foldaway portion by one side thereof; the leather element comprising a plurality of card receival units, each of which constituting by a plurality of bar openings for cards inserting. As an embodiment, the card receival units are arranged at intervals. The apparatus for card receival may further comprise a coin-receiving bag formed on an outer side of the foldaway portion. The invention also discloses a wallet with such an apparatus for card receival. |
US07730911B2 |
Means and method for filling bag-on-valve aerosol barrier packs
A bag-on-valve aerosol valve system in a container. Propellant is pressure filled around the valve stem, outwardly over the stem gasket and down into the container space outside the bag. Product is filled through the valve stem into the bag. The valve stem has an exterior intermediate frusto-conical annular surface and the valve housing has an interior frusto-conical annular surface, with both surfaces engaging in annular sealing contact to block propellant access to the bag when the valve stem is deeply depressed to a first predetermined position for propellant pressure filling. A stem exterior surface indent interacts with radially-biased spring-loaded slides to lock the stem in a second less depressed predetermined position for product filling through the stem down into the bag. The propellant and product may be pressure filled in either order using essentially conventional pressure filing equipment, after the valve is mounted on the container and the bag is mounted on the valve. |
US07730909B1 |
Accessory for a vapor generator
An accessory for a vapor generator, such as a smoke or fog machine, includes an elongated member that connects to an output nozzle of the vapor generator. The elongated member has one or more perforations formed in its sidewall along its length. A vapor generated by the vapor generator travels through an interior of the elongated member and escapes through the perforations to the ambient atmosphere. The effect creates a curtain of smoke or fog. |
US07730908B2 |
Self supporting reinforced header
A self supporting header has a horizontally extending header pipe of fiberglass reinforced plastic with a horizontal axis and a flange of fiberglass reinforced plastic connected to an outer surface of the header pipe by at least one web and extending along at least part of the horizontal extent of the header pipe. The at least one web extends vertically from at least one of the top and bottom of the header pipe and is connected to the flange. A reinforcing member or material is embedded in at least one of the flange and the at least one web and that has a greater modulus of elasticity than a modulus of elasticity of the fiberglass reinforced plastic of the header pipe reinforces a cross-section of the header for increasing the self supporting strength of the header. The reinforcing member may be made of metal or a carbon composite material. |
US07730903B2 |
Non-metallic auxiliary tank system for a vehicle
An on-board auxiliary split tank system for supplying makeup water and chemical additives to a transit concrete mixing vehicle is disclosed which includes a generally cylindrical water tank designed for generally horizontal deployment having a shaped recess therein and an additive tank configured to nest in said recess of said water tank and which, when nested in said recess, generally completes said cylindrical shape. The water tank and additive tank are formed from a non-metallic material comprising a polymeric component. |
US07730880B1 |
Ignition apparatus for internal combustion engine
There is obtained an ignition apparatus, for an internal combustion engine, that can make a predetermined output current flow in a stable manner so that the combustion state of the internal combustion engine can always be maintained in a good condition, even in the case where the voltage of the power source connected with the energy storing coil fluctuates. There are provided an energy storing coil (3), a switching means (S1) for accumulating energy, an ignition coil (4), and a switching means (S2) that turns on/off an ignition current; the switching means (S1) and (S2) are alternately turned on/off so that a current with a alternating polarity is made to flow continuously in the ignition coil (6); a switching means (S3) is connected both terminals of the energy storing coil (3); and when a current flowing in the energy storing coil (3) reaches a target value, the switching means (S1) is turned off and the switching means (S3) is turned off so that the energy storing coil current circulates through the switching means (S3) so as to keep the current to be approximately the target value. |
US07730870B2 |
Engine dynamic load leveling
A method for controlling an internal combustion engine having a plurality of cylinders using electronic valve actuation, including operating a first portion of the cylinders in a homogeneous charge compression ignition (HCCI) mode, operating a second portion of the cylinders in a non-HCCI mode, and adjusting the valve timing of the second portion of cylinders to dynamically load level the engine in response to a transient torque demand. A system for controlling a multiple cylinder internal combustion engine, including a first group of cylinders to operate in an HCCI mode, a second group of cylinders to operate in a non-HCCI mode, and an engine controller operably coupled to the first and second groups of cylinders, said controller to adjust the valve timing of the second group of cylinders to dynamically load level the engine in response to a transient torque demand. |
US07730869B2 |
Housing wheel engine
Disclosed herein is a housing wheel engine that has a wheel shaped combustion housing, the housing wheel engine can hold several pistons which both sides working inside the combustion housing. The housing wheel engine transfers its rotating movement directly to the driveshaft by the planetary gearsets. A four-stroke time mechanism provided by the planetary gearsets. |
US07730865B2 |
Engine air intake arrangement for a vehicle
A vehicle, such as a motorcycle, having an arrangement that inhibits the reduction of the fuel tank volume disposed to the rear of a moveable funnel that forms a portion of a variable length air intake. The vehicle includes an engine having an intake port. A fixed funnel introduces air to the intake port of the engine and a moveable funnel is position on the inlet side of the fixed funnel to selectively cooperate with the fixed funnel to deliver air to the intake port of the engine along with the fixed funnel. A parallel linkage moveably supports the moveable funnel. A fuel tank is disposed to the rear side of the moveable funnel and a motor that drives the parallel linkage is disposed on the opposite side to the fuel tank from the moveable funnel. |
US07730864B2 |
Method of operating glow plugs in diesel engines
The invention describes a method for operating glow plugs, that comprise a housing and a heater element projecting beyond that housing, in a diesel engine which interacts with an engine control unit and a glow plug control unit which latter, following a preheating phase, controls the electric power supplied to the glow plugs in response to an input received from the engine control unit. It is provided according to the invention that the engine control unit determines a value representative of a temperature that is to be reached at the heater element and the engine control unit transmits that value as target value to the glow plug control unit which implements that target value using an algorithm stored in the glow plug control unit and with reference to characteristic values stored in the glow plug control unit. |
US07730862B2 |
Valve mechanism for internal combustion engine
A valve mechanism for an internal combustion engine includes a first rocker arm (4) connected to an intake or exhaust valve and supported on a rocker shaft (3a), a second rocker arm (5) supported on the rocker shaft for being rotationally driven by a cam, a cylinder (10) formed on one of the first and second rocker arms (4, 5) and a first piston (11) provided in the cylinder, a contacting projection (4a) projecting on the other one of the first and second rocker arms, a return spring (12) for biasing the first piston in a direction in which the first piston contacts with the contacting projection, and a second piston (14) for displacing the first piston to a position at which the first piston does not contact with the contacting projection. The two pistons extend in parallel to each other when the first piston is at a non-contacting position. |
US07730861B2 |
Two-step rocker arm assembly
A two-step rocker arm assembly is provided having an arm member and a first roller assembly rotatably mounted with respect to the arm member and defining a generally C-shaped opening. A shaft member rotatably supports a second and a third roller assembly. The shaft member extends through the generally C-shaped opening and is selectively translatable therein to guide the second and third roller assemblies with respect to the arm member. A coupling lever is mounted with respect to the shaft member and is operable to selectively retain the shaft member with respect to the arm member for unitary movement therewith. |
US07730859B2 |
Variable valve train system for internal combustion engine
A variable valve train system for an internal combustion engine wherein the engagement section of a transmission mechanism is lubricated by means of an existing part for driving a variable valve actuation mechanism. Gears forming the engagement section of the transmission mechanism are arranged at a position where the engagement section is lubricated with a lubricant scattered from an endless elongate member for driving a camshaft. The transmission mechanism can therefore be lubricated without the need for additional use of a lubricant passage and its associated elements, besides the existing parts for driving the variable valve actuation mechanism. |
US07730856B2 |
Engine with variable volumetric ratio
Four-stroke internal combustion engine comprising a housing component having a first series of cylinders, each with an axis and a diameter, and a second series of cylinders, each with an axis and a diameter, in which each cylinder of the first series communicates with at least one cylinder of the second series via a channel which is provided by the housing component. |
US07730848B2 |
Indicator apparatus
The invention relates to an indicator apparatus (1) having a ring pointer (2), which is mounted such that it can move in the circumferential direction (5), and having a drive unit (3), which drives the ring pointer (2) in the circumferential direction (5), wherein the ring pointer (2) interacts with a stop (10) in a manner limited in terms of its circumferential movement. Particularly in the case of synchronization, radial disengagement often occurs in conventional ring pointer arrangements, and the aim of the invention is to prevent this. In order to solve the problem, the invention proposes arranging the stop (10) directly next to the drive unit (3). The critical advantage of this is that the tangential force on the ring pointer (2) from the drive unit generates an only small disengagement moment on the ring pointer (2). |
