Document	Document Title
US09361582B2	Efficient binary protocol marshalling for rule engine sessions Some embodiments of efficient binary protocol marshalling for rule engine sessions have been presented. In one embodiment, a set of marshalling plug-ins is provided to a rule engine. Each of the set of marshalling plug-ins is customized for a type of user objects. In response to encountering a user object, the rule engine selects a marshalling plug-in out of the set of marshalling plug-ins based on a type of the user object to marshall in or to marshall out the user object.
US09361580B2	Medical diagnosis support apparatus and method of controlling the same A medical diagnosis support apparatus is provided. In the medical diagnosis support apparatus, an acquisition unit acquires medical information associated with a diagnosis target as input information. An inference unit infers a diagnosis name of the diagnosis target based on the acquired input information. A calculation unit calculates the influence rate of each input information with respect to each inference. A creation unit creates a report sentence based on the calculated influence rate.
US09361568B2	Radio frequency identification tag with hardened memory system In embodiments of the present invention improved capabilities are described for RFID tags with hardened memory, where the memory comprises a plurality of one time programmable (OTP) non-volatile memory locations for storing data, wherein the plurality of OTP non-volatile memory locations are configured to emulate a hardened memory system that retains data stored in the plurality of OTP non-volatile memory locations, wherein the data stored is retained after exposure of the RFID tag to an ionizing radiation exposure with an exposure level equal to or greater than 25 kGy, wherein the plurality of OTP non-volatile memory locations are configured to emulate at least one multiple time programmable (MTP) memory location for storing the data.
US09361560B2	Printing device which transmits decompressed data to a storage device if a predetermined condition is not satisfied A printing apparatus including: a receiving unit configured to receive print data; a printing unit configured to print image obtained from decompressed data, which is obtained by decompressing the print data, on a sheet; a transmitting unit configured to transmit data to a storage device to which a log related to printing is configured to be stored; and a control device configured to: decompress the print data into the decompressed data; and determine whether data related to the printing satisfies a predetermined condition; wherein, if the control device determines that the predetermined condition is satisfied, the transmitting unit transmits the print data to the storage device, and if the determining unit determines that the predetermined condition is not satisfied, the transmitting unit transmits the decompressed data to the storage device.
US09361554B2	Low overhead near unity scaling technique A printer is described having a control unit and/or image processor to determine a number of pixels by which to scale an image along an axis of the image, wherein, the scaling of the image is less than 10% of the image along the axis. The control unit and/or image processor is also to identify locations along the axis equal to the number. The control unit and/or image processor is also to remove a region of more than one pixel along the axis at each of the locations. The control unit and/or image processor is also to insert a region of more than one pixel along the axis at each of the locations, where, a difference between pixels removed and pixels inserted accounts for the number.
US09361550B2	Processing webs using printed graphic code symbol relating to web features An arrangement comprising at least one first processing machine arranged to process a web, and a scanning device arranged to scan the web. The arrangement also comprises a computing device configured to: receive image data of the web, analyze the data, and generate a graphic code symbol based on the analysis, and a printing device arranged to print the graphic symbol on the web for marking a web with data relating to features of the web. At least one second processing machine is arranged to further process the web, a reading device is arranged to read the graphic code symbol of the web, and a control device is configured to: receive image data relating to the graphic code symbol, decode the graphic code symbol to retrieve information regarding features of the web, and control the second processing machine to adapt the further processing of the web according to the features.
US09361545B2	Methods and apparatus for estimating angular movement with a single two dimensional device Certain aspects of the present disclosure relate to methods and apparatus for neuro-simulation with a single two-dimensional device to track objects. The neuro-simulation may report a point of interest in an image that is provided by the device. The device may center on the point of interest using one or more actuators. The simulation mechanism may input pixels and output a plurality of angles to the actuators to adjust their direction.
US09361542B2	Methods and systems for determining image similarity In one embodiment, a computing device receives a first image from a client device associated with at least one user of a social-networking system. The computing device performs a content-aware hashing function on the first image and generates a large hash value. The computing device then performs a locality-sensitive hashing function on the large hash value to generate a small hash value. The computing device calculates a distance from the small hash value to a cluster center which is associated with the small hash values for at least one other image. If the distance is greater than a threshold distance, the first image is determined not similar to the at least one other image. The computing device creates a new cluster center for the first image. If the distance is less than the threshold distance, the first image is determined similar to the at least one other image.