US07730840B2 |
Girder of a guideway for a track-bound vehicle
A track carrier for a railborne vehicle, especially a magnetic suspended railway comprises a concreted plate (2) projecting laterally from the carrier (1). Stators (15, 16) are arranged at the two lateral ends of the plate (2) on the bottom of the plate (2), lateral guide rails (12) are arranged on the lateral surfaces of the plate (2), and glide strips (8) are arranged on the top side of the plate (2) for driving and guiding the vehicle. Hardenable, especially concreted, positionally correct contact surfaces (5, 6, 7) for the lateral guide rails (12) and/or for the stators (15, 16) and/or for the glide strips (8) are formed on the carrier (1), and the lateral guide rails (12) and/or the stators (15, 16) and/or the glide strips (8) are detachably arranged on, especially screwed to the contact surfaces (5, 6, 7) provided for them. |
US07730839B1 |
Interfacial stress reduction and load capacity enhancement system
An article and a process are provided for reducing the shear stress on an interface of a structural member in intimate contact with a compressive load. The article is in the form of a wedge that is forcibly placed against the sidewall of one end or both ends of the structural member. The wedge may take the form of a ring that can be placed on the inside or outside surface of a hollow cylindrical structural member. The process of forcibly placing a wedge against the sidewall at one or both ends of the structural member produces a transverse compressive stress upon the sidewall. The transverse compressive stress upon the sidewall attenuates the tendency of said sidewall to deflect when the structural member is subjected to a compressive load. A reduction in the deflection of the sidewall reduces the shear stress generated proximal to the interface of the structural member in intimate contact with a compressive load and increases the structural member load bearing capacity. |
US07730835B2 |
Holding apparatus for holding a flexible plate on a circumferential surface of a holder of a printing machine
A holding apparatus holds a flexible plate wound on a circumferential surface of a holder of a printing machine. A holding apparatus includes a hole section made in the holder along an axial direction of the holder, a groove section made by notching the circumferential surface of the holder along the axial direction to establish a connection with the hole section and accept insertion of a leading edge end portion and trailing edge end portion of the plate, a tension bar inserted and fitted into the hole section for engaging the trailing edge end portion of the plate, and a rotating mechanism provided in the hole section for rotating the tension bar. |
US07730832B2 |
Method and apparatus for forming a bale having substantially flat upper and lower surfaces
An apparatus and method are described for forming a bale having substantially flat upper and lower surfaces. Also described is a bale having substantially flat upper and lower surfaces, which can be safely stacked vertically for transportation and storage purposes. The apparatus comprises upper and lower platens having a protruding surface for compressing the upper and lower surfaces, respectively, of a compressible material. |
US07730831B2 |
Pin-less socket for frozen confections
A pin-less socket apparatus and manufacturing system for assembling a frozen confection using such socket apparatus including a socket for accepting a conical food product therein, the socket having a hook with one or more teeth located at an outer periphery of the socket, a hinge located on an outside of the socket, the hook movably attached to the socket via the hinge, a force mechanism for holding the hook in place against the socket. The force mechanism takes the form of either an annular spring or O-ring located around the socket and hook or a linear spring attached to the hook in a lever-type manner. The manufacturing system includes a coating area for coating a wafer cone with a moisture-resistant layer, a filling area having a filler for inserting a semi-frozen confection into the wafer cone, a cooling area for accepting the wafer cone with the semi-frozen confection and including a hardening tunnel for freezing the wafer cone and the semi-frozen confection, and a dipping area including more than one pin-less socket apparatus for accepting the wafer cone and moving the wafer cone through a dipping bin. Within the system, the coating, filling, cooling, and dipping areas may be on the same or separate assembly loops including the socket apparatus within one or more of such assembly loops. |
US07730822B2 |
Protection against landmine explosion
A body and any occupant of a land vehicle (10) is protected against effects of a landmine explosion, by conducting shock waves laterally outwardly by means of one or more shock wave guide members (16, 18) of a material having high acoustic velocity, and located proximate a ground engaging element (12) of the vehicle. The material may be glass, ceramic or the like having an acoustic velocity of about 6000 m/sec or more, i.e. higher than other materials of other components of the land vehicle. Shock waves encounter less resistance in high-acoustic velocity materials and are thus conducted laterally outwardly, i.e. away from the body. The shock wave guide members may be located immediately above bottom runs of tracks (12) and annularly within wells of bogey wheels (14) of track vehicles; and annularly around hubs or within tyres of wheels of wheeled vehicles. |
US07730817B2 |
Apparatus for cutting ductile materials and a method of operating the apparatus
A cutting apparatus for ductile materials comprises a nozzle having a number of outlet openings separated from each other by separator webs. Next to the nozzle, a rotating cutting tool is provided, having a plurality of cutting knives for cutting off the strands of material discharged through the outlet openings of the nozzle. Each separator web is at least as wide as a cutting knife. For performing a cutting operation, the cutting tool is intermittently rotated. Between two cutting operations, the cutting tool is stopped, whereby its knives remain in a rest position behind the separator webs. For the next cutting operation, the cutting tool is rotated by such an amount that its cutting knives move from a position behind a first separator web to the next adjacent separator web. |
US07730796B2 |
Method for sampling flue gas for analysis containing gas component having high susceptibility to adsorption
An object of the invention is to realize high-accuracy analysis of a flue gas in terms of a trace amount of ammonia so as to control the level of ammonia gas to be added to a flue gas NOx removal apparatus. Since the ammonia gas to be determined is a highly absorbable, the gas component is considerably adsorbed on a surface of the flue gas sampling tube during sampling of flue gas. When a conventional sampling method including heating a gas sampling tube is employed, the amount of sampled gas is reduced through adsorption during gas sampling, failing to obtain concentration values at high accuracy. Thus, a high-accuracy gas sampling method replacing a conventional, heating-based method includes completely washing out, with an absorption liquid therefor serving as a washing liquid, a target ammonia gas deposited on the inner wall of a flue gas sampling tube (2), whereby the gas component is thoroughly collected. Through analysis of the thus-obtained washing liquid, high-accuracy analysis can be attained. |
US07730789B2 |
Device and method for measuring a gap between members of a structure for manufacture of a shim
An apparatus for measuring a gap between a first mating surface of a first component and a second mating surface of a second component has a substrate. A plurality of capacitive sensors is coupled to the substrate. A controller is coupled to the plurality of capacitive sensors. The controller is used to select each individual capacitive sensor to measure the gap between the first mating surface of the first component and the second mating surface of the second component. |
US07730786B2 |
Seismic sensor providing a body and an insertion tip having at least two wings between which cavities extend, and corresponding insertion tip
A seismic sensor, having a body which incorporates means for detecting and/or measuring waves, and, in the extension of said body, a tip for insertion into the ground, said tip extending between an upper end and a lower end, wherein said tip has at least two wings which together give said tip a V-shaped profile, said wings having between them at least one cavity which extends from said upper end to close to said lower end. |
US07730781B2 |
Gas pendulum inertial sensor
The present invention relates to a gas pendulum inertial sensor, which is used in control technology field to detect pose measurement of motional body, such as ship craft and robot, wherein the inertial sensor main includes a gas pendulum angular velocity sensing element, a gas pendulum tilt sensing element and a signal process circuit, wherein the signal process circuit mainly comprises a bridge circuit, a amplify circuit, a filter circuit, and a SCM compensation circuit with a null position and sensitivity compensation program, a linearity and output compensation program, an acceleration interference offset subprogram, and an omnibearing tilt signal compensation program, whereby the SCM compensation circuit integral into a circuit board to replace a conventional hardware signal amplify circuit, a filter circuit and a compensation circuit. The gas pendulum inertial sensor is adapted to accurately measure not only an object's indication without interference from the acceleration, but also an object's indication with interference from the acceleration. The gas pendulum inertial sensor has some significant advantages like highly attack-resist ability, intensively vibrate-resist ability, quick response time, wide ranges of working temperature, well linearity, credibility, sensitivity and precision ability, compact capacity and lower cost. |
US07730780B2 |
Level switch and method for detecting the fill level of a medium in a container
A level switch detects the fill level of a medium in a container and transmits a switch signal corresponding to the detected level. The level switch incorporates a signal generator for generating an electromagnetic signal, a measuring circuit, and a reference circuit into which the electromagnetic signal can be fed. The measuring circuit is so configured and positioned that the signal fed into the measuring circuit changes as a function of whether or not the measuring circuit is surrounded by the medium, while the reference circuit is so configured and positioned that the signal fed into the reference circuit remains unaffected by the fill level of the medium. A tap at a specific point on the measuring circuit collects the measuring voltage, a tap at a specific point on the reference circuit collects a reference voltage, and a voltage comparator compares the measuring voltage with the reference voltage and emits a comparison-derived switch signal. This permits the dependable detection of a specific level of the medium in the container while essentially eliminating errors due to changes in extraneous parameters such as temperature fluctuations. A method for detecting the fill level of a medium in a container employing the switch is also disclosed. |
US07730777B2 |
Flowmeter and flow control device
A simply structured flowmeter in which an influence of a dilatational wave on a thermal flow rate sensor is suppressed, and measurement accuracy is enhanced.The flowmeter has not only the thermal flow rate sensor that is placed to face a flow channel and detects a flow rate of fluid flowing through the flow channel but also a micro path (for example, narrow pipe) that is provided to the flow channel and blocks a dilatational wave created in the flow channel from being transmitted to the thermal flow rate sensor. |
US07730762B2 |
Device and method for testing isolation structure
Provided is a device for testing an isolation structure comprising an isolation layer having an upper beam, a lower beam and a top beam plate, along with an upper portion, the device comprising a plurality of upper corbels, a plurality of lower corbels, a plurality of hoisting jacks, a plurality of acceleration sensors, a plurality of displacement sensors, an acceleration collecting analyzer and a displacement collecting analyzer. A method for testing an isolation structure is also provided. |
US07730758B1 |
Vehicular frame straightening apparatus
An apparatus straightens vehicular structure, and comprises a U-shaped main frame, a pair of lift tower assemblies, and a pull tower assembly. The length of the main frame comprises spaced attachment structure for attaching the pull tower assembly. The lift tower assemblies are fastened to the main frame intermediate its length and function to fix the position of the vehicle relative to the main frame. The pull tower assembly is attachable to the main frame at a select attachment site and a tension member is attached to adjacent select vehicular structure. Thereafter tension may be applied to the select vehicular structure based from the attachment site to the main frame. Multiple tower assemblies may work in tandem with one another peripherally to the vehicle; a rear frame member may close the open end of the main frame; and vehicle support cross members may be included to support the framed vehicle. |
US07730753B2 |
Lubricant for elevated temperature forming
The hot stretch forming of sheet metal alloys, such as highly deformable aluminum alloy materials, is improved by using a lubricant comprising bismuth between the forming tool and the engaged surface of the sheet metal. A precursor of bismuth, such as bismuth subsalicylate, may be dispersed in a liquid and applied to the sheet metal before the sheet is heated to its forming temperature. Other lubricants such as boron nitride may be combined with the bismuth precursor. The precursor compound is decomposed to bismuth (or bismuth and carbon in the case of bismuth subsalicylate) which lubricates contact between the surface(s) of the sheet and the forming tool during forming and removal of the formed part from the tool. |
US07730748B2 |
Method of making a post-patent collimator assembly
A method of manufacturing a collimator assembly is provided. The method includes placing a first core element within a first center collimator path of a first collimator tube to create a first base-tube couple. A couple cross-section of the first base-tube couple is reduced such that the first base-tube couple becomes a first single-fiber fiber. The first single-fiber fiber is assembled into a collimator group. The first core element is dissolved such that a first hollow fiber is generated. |
US07730746B1 |
Apparatus to prepare discrete hollow microsphere droplets
Apparatus to eject on demand discrete hollow microsphere droplets that are characterized by a highly regular and predictable spherical shape, devoid of tails or other irregularities common in the prior art with a selected pure gas contained in the center. With this method and apparatus, droplets may be formed of any suitable material including glass, ceramic, plastic, or metal. A variety of gases at various pressures including complete vacuums may be contained in the hollow microsphere. Microspheres filled with ionizable gas may be used as pixels in a plasma display panel. Microspheres used as a pixel elements may be referred to as Plasma-spheres. The inside of each Plasma-sphere may contain a luminescent material such as a phosphor and/or a secondary electron emission material such as magnesium oxide or a rare earth oxide introduced during the gas filling of the microsphere. |
US07730737B2 |
Cooling station lifter pins
In a cooling station having lifter pins positioned within respective sockets, the lifter pins being positioned for translational movement within platform openings, the improvement comprising forming the lifter pins of aluminum or polymer. A cooling station comprising a cooling station body, a series of sockets affixed to the cooling station body a respective series of lifter pins comprised of aluminum or polymer affixed to the series of sockets, and an platform positioned on the cooling station body. The platform having respective openings positioned above the series of sockets and lifter pins for translational movement of the lifter pins into the platform openings. |
US07730732B2 |
Refrigerating storage cabinet
A storing section stores data of a pull down cooling characteristic indicative of a time-varying mode of reduction in a target temperature drop. For example, when this is a linear function line, a target internal temperature drop degree takes a constant value, irrespective of an operating time. An actual temperature drop degree is computed on the basis of the detected internal temperature. The computed value is compared with a target value read from the storing section. When the computed value is less than the target value, a rotational speed of an inverter compressor is increased via an inverter circuit. When the computed value is larger than the target value, the rotational speed of the compressor is decreased. The speed increases and decreases are repeated so that pull down cooling is performed along the linear line. |
US07730729B2 |
Refrigerating machine
A compressor, a radiator, an expander, and an evaporator are connected in series to define a refrigerating cycle. A bypass circuit that bypasses the expander, an on-off valve disposed in the bypass circuit, and a controller C1 for controlling an opening of the on-off valve are provided in the refrigerating cycle. During defrosting, the controller C1 controls the on-off valve so that a refrigerant may flow through the bypass circuit, thereby avoiding reduction in the amount of flow of the refrigerant during defrosting and preventing the defrosting operation from being prolonged. |
US07730726B2 |
Method and apparatus for controlling the combustion in a gas turbine
A method and apparatus are described for controlling the combustion in a gas turbine. The method includes measuring, with one or two calorimeters, the temperature, calorific value and relative density of a gaseous fuel in order to determine the Wobbe index, comparing the Wobbe index value measured with a predefined Wobbe index value for the gaseous fuel and regulating the temperature of the gaseous fuel with at least one heat exchanger in order to reach the predefined Wobbe index value. The method may also include using a second gaseous fuel, having a different Wobbe index from the gaseous fuel, or a fuel obtained by mixing the gaseous fuel and the second gaseous fuel, according to arbitrary proportions and variable with time. |
US07730723B2 |
Exhaust heat recovery apparatus
An exhaust heat recovery apparatus includes: an exhaust heat recovery unit that produces motive power by recovering thermal energy from exhaust gas discharged from a heat engine; an electric generator that is driven by the exhaust heat recovery unit; a first power transmission-switching device that switches between connection and disconnection between the heat engine and the exhaust heat recovery unit; and a second power transmission-switching device that switches between connection and disconnection between the exhaust heat recovery unit and the electric generator, wherein the heat engine or the electric generator is selectively connected to the exhaust heat recovery unit, depending on the operational status of the heat engine. The exhaust heat recovery apparatus makes it possible to effectively use surplus motive power produced by an exhaust heat recovery unit. |
US07730718B2 |
Control system for internal combustion engine
A control system for an internal combustion engine includes an exhaust gas purifying device, an exhaust gas temperature sensor, and temperature estimating device. The exhaust gas purifying device is provided to an exhaust duct of the internal combustion engine. The exhaust gas temperature sensor is provided in the exhaust duct on an upstream side of the exhaust gas purifying device. The temperature estimating device estimates a first exhaust gas temperature on a downstream side of the exhaust gas purifying device through a transfer function, which is expressed by a plurality of identical first-order lag elements, based on a second exhaust gas temperature on the upstream side of the exhaust gas purifying device sensed by the exhaust gas temperature sensor. |
US07730715B2 |
Fan frame
A fan frame (10) for a gas turbine is provided. The fan frame (10) has fan exit guide vanes (100) that are connected to an intermediate case (50) for structural support, and are constrained from movement in a radial direction by a first joint (110, 110a) and constrained from movement in an axial and radial direction by a second joint (120a, 110a). The intermediate case (50) provides structural integrity while reducing weight by providing struts (56, 95) with a width that increases in a direction away from a central bearing (55) as the thickness of the struts (56, 95) decreases. |
US07730711B2 |
Methods and apparatus for a combustion turbine nitrogen purge system