US09361523B1	Video content-based retrieval A method and system for video-content based retrieval is described. A query video depicting an activity is processed using interest point selection to find locations in the video that are relevant to that activity. A set of spatio-temporal descriptors such as self-similarity and 3-D SIFT are calculated within a local neighborhood of the set of interest points. An indexed video database containing videos similar to the query video is searched using the set of descriptors to obtain a set of candidate videos. The videos in the video database are indexed hierarchically using a vocabulary tree or other hierarchical indexing mechanism.
US09361520B2	Method and system for tracking objects There is provided a system for tracking objects. The system includes a processor and a memory for storing a plurality of sensory data frames. The processor determines a first hypothesized location for each of the objects in each of the plurality of sensory data frames. For each of the plurality of sensory data frames, the processor determines probabilities that the first hypothesized location of each of the objects in a sensory data frame of the plurality of sensory data frames is the same as the first hypothesized location of another object in an adjacent sensory data frame. The processor computes a first optimal trajectory for each of the objects using an algorithm based on the probabilities, checks the first optimal trajectory for each of the objects, and accepts or rejects the first optimal trajectory for each of the objects.
US09361510B2	Efficient facial landmark tracking using online shape regression method Disclosed in some examples are various modifications to the shape regression technique for use in real-time applications, and methods, systems, and machine readable mediums which utilize the resulting facial landmark tracking methods.
US09361506B2	Tenprint card input device, tenprint card input method and storage medium A system, which computer processes a tenprint card where fingerprint images are imprinted, provides a processing mechanism which automatically crops or segments respective fingerprint images on the tenprint card. In particular, the system provides: a processing mechanism which appropriately crops or segments a slap print image, even if a fingerprint image of slap prints does not fit in a predetermined frame or even if noise other than fingerprints to be cropped or segmented is present within a frame of a four-finger slap, by using a result of matching with rolled prints; and a processing mechanism which checks a correspondence relationship between the rolled prints and the plane prints, assesses a finger position, and detects an error of imprinting position.
US09361497B1	Arrangement for and method of capturing images of documents A visible target having a predetermined target size is fixed on a document capture stand. A visible aiming light beam is directed along an aiming axis away from an imaging reader. The beam has a beam size in cross-section that changes along the aiming axis. The reader is moved relative to the stand along the aiming axis until the beam size visually matches the target size at a predetermined distance between the reader and the stand. An image of a document supported by the stand is captured at the predetermined distance.
US09361488B2	Single or dual complex subcarrier downconversion A method for subcarrier downconversion and data detection according to one embodiment includes determining whether to use an upper sideband frequency section of a complex downconverter output, a lower sideband frequency section of the complex downconverter output, or both sideband frequency sections of the complex downconverter output; and processing the output corresponding to the selected sideband frequency section or sections based on the determination, wherein the processing includes correlation and data detection. Such methodology may also be implemented as a system using logic for performing the various operations. Additional systems and methods are also presented.
US09361474B2	Network filesystem asynchronous I/O scheduling Resource acquisition requests for a filesystem are executed under user configurable metering. Initially, a system administrator sets a ratio of N:M for executing N read requests for M write requests. As resource acquisition requests are received by a filesystem server, the resource acquisition requests are sorted into queues, e.g., where read and write requests have at least one queue for each type, plus a separate queue for metadata requests as they are executed ahead of any waiting read or write request. The filesystem server controls execution of the filesystem resource acquisition requests to maintain the ratio set by the system administrator.
US09361470B2	Secure element comprising separated containers and corresponding method The invention is a secure element comprising a virtual machine able to work in admin mode and in runtime mode. The secure element comprises two enhanced containers. Each of said enhanced containers can be either in an activated state or in a disabled state. Only one of the enhanced containers can be in activated state at any given time. The virtual machine is adapted to access each of the enhanced containers when working in admin mode. The virtual machine cannot access an enhanced container which is in disabled state when working in runtime mode.