A method of operating a fuel system is provided. The method includes removing fuel from at least a portion of the fuel system using a gravity drain process. The method also includes channeling nitrogen into at least a portion of the fuel system to facilitate removing air and residual fuel from at least a portion of the fuel system, thereby mitigating a formation of carbonaceous precipitate particulates. The method further includes removing air and nitrogen from at least a portion of the fuel system during a fuel refilling process using a venting process, such that at least a portion of the fuel system is substantially refilled with fuel and substantially evacuated of air and nitrogen. The method also includes removing air from at least a portion of the refilled fuel system using a venting process. |
US07730709B2 |
Compact epicyclical drive
An epicyclical drive having a generally flat, disk shaped flywheel, a flywheel to pinion carrier in the form of an inner hub of the flywheel, and a flywheel support bearing and structure incorporated into the flywheel itself, all of which are concentric about a rotational axis of the flywheel so as to be axially compact, and so as to be particularly well adapted for being located beneath, or incorporated into, the floor of a grain header of an agricultural harvesting machine, for reciprocatingly driving knife knives of a sickle thereof. In particular, the flywheel support bearing is located in an annular space between the inner hub and an outer flange which is rotated by a belt or other drive for rotating the flywheel. |
US07730706B2 |
Lawn mower with pivotable grass collector
A lawn mower, comprising a vehicle body that is supported by a plurality of wheels; a support frame that is connected to a rear part of the vehicle body; a grass collector that is supported on the support frame so as to be pivoted between a grass collecting position and a discharge position about an axis oriented in the transverse direction of the vehicle body, the grass collector having a bottom surface; a swiveling body that is connected to a rotating shaft of the grass collector to be rotated in unison so as to switch the grass collector between the grass collecting position and the discharge position; and a cylinder connected to the swiveling body and to the support frame; wherein the swiveling body and the cylinder are disposed below the grass collector in the grass collecting position, and the cylinder extends along the bottom surface of the grass collector. |
US07730705B2 |
Electro-hydraulic lift mechanism for lawn mower deck
A mower deck lift mechanism for a lawn mower includes a mower deck, a linkage mechanism for movably mounting the mower deck to the frame for raising and lowering movement relative to the frame, and an electro-hydraulic actuator assembly connected to the linkage mechanism for raising and lowering the mower deck relative to the frame. The actuator assembly is an integrated unit including a hydraulic piston-cylinder assembly connected to the linkage mechanism, a pump for supplying pressurized fluid to the piston-cylinder assembly, and an electric motor for driving the pump. |
US07730702B2 |
Belt drive for a harvesting header with a movable cutterbar
A header for a harvesting machine with a movable cutterbar includes a belt drive mechanism connecting a stationary pulley mounted on the frame of the header and a relatively movable pulley mounted on the movable part of the header. The belt drive mechanism includes two guide pulleys, a belt mounted along said pulleys, and a pivot assembly mounted on the auger shaft. The guide pulleys are mounted on opposite lever arms of the pivot and said belt drive mechanism further includes a tensioning mechanism. |
US07730696B2 |
Method of making a stone wall
The invention described herein includes a method embodiment for making a stone wall manufacturing kit. The method embodiment includes providing a plurality of stones having a variety of thicknesses and lengths; sorting the stones based upon length and thickness of each of the stones; preparing an image of the stone wall; marking each stone within the image with an identifier to make a marked stone image; marking each stone of the plurality of stones with an identifier corresponding to the identifier of the stone in the image of the assembled stone wall; and packaging the marked stones and marked stone image to make a stone wall kit. |
US07730693B2 |
Decking system
A floor panel and method of manufacturing wherein each panel comprises a sheet having at least two stiffening members extending from the lower surface and substantially the length of the sheet. A bead is defined along one of the stiffening members while a tab is defined along the other stiffening member. Clips are provided to fasten the bead and tab in a locking relationship to hold the sheet in position. A flange formed at one end of the panel is received within a recess formed at an opposite end of another panel to automatically space one panel from another. |
US07730692B1 |
Truss bearing
A truss bearing supports a web-type construction truss and has an elongated metal member that is secured along its length to the primary supporting chord of a truss. The truss bearing can include a pair of substantially parallel spaced-apart elongated wooden members sandwiching the metal member extending along and secured to the bottom of the primary chord, with the metal member adhesively secured to the primary chord through being adhesively secured to the pair of wooden members. An optional metal bearing plate can be substantially rigidly secured to the bottom surface of the elongated metal member near one or both ends of the truss, forming therewith a T-shaped cross-section, and can be welded to a supporting member of a larger structure using metal-to-metal connection. The bearing plate can have an angled extension affixed to the first diagonal truss member. |
US07730681B2 |
Air conditioning line flashing panel
A flashing panel mount for a plurality of air-conditioning lines of an air-conditioning unit located about an exterior of a building is provided. The plurality of air-conditioning lines defines an outer periphery. The panel mount may comprise a hood member and a cover. The hood member may be attachable to the building and may have a hood member aperture sized and configured to accommodate at least two of the plurality of air-conditioning lines so as to extend the air-conditioning lines from within the building to the air-conditioning unit located about the building exterior. The cover may be attached to the hood member aperture and may be sized and configured to accommodate the air-conditioning lines therethrough. The cover may be conformable to the outer periphery of the air-conditioning lines once the air conditioning lines are fed through the hood member aperture to prevent entrance of undesirable material from a building outside to a building inside. |
US07730674B1 |
Window well
A window well for use by a person to escape through a window formed in a basement wall including a generally U-shaped body member having upper and lower ends and inner and outer ends. The open upper end of the body member has a spacer and a removable lid mounted thereon. The body member is comprised of a composite material such as fiberglass. A stair structure is positioned adjacent the inner surface of the front wall of the body member and is also comprised of a composite material. |
US07730670B2 |
Sliding door assembly
An assembly for coupling a sliding door to a track is disclosed generally comprising a support member, which has a channel in which an upper portion of the panel is disposed, that is connected to an engagement device, such as a wheel, adapted to engage the track. The engagement device is fastened to the support member at a point adjacent to the upper portion of panel in order to minimize the vertical space required. In some embodiments, the panel has a gap in the upper portion, and the engagement device is fastened to the support member via a fastener that extends through the support member and the gap in the panel. In certain embodiments, the support member is a shoe with first and second sidewalls. In some of these embodiments, the fastener extends through the engagement device and into the first sidewall adjacent the panel. |
US07730666B2 |
Plant container with watering system
A double walled plant container wherein the two walls or shells form a space for holding water. The outer wall may include a window for viewing water level. The container includes a combination watering funnel and handle arrangement at the top of the container. The watering funnel protrudes or extends from the outer perimeter of the characteristic shape of the container to allow grip of the container for carrying. Preferably two watering funnel and handle structures are included, one each on opposite sides of the container. The rim arrangement allows for convenient carrying without separating the container components. The bottom of the inner shell includes holes for conducting water from the water reservoir into the soil and may include a fiber wick and soil stop barrier to prevent entry of soil into the space between the two walls and to allow water to conduct by capillary action or otherwise into the soil. |
US07730655B2 |
Sight mount for fire arms
A sight mount for fire arms comprises a base part (10) to be mounted on a fire arm, and an upper part (11) to have a sight mounted thereon. The upper part is pivoted relative to the base part for movement about an axis between a first position corresponding to the operative position of the sight, wherein a projection (33) on the, upper part or the base part engages a groove (29) on the other part, and a second position transverse to the first position, wherein the projection is disengaged from the groove to allow the upper part to be separated from the base part. A latch (21) is spring biased to an engaged position preventing pivoting of the upper part, and against the spring bias can be brought into a disengaged position allowing pivoting of the upper part. |
US07730653B2 |
Information display system
An information display system provides an effective device for the storage and display of information. An H-shaped frame provides easy installation and ease of manufacture. An information storage unit is attached to the H-shaped frame and provides a sealed unit that is easy to access but that protects the contents from exposure to the elements. |
US07730646B2 |
Swivel work machine
A swivel work machine comprises: a travel device; a swivel base provided on the travel device; a swivel base provided in the front of the travel device; a dozer provided to the travel device; a swing control; a dozer control; a tilt control member provided to the dozer control, an actuation of the tilt control member causing the dozer to be pivoted about the tilt pivot shaft; a controller having a swing control mode in which an actuation of the swing control causes the implement to be pivoted laterally, and an angle control mode in which an actuation of the swing control causes the dozer to be pivoted about the angle pivot shaft; and a mode change-over portion for switching a control mode of the controller between the swing control mode and the angle control mode. |