US09361467B2	Owner-controlled access control to released data Implementations of the present disclosure include methods, systems, and computer-readable storage mediums for receiving, from a computing device used by an authenticated user, a validation request, the validation request including a first hash value and a first validation token, the first hash value being generated based on restricted content of a workflow object and the first validation token being associated with a first state of the workflow object, and determining that the authenticated user is authorized to request validation of the workflow object and, in response: decrypting the validation token to provide a second hash value, and determining that the second hash value is equal to both the first hash value and a third hash value and, in response, transmitting a validation response to the computing device, the validation response indicating that the workflow object is valid.
US09361464B2	Versatile log system A versatile log system is disclosed for producing logs for documents or other objects. The system allows authorized users to configure a log table and at least one coupled table, validate log entries for the log table, and validate data records for the coupled table. When the system is installed with investigative identity data search algorithm, identity data processing algorithm, interactive data entry features, and phrase construction feature, it can significantly improve production efficiency and data accuracy.
US09361458B1	Locality-sensitive hash-based detection of malicious codes Malicious code is detected in binary data by disassembling machine language instructions of the binary data into assembly language instructions. Opcodes of the assembly language instructions are normalized and formed into groups, with each group being a subsequence of a sequence of machine language instructions of the binary data. The subsequence is delimited by a predetermined machine language instruction. Locality-sensitive hashes are calculated for each group and compared to locality-sensitive hashes of known malicious machine language instructions to detect malicious code in the binary data.
US09361454B2	Methods for restricting resources used by an application based on a base profile and an application specific profile In response to a request for launching an application within an operating system of a data processing system, one or more extended entitlements are extracted from the application, where the one or more extended entitlements specify one or more resources the application is entitled to access. One or more security profile extensions corresponding to the one or more extended entitlements are dynamically generated. A security profile specifically for the application is created based on the one or more security profile extensions and a base security profile that has been previously compiled, where the base security profile specifies a list of a plurality of base resources. The application is then launched in a sandboxed operating environment that is configured based on the security profile specifically generated for the application.
US09361449B2	Platform integrity verification system and information processing device A platform integrity verification system capable of executing platform integrity verification by a trusted boot without causing a delay of system startup time. The platform integrity verification system has an information processing device and an integrity verification computer that is communicably connected to each other. The information processing device comprises an acquisition section acquires a unique value from each of a plurality of programs executed by the information processing device when the information processing device is shut down; and a storage section configured to store the unique value acquired by the acquisition section in a storage device. The integrity verification computer comprises a comparison section configured to acquire the unique value stored in the storage device through communication with the information processing device and compares the acquired unique value with a predetermined value held in advance for each program.
US09361448B2	Enabling authentication and/or effectuating events in virtual environments based on shaking patterns and/or environmental information associated with real-world handheld devices Shaking patterns and/or environmental information associated with real-world handheld devices may form a basis for enabling authentication and/or effectuating events in a virtual environment. The handheld devices may include toys and/or other object that can be used to play. The handheld devices may be associated with the virtual environment in that individual handheld devices may share an appearance and/or theme with an avatar, a virtual object, and/or other element within the virtual environment. Shaking a pair of handheld devices together may facilitate authentication of the handheld devices with respect to the virtual environment and/or effectuate one or more events within the virtual environment. Shake patterns may be used in conjunction with geo-location and/or environmental information to improve pairing between handheld devices.
US09361438B2	System and method for accepting user input using asynchronous authentication A method and system for accepting user inputs over a network. The user is provided with an input widget on a client system to collect and send an input and user identity information to a server system, without the requirement to authenticate the user identity on the client system upfront. The server stores the user input and the user identity information, and associates the user input information with the user identity information. The server system sends to the user identity URL a message comprising of the user input information and an indication of action such as a link that the user is to perform to confirm the authenticity of the input. In response to the indicated action being performed, the server system processes the user input as authenticated input.
US09361428B2	System and method for electronically managing medical data files A network server arrangement including a processor with a machine readable storage encoded with software for execution by the processor. The network server arrangement is responsive to requests to access a medical record of an individual and generates summary medical record data including summary information having a plurality of data elements associated with the individual, at least one of the data elements conveying medical information about the individual, and a pointers component including at least one pointer pointing to a network location containing importable medical information in connection with the individual that is not contained in the summary information component. The pointer includes a machine readable address part for processing by the client, allowing the client to import the medical information from the network location, and a label part for displaying to a user the nature of the medical information residing at the network location.