US07730637B2 |
Modular shoe
A modular shoe includes an upper with an upper side and a lower side, a chassis releasably arranged in an interior of the upper, and a plurality of studs. Each stud is releasably attached to the chassis through the lower side of the upper. The lower side of the upper is clamped between the chassis and at least one of the attached studs. The invention also relates to the various components used in a modular shoe in accordance with the invention. |
US07730632B2 |
Combination tape measure and hammer
A combination tape measure and hammer includes a tape measure having an extendible tape for measuring distances, and a hammer attached to the tape measure. The tape measure includes a housing with an outer surface and the hammer conforms to the outer surface of the housing. The outer surface of the housing is curved and an underside of the hammer is curved for conforming to the curved outer surface of the housing. The hammer includes a head and a claw extending rearwardly from the head. The outer surface of the housing has a depression formed therein that is aligned with the claw. The claw is a forked claw including a first tine and a second tine spaced from the first tine. The depression formed in the outer surface of the housing is aligned with the first and second tines. |
US07730631B2 |
Device for checking accuracy of a right angle
A tape measure has a first scale on one edge of the blade and a second scale on the other edge blade where the second scale is marked in units of length which are equal to the units of the first scale multiplied by the square root of 2. A method to check a right angle measures from a corner to a distal end of a first line using the units of the first scale, measures along a second line an equal length in the first units from the corner and marking a point, by measuring from the distal end to the point using the second scale and by adjusting an angle between the first and second lines at the corner until the distance between the distal end and the point is equal to the length of the first line when measured on the second scale. |
US07730623B2 |
Frame jamb marker
A frame jamb marker includes a sliding panel for sliding on the side surface of the frame and a guiding panel perpendicularly extended from the sliding panel for sliding on the marking surface of the frame, wherein the guiding panel has a top stepping edge and a bottom stepping edge to define a top marking point and a bottom marking point at stepping corners at the top and bottom stepping edges respectively. The user is able to point a marker tool on the marking surface at one of the top and bottom marking points. When the sliding panel is slid on the side surface to drive the guiding panel sliding on the marking surface, the marker tool is guided to slidably mark on the marking surface to make a straight marking line thereon so as to precisely form the marking line parallel to the common edge of the frame. |
US07730603B2 |
Methods for forming a magnet in a rotor
Methods are provided for forming/inserting a magnet in a rotor. One method includes coating a plurality of magnetizable particles with a non-metallic material, inserting the coated particles in a rotor, and magnetizing the coated particles. Another method includes inserting a plurality of magnetizable particles into a rotor, submersing the rotor in motor varnish to coat the particles with motor varnish, and magnetizing the particles. Yet another method includes inserting a plurality of magnetizable particles in a rotor, inserting a non-metallic material into the rotor, mixing the particles and non-metallic material to form a mixture, curing the mixture to coat each particle with non-metallic material, and magnetizing the particles. Still another method includes mixing a plurality of magnetizable particles with a non-metallic material, curing the non-metallic material to coat each particle with non-metallic material, inserting the coated particles in a rotor, and magnetizing the coated particles. |
US07730599B2 |
Forklift guard, fork rack, and associated methods
A method of removing at least one fork from a forklift carriage includes placing a guard on the forklift carriage to interpose the at least one fork between the forklift carriage and the guard, uncoupling the at least one fork from the forklift carriage at a first coupling location, positioning the at least one fork uncoupled from the forklift carriage at the first coupling location in a fork rack, removing the guard from the forklift carriage, and removing the at least one fork from the forklift carriage. Fork racks, methods, and systems for removing, replacing, and/or storing forks provide additional advantages. |
US07730589B2 |
Power tool with gel grip including an integral backing
A power tool with a gel gripping member has a base with a desired configuration. The base has a desired structural rigidity such that when force is exerted on the base, the base substantially prohibits deflection. A flexible layer covers the base. The flexible layer has a mating configuration slightly larger than the base to form a pocket. A gel material is positioned into the pocket to provide resilient characteristics. A mechanism on the base enables the gel gripping member to be secured with the housing of the power tool. |
US07730588B1 |
Fire hose holding apparatus
The invention is a fire hose holding apparatus that involves a hose clamp that involves two halves that are connected together via a hinge and a handle. Located along the interior of said two halves are rubber strips. The locking apparatus involves a locking clip on the opposite ends of the two halves and locking notch in the handle. |
US07730586B2 |
Locking hinge assembly
A locking hinge assembly (32) has first and second hinge members (38, 40) having a respective hinge section (50, 51), proximate wall (46, 47) and mounting flange section (42, 43) for mounting on respective first and second panels (24, 26). The first and second hinge members are pivotably connected together at the hinge sections and are pivotably movable between a first position and a second position. The mounting flange section (42) has a channel (54) extending along the proximate wall section (48) for slidably receiving a locking member (56). The locking member (56) has at least one locking flange (60) extending through aligned apertures in the proximate walls. The locking flange has a hook section (62) at a distal end such that when the locking member slides to a locking position, the hook section engages a proximate wall to lock the hinge members in the first position. |
US07730584B2 |
Single pivot hinge with integral coil spring assist
A vehicle closure hinge includes a mount having a pivot axis flange, a pivot link, a pivot coupling the pivot link to the pivot axis flange and a spring formed by a laterally coiled strand extending from a first coil end to a second coil end in a direction substantially perpendicular to the plane of displacement about the pivot axis. The coil size, the strand size and the number of coils can be varied as desired to vary the spring biasing force exerted against the vehicle closure without varying other components of the hinge. The hinge parts may be designed with various configurations including simple pivoting links or a four bar linkage. A strand end of the coil spring extends along the direction of the coil to a position at a first coil end to maintain biasing force near the plane of displacement about the pivot axis. |
US07730580B2 |
Automobile vehicle striker assembly
A striker used between a vehicle component and a vehicle body member includes a homogenous polymeric striker body. The body includes a first portion having opposed first and second sides, and a raised mid-body between the first and second sides. A second portion is oriented at an angle with respect to the first portion. The second portion includes first and second mounting wings and a bumper receiving portion positioned between the mounting wings. A resilient bumper is engaged with the second portion extending partially over the inclined surface. The raised mid-body defines a substantially planar, inclined surface continuously increasing in elevation with respect to the first and second sides between a first portion free end and a first and second portion intersection. The second portion has at least one rectangular-shaped cavity created on a vehicle body engaging side adapted to non-rotatably receive a geometrically configured fastener. |
US07730557B1 |
Cooled protective garment
A chemical protective garment or ensemble is disclosed that comprises a impermeable, protective cooling laminate having a water-holding layer for holding and evaporating liquid, and a chemical barrier. The water-holding layer has a water-holding capacity of at least about 5% wt., and the suit is designed to retain sufficient liquid to provide cooling to a wearer upon evaporation of the liquid from the suit. |
US07730553B2 |
Torso garment
A torso-covering garment for playing paintball having gripping areas to enable the user to grippably contact a gripping area of the garment with the butt stock of the gun. Each gripping area comprises a pliant, non-cushioning substrate. Common embodiments of the garment are shirts, jerseys, jackets, and vests. A method of playing paintball which comprises wearing the garment of the invention, and a method of fabricating the garment. |
US07735142B2 |
Electronic vulnerability and reliability assessment
Systems for providing information on system vulnerabilities include a database populated with descriptive system information and a database structure configured as a hierarchical plurality of database pages configured to include element vulnerability information and links to related database pages. A rule processor module is configured to provide rules for cycling through the database structure to match keywords, such as keywords provided by user input, and descriptive system information from the database with element vulnerability information from the database structure. Other systems and methods are also provided. |
US07735141B1 |
Intrusion event correlator
Disclosed is a system for correlating intrusion events using attack graph distances. The system includes an attack graph generator, an exploit distance calculator, an intrusion detector, an event report/exploit associator, an event graph creator, an event graph distance calculator, a correlation value calculator, and a coordinated attack analyzer. An attack graph is constructed for exploits and conditions in a network. The exploit distance calculator determines exploit distances for exploit pair(s). The intrusion detector generates event. Events are associated with exploits. Event graph distances are calculated. Correlation values are calculated for event pair(s) using event graph distances. The correlation values are analyzed using a correlation threshold to detect coordinated attacks. |
US07735133B2 |
Authentication system, control method and program thereof, and storage medium
An authenticated user is provided with page information relating to a service to be provided, such as a service for ordering products. In the invention, the authenticated user is provided with page information in either a first or second form, wherein in the first form the page information includes an entry field for coupon information and in the second form the page information does not include the entry field for the coupon information. When coupon information input in the entry field is received, a determination is made whether or not the coupon information is valid. The number of times that the coupon information is determined to be invalid is counted and stored in association with the authenticated user. When the counted number does not exceed a predetermined value, the user is provided with the page information in the first form, while the page information is provided in the second form when the counted number exceeds the predetermined value. |
US07735119B2 |
Access control in a web application using event filtering
A web application is described that is capable of assuming a plurality of states and being arranged to process a received event from among a predeterminable set of events to change from one state to another. A permission record defines a set of permitted or forbidden events and the web application comprises an event filter arranged to consult the permission record on receipt of an event in order to determine whether to permit or not permit the event to be processed. Related methods of access control and computer program products are also described. |
US07735115B2 |
System which enforces policy for virtual private organization and method thereof
System formed of a group of management entities including an enforcement environment of a policy description program, and service, data, software and hardware, in which the enforcement environment of the policy description program correlates resources to be managed (group) with a management entity which is to enforce a policy and includes a dynamic conversion unit, an enforcement unit, a unit of an interface between the management entities and a unit of an interface to the resources to be managed (group). |
US07735104B2 |
System and method for navigation of indexed video content
Systems and methods for providing enhanced navigation of stored digital video content based upon a content-based index. Includes generation and storage of an index, as well as navigation based on the segments defined by the index. An example system is embodied in a digital video recorder that generates an index for locating commercial groups interleaved with program content in a video presentation recorded from a television broadcast. The commercial groups may be viewed without the intervening program content or otherwise navigated based upon information in the index and one or navigation functions. Example user interfaces and several navigation functions are also provided. |
US07735101B2 |
System allowing users to embed comments at specific points in time into media presentation
A method and system for linking a web page to a portion of a video is provided. Users can enter comments into a video that include a start and end time index for identifying a portion of a video. Comments are indexed to the media presentations such that they may be searched and located, thus media playback can be executed from any comment. The system allocates a unique comment track to each user that can be turned on and off at will by users during playback. |
US07735096B2 |
Destination application program interfaces
Media processing methods, systems and application program interfaces (APIs) in which a destination component, also referred to as a destination, provides an application with a simple and unified way of rendering, archiving, broadcasting (or other types of media output processing) media from an origin to a target of choice, without requiring the application to have intimate knowledge about underlying components, their connectivity and management. For example, applications can use a destination to help manage the rendering or archiving (or other processing) of the particular media. |
US07735093B2 |
Method and apparatus for processing real-time command information
A method and apparatus includes a real time event engine that monitors event signals. A real time event detector within the real time event engine detects when the real time event occurs. Thereupon, real time event commands within a real time event command buffer are fetched and consumed by the command processor in response to the occurrence of the real time event. The real time event detector contains a plurality of control registers, which contain an event selector register, a real time command buffer point register, and a real time command buffer length register. A driver may program the registers, whereupon a singe real time event detector may be used in conjunction with a plurality of real time event command buffers. |
US07735090B2 |
On demand software contract modification and termination in running component assemblies
A method, apparatus and article of manufacture to dynamically modify, terminate, or replace software components and connections (i.e., contracts) between components in a running assembly. Information about the component and contracts between components in a running assembly is used to determine an allowable sequence of management commands to transition the assembly of components from a current state to a specified goal state. At the same time, other components may continue to perform an operational workflow. |
US07735089B2 |
Method and system for deadlock detection in a distributed environment
A method of deadlock detection is disclosed which adjusts the detection technique based on statistics maintained for tracking the number of actual deadlocks that are detected in a distributed system, and for which types of locks are most frequently involved in deadlocks. When deadlocks occur rarely, the deadlock detection may be tuned down, for example, by reducing a threshold value which determines timeouts for waiting lock requests. When it is determined that actual deadlocks are detected frequently, the processing time for deadlock detection may be reduced, for example, by using parallel forward or backward search operations and/or by according higher priority in deadlock detection processing to locks which are more likely to involve deadlocks. |
US07735088B1 |
Scheduling synchronization of programs running as streams on multiple processors
Systems and methods start a process in an operating system. Additionally, a plurality of program units associated with the process are started. When a context shifting event occurs, each of the plurality of program units has their scheduling synchronized and their context set so that each thread processes the context shifting event. A further aspect of the system is that some program units may be executing on more than one multiple processor unit. In the operating system selects a multiple processor unit to host all of the program units, and migrates those program units that are not currently on the selected multiple processor unit to the selected multiple processor unit. |
US07735084B2 |
Communication processing apparatus, communication processing method, and computer program
A communication processing apparatus is disclosed which performs a process for establishing a connection upon receipt of a communication connection request. The apparatus includes a controlling element for performing a connection availability determination process upon receipt of the connection request. The controlling element performs a user identification process for identifying a user representing a connection request sender based on data in the connection request. The controlling element further carries out the process for establishing the connection if communication processing resources allocated for the user having a user identifier acquired in the user identification process are judged to be available. |
US07735081B2 |
Method, apparatus and system for transparent unification of virtual machines
A method, apparatus and system for transparently unifying virtual machines (“VMs”) is disclosed. An embodiment of the present invention enables a user to interact with various applications on a VM host while unaware of the VM structure on the VM host. The user may be presented with a unified desktop interface representing a composite and/or unified view of the VM host. Via this unified desktop interface, the user may perform all necessary commands and/or receive output. Invisible to the user, the unified desktop interface represents a unification console. The unification console may be an independent component (e.g., an enhanced VM) and/or a subset of a virtual machine manager (“VMM”) component on the VM host. In either situation, the unification console may, alone and/or in conjunction with the VMM, route and/or redirect and/or transform and/or filter the user's commands to the appropriate applications and redirect and/or copy and/or transform and/or filter the output from the applications to be displayed in the unified desktop interface. |
US07735071B2 |
Method and system for compiling multiple languages
A method and system for compiling multiple source language files that share a common library. The common library is represented in a common language that can be used by multiple different source languages. Font end compiler systems read the common language files that make up the common library and the source language files that use the library. Additionally, the front end systems produce common language files. The common language files produced by the front end systems can be used in the common library. The common language files may also be supplied to a back end system or runtime environment that further compiles the common language file to an executable form and executes the file. At runtime, the common language file is used by the runtime environment to layout the objects and methods used during execution. |
US07735068B2 |
Automated relationship traceability between software design artifacts
Tools and methods are described herein that allows for measuring and using the relationship between artifacts of a software design, such as requirements, test plans, and so on. The relationship can be quantified by determining a relationship quotient for quantifying a similarity between components of software design artifacts and presenting the quantified relationships to a user, such as a software designer, so that he or she can account for the relationship between such components during design changes and so on. The relationship quotient is made more representative of substantive similarity by selecting the key terms that are to be submitted to a similarity analysis such that words that are too common in the English language, such as conjunctions, articles, etc., are not used. Ubiquity of certain key terms in an enterprise is accounted for by adding a term significance weight to the similarity analysis. The similarity analysis is made contextual, for instance, by the use of inputs from domain ontology including Entity Descriptions, and Entity Relationships. |
US07735067B1 |
Avoiding signals when tracing user processes
A method for tracing an instrumented program, including triggering a probe in the instrumented program, obtaining an original instruction associated with the probe, loading the original instruction into a scratch space, beginning execution of the original instruction in the scratch space using a thread, detecting a state of a signal received by a signal handler, and if the signal is asynchronous, executing a second instruction corresponding to the signal after executing the original instruction, and if the signal is synchronous, executing a third instruction corresponding to the signal and resetting a program counter to a location of the original instruction where the probe in the instrumented program was triggered. |
US07735062B2 |
Software development system and method
A computer design model processing system and methods are described that can create visual models of computer systems, store versions of design models in a centralized repository, automatically generate and deploy computer software systems in response to the stored computer design models, define dependencies between computer design models, and automate and assist the development of multiple, possibly dependent, computer design models by multiple developers. |
US07735058B2 |
Remote component and connection architecture
A method of developing software comprises the steps of defining a plurality of component objects for receiving input data and producing output data, defining a plurality of connection objects for passing data between the component objects, and executing an initialization script to define a behavioral model for the system by defining relationships between the component objects and the connection objects. A software development system that performs the method is also provided. |
US07735055B2 |
Method of creating photo mask data, method of photo mask manufacturing, and method of manufacturing semiconductor device
A method of creating photo mask data includes preparing design data of a photo mask, generating drawing data of the photo mask by using the design data, generating inspection control information configured to control inspection of defect on the photo mask by using the drawing data, and generating drawing and inspection data including the drawing data and the inspection control information by providing the drawing data with the inspection control information. |
US07735044B2 |
Combination of ground devices in wiring harness designs
A method can include allowing a user to place a first wiring harness design component within a wiring harness topology in a wiring harness design workspace, allowing the user to place a first plurality of ground devices within the first wiring harness design component placed in the wiring harness topology, allowing the user to request an automatic ground combination, and, in response to the user requesting an automatic ground combination, automatically applying at least one electronically stored ground combination rule to a first set of ground devices comprising a plurality of the first plurality of ground devices and automatically combining at least two of the first set of ground devices into a first combined ground device based at least in part on the applied at least one electronically stored ground combination rule. |
US07735043B2 |
Wiring layout apparatus, wiring layout method, and wiring layout program for semiconductor integrated circuit
A wiring layout apparatus includes a layout design unit configured to design a wiring layout for a semiconductor integrated circuit; a critical wiring detection unit configured to analyze a delay of signal propagation in the wiring layout so as to detect wiring strip conductors that configure a signal path whose timing is critical; a rewiring unit configured to rearrange the wiring strip conductors so as to improve the uniformity of a wiring pattern of an area in the vicinity of the critical wiring strip conductor, with regard to the wiring layout; and a strip-conductor-size variation determination unit configured to evaluate the uniformity of the pattern of the rearranged wiring layout so as to determine whether or not variation in the size of the critical wiring strip conductor falls within a tolerance range. |
US07735039B1 |
Methods of estimating net delays in tile-based PLD architectures
Methods of estimating delays between pins on a tile-based programmable logic device (PLD), by identifying repeat patterns and exploiting these patterns to provide accurate delay estimates. A computer-implemented method can include selecting a sample area in a tile-based PLD and constructing a delay table corresponding to the sample area. Each entry in the delay table includes a base delay value and a description of the fastest available route from a source pin in a source tile to a load pin in the sample area. To estimate a net delay, the base delay value and the description of the route are read from the delay table for specified source and load pins. One or more delay variants (e.g., pin delays and/or crossing penalties) are calculated based on the description of the route. The calculated delay variants are added to the base delay value to obtain an adjusted delay value, which is output. |
US07735036B2 |
System and method enabling circuit topology recognition with auto-interactive constraint application and smart checking
A computer-implemented method of identifying sub-circuits in circuit designs includes: receiving a selection of a sub-circuit; specifying a match expression for the sub-circuit, where the match expression characterizes matching properties of components of the sub-circuit; modifying the match expression to change the matching properties of components of the sub-circuit; and producing an information structure in a computer readable medium, where the information structure associates a graph representing a topology of the selected sub-circuit with the modified match expression. Subsequently, the information structure corresponding to the selected sub-circuit can be identified in a given circuit design. |
US07735034B2 |
Simulation model for a semiconductor device describing a quasi-static density of a carrier as a non-quasi-static model
There is disclosed a simulation model and method for designing a semiconductor device being used for a simulation apparatus for designing a semiconductor device that includes using assuming units as to carrier transient density and current flow of electrodes along with a non-quasi-static model describing unit of the simulation apparatus. A simulation apparatus and computer readable medium with a simulation program for executing the method are also included. |
US07735025B2 |
Portable terminal having motion-recognition capability and motion recognition method therefor
A motion-recognition portable terminal and a motion recognition method therefor are provided. In the portable terminal, a motion key starts to create a motion entry, upon activation. A motion detector measures an acceleration along each axis of the portable terminal, upon activation of the motion key. A controller determines whether the motion entry has been completed based on the variation of the each-axis acceleration. |
US07735020B2 |
Method and apparatus for determining font attributes
Methods and apparatuses for text formatting. In one exemplary embodiment of the present invention, a method to determine a font attribute includes: determining a first number and a second number; receiving input resulting from a sliding (or other repositioning method) of a thumb of a slider to a position; and determining a value for the font attribute from the position relative to the slider and the first and second numbers. In one example according to this aspect, the font attribute is one of: a) font size; b) boldness; c) italic angle; d) baseline offset; e) line spacing; and f) character spacing. At least one of the first number and the second number is adjusted in one example, when the thumb is pushed against one end of the slider. In another example according to this aspect, at least one of the first number and the second number is updated when a first input is received (e.g., selecting a value from a list, typing in a value; or pushing a thumb against one end of a slider), which determines the at least one of the first and second number. |
US07735017B2 |
System and method for automating manual transactions between disjoint systems
A system, method and program product for copying data between disjoint data processing applications. A system is disclosed that includes: a source application having a system for selecting a data record and a triggering agent that extracts relevant data from the selected data record, launches a dialog box and displays the extracted relevant data in the dialog box; and a data transfer system having a keystroke simulator for copying and pasting data from the dialog box to an interface window in a target application based on a set of data transfer rules. |
US07735012B2 |
Audio user interface for computing devices
An audio user interface that generates audio prompts that help a user interact with a user interface of a device is disclosed. One aspect of the present invention pertains to techniques for providing the audio user interface by efficiently leveraging the computing resources of a host computer system. The relatively powerful computing resources of the host computer can convert text strings into audio files that are then transferred to the computing device. The host system performs the process intensive text-to-speech conversion so that a computing device, such as a hand-held device, only needs to perform the less intensive task of playing the audio file. The computing device can be, for example, a media player such as an MP3 player, a mobile phone, or a personal digital assistant. |
US07735005B2 |
Style guide and formatting methods for pilot quick reference handbooks
Aspects of the present invention provide a style guide, formatting methods, and electronic/digital versions for quick reference handbooks (QRH) for mobile platforms. Using one or more of the style guide and formatting methods to create quick reference handbooks can provide improvements in safety through error and workload reduction during non-normal situations, improvements in operator understanding of checklists and information contained in the checklists, reduced customer changes needed to create an airline quick reference handbook, reduced documentation maintenance costs, and/or reduced training costs through standardized format and content. |
US07735001B2 |
Method and system for decoding encoded documents
A method for decoding encoded markup language documents includes reading a first numeric value from a data document and identifying a data definition associated with the first numeric value. The method further includes reading a second numeric value from a data document and determining, based on a base delimiter value, that the second numeric value comprises an end delimiter of an encoded node. Additionally, the method includes generating a markup-language data structure based on the data definition and information in the encoded node. |
US07735000B2 |
Information and content exchange document type definitions to support content distribution
Extensions to a communications protocol manage the exchange of data content and related metadata according to a hierarchical data content structure. The communications protocol is the ICE protocol, and the extensions include ICE DTD extensions. Data content is preferably offered according to a subscription service provided by a first network device. The first network device is preferably a content server. The data content is organized, and thereby distributed, according to a hierarchical data content structure defined by the ICE DTD extensions. The hierarchical data content structure provides a means for organizing the data content, preferably by subject-matter. The hierarchical data content structure includes a plurality of channels, and each channel is segmented into one or more content sub-channels. Each individual data content item is associated with at least one of the content sub-channels and corresponding channel. The individual data content item is associated with a particular channel according to the subject matter of the individual data content item and the subject-matter of the channel. In this manner, a content sub-channel with a specific subject-matter is configured and an individual data content item corresponding to the specific subject-matter is associated with the content sub-channel. |
US07734990B2 |
Spatial-multiplexed signal detection method and spatial and temporal iterative decoder that uses this method
The present invention is directed to providing a spatial-multiplexed signal detection method that can improve the characteristics of spatial and temporal iterative decoding that is based on turbo principles. According to the method, when implementing factorization of conditional probability referred to as “likelihood” such that the conditional probability can be represented by the product of a plurality of conditional probabilities, the conditional probability being obtained for a received signal sequence in a spatial and temporal iterative decoding configuration based on turbo principles of soft-input soft-output detector 1 and soft-input soft-output decoder 2, the conditional probability for which factorization is possible is divided into a plurality of groups. When calculating this likelihood, the ordering among groups in which probabilities are calculated can be ordered such that groups that contain events that serve as the conditions of conditional probabilities in the groups are processed earlier. When calculating the probabilities in the groups, a metric operation method is used that uses semi-rings for estimating transmission sequences by means of the ratio of likelihoods of two exclusive events. |
US07734983B2 |
Input control device and input control method
An input control apparatus capable of suppressing characteristic deterioration, reducing the circuit scale of a turbo decoder and effectively using memory of the turbo decoder. In this apparatus, control section (110) acquires information on a coding rate and coding block length of a received signal, determines the number of bits of systematic part Y1, and parity parts Y2 and Y3 in accordance with the coding rate and/or coding block length and so that the number of bits of one sequence of the parity parts falls below the number of bits of systematic part Y1 and controls bit number reduction section (109) so that the determined number of bits is obtained. Bit number reduction section (109) reduces the number of bits of systematic part Y1, and parity parts Y2 and Y3 output from separation section (108) under the control of control section (110) and decoder (111) performs turbo decoding using each sequence reduced by bit number reduction section (109). |
US07734979B1 |
ARQ for point to point links
An automatic retransmission system offering good latency and overhead characteristics combined with programmable tradeoffs among overhead, latency, and error performance. ARQ (Automatic Repeat reQuest) blocks present at both ends of a link coordinate to automatically attempt to re-send data if that data was not received properly the first time it was sent. Re-transmission from the transmitter (transmitter) is requested by the receiver (Receiver) via a highly reliable “Repeat Request” (RR) mechanism. This RR scheme carries sufficient information back to the transmitter for it to determine which previous transmissions need to be re-sent. |
US07734977B2 |
Method and system for error correction over serial link
A system and method in accordance with the invention produces an ECC code that is transmitted in the y-bit domain along with data is converted from a native x-bit domain to the y-bit domain. Such a system and method provides a representation of an ECC code that is part of a transmitted serial stream that allows clock recovery and that can use parity checking or other method to verity the integrity of the transmitted ECC code itself. |
US07734976B2 |
Synchronizing control of test instruments
A method and apparatus for synchronizing plural test devices coupled to a host. A counter of each of the devices is initialized, and each of the counters is incremented, such as by a periodic signal indicating a start of a data stream. An action, typically either a source signal or a measurement signal, is triggered when a respective counter reaches a programmed counter value. |
US07734966B1 |
Method and system for memory testing and test data reporting during memory testing
The present invention provides a method and system for improving memory testing efficiency, raising the speed of memory testing, detecting memory failures occurring at the memory operating frequency, and reducing data reported for redundancy repair analysis. The memory testing system includes a first memory tester extracting failed memory location information from the memory at a higher memory operating frequency, an external memory tester receiving failed memory location information at a lower memory tester frequency, and an interface between the first memory tester and the external memory tester. The memory testing method uses data strobes at the memory tester frequency to clock out failed memory location information obtained at the higher memory operating frequency. In addition, the inventive method reports only enough information to the external memory tester for it to determine row, column and single bit failures repairable with the available redundant resources. The present invention further provides a redundant resource allocation system, which uses a bad location list and an associated bad location list to classify failed memory locations according to a predetermined priority sequence, and allocates redundant resources to repair the failed memory locations according to the priority sequence. |
US07734963B2 |
Non-causal channel equalization system
A system and method are provided for non-causal channel equalization in a communications system. The method comprises: establishing three thresholds; receiving a binary serial data stream; comparing the first bit estimate in the data stream to a second bit value received prior to the first bit; comparing the first bit estimate to a third bit value received subsequent to the first bit; data stream inputs below the first threshold and above the third threshold are a “0” if both the second and third bits are “1” values, and as a “1” if either of the second and third values is a “1”; data stream inputs above the second threshold and below the third threshold are a “1” if both the second and third bits are a “0” value, and as a “0” if either of the second and third values is a “0”. |
US07734962B2 |
Secure problem resolution techniques for complex data response networks
In various embodiments, techniques for secure problem resolution associated with complex data response networks are provided. Error messages associated with an executing problem service are trapped and hidden from a principal. The error messages are associated with a randomly generated incident identifier. The incident identifier is supplied to the principal. The principal gains access to the error messages when the principal successfully authenticates for access and supplies the incident identifier. |
US07734960B2 |
Method of managing nodes in computer cluster
A method is described of managing nodes in a computer cluster comprising: each node repeatedly broadcasting a cluster summary message; a cluster coordinator node identifying failed nodes by analysing cluster summary messages received from other nodes in the cluster; and the cluster coordinator node broadcasting an updated cluster organization status, if failed nodes are identified. In at least preferred embodiments, the broadcasts can be transmitted using an ad-hoc wireless network. |
US07734948B2 |
Recovery of a redundant node controller in a computer system
Recovery of a redundant node controller in a computer system including determining a loss of a heartbeat for a predefined period of time between a system controller and the redundant node controller; in response to determining the loss of the heartbeat for the predefined period of time, checking network connectivity between the system controller and the redundant node controller; if there is network connectivity between the system controller and the redundant node controller, determining whether an application on the redundant node controller is running; and if an application on the redundant node controller is running, resetting the redundant node controller through a primary node controller. |
US07734943B2 |
Low power display refresh
An application processor coupled to a Static Random Access Memory (SRAM) interfaces with a graphics accelerator. A Dynamic Random Access Memory (DRAM) stores frame buffer data that may be transferred to a display through a switch located on the graphics accelerator in normal operation. In a power savings mode, the DRAM may be powered down and a copied frame buffer data stored in the SRAM may be transferred to the display through the switch. |