US09361427B2	Scar-less multi-part DNA assembly design automation The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.
US09361423B2	RC corner solutions for double patterning technology A method includes selecting a process corner, determining model parameters for forming an integrated circuit, and generating a file using the model parameters for the process corner. The generating the file is performed using a computer. The file includes at least two of a first capacitance table, a second capacitance table, and a third capacitance table. The first capacitance table stores greatest parasitic capacitances between layout patterns of the integrated circuit when lithography masks including the layout patterns shift relative to each other. The second capacitance table stores smallest parasitic capacitances between the layout patterns when the lithography masks shift relative to each other. The third capacitance table stores nominal parasitic capacitances between the layout patterns when the lithography masks do not shift relative to each other.
US09361417B2	Placement of single-bit and multi-bit flip-flops Technology is disclosed for placement of single-bit flip-flops and multi-bit flip-flops. Single-bit flip-flops with replaced with multi-bit flip-flops and/or relative placement groups of single-bit flip-flops.
US09361410B2	Surgical guides from scanned implant data A method of making a patient specific surgical guide includes obtaining a virtual model of a fixation member, and virtually designing a guide that defines at least one hole that corresponds to a hole of the virtual model of the fixation member.
US09361401B2	Relevance map linking Systems, methods, and machine-readable and executable instructions are provided for relevance map linking. Relevance map linking can include identifying a user as a user node that is associated with a number of user resources. Relevance map linking can also include finding a number of related resources that are associated with the number of user resources and defining the number of related resources as a number of related resource nodes. Relevance map linking can include defining a number of related resource relevance maps for the number of related resource nodes. Relevance map linking can include defining a user relevance map for the user node wherein the user relevance map links the number of related resource nodes and the user node based on the number of resource relevance maps.
US09361400B2	Method of improved hierarchical XML databases A method is provided for initializing an XML database. The method includes the steps of parsing an XML file to extract a plurality of records, the records arranged in a hierarchical form, creating, for each record, a plurality of class objects, each class having associated therewith one or more attributes, and creating a plurality of handling methods for each of one or more attributes associated with each class object, the handling methods defining how the database can be accessed.
US09361378B2	Determining reliability of online post Technologies are generally described for determining a reliability of an online post. In some examples, a method may include identifying from an online post at least one word associated with a place, identifying a location from which the online post was posted, and determining a reliability of the online post based at least in part on the identified word associated with the place and the identified location from which the online post was posted.
US09361371B2	Playlist update in a media playback system Embodiments are provided for updating a playlist that has been added to a playback queue in response to changes to the playback queue. The playback queue may be associated with a zone of a network media system such that items in the playback queue are to be rendered by the zone. The playlist may include one or more items playable by the zone, and may be stored separately from where the playback queue is maintained. Embodiments are also provided for updating a playback queue in response to modifications to a playlist included in the playback queue. In some cases, a user modifying the playlist or playback queue may be prompted upon making the modifications whether to also apply the modification to the playback queue or playlist, respectively.
US09361368B1	Review-broadcasting integrating social networks and product information A feedback module identifies one or more social network data entries received from the at least one social network provider that are related to a content item. The feedback module parses the identified one or more social network data entries to identify feedback related to the content item. The feedback module then generates a feedback result based on the feedback identified in the one or more social network data entries.
US09361359B1	Accessing schema-free databases Accessing a schema-free database includes constructing a model indicating a structure for the data to be used by applications accessing the data, validating the model based on the structure and on the data stored in the schema-free database, providing an API based on the structure, and accessing the database using the API. The model may be constructed by extracting data structure information from a program. The program may be written in the Ruby programming language or the Python programming language. The API may be a RESTful API.
US09361350B2	Data transfer between first and second databases To facilitate data transfer between two databases, a transfer machine accesses both databases and finds matching records. The transfer machine determines and stores a match status of a record in one database. The match status indicates whether the record corresponds to at least one of the records in the other database, and if so, which record or records in the other database correspond to the record. If the match status indicates that the record matches a record in the other database, the transfer machine determines which record is current and updates the other record. If the match status indicates that a record has no match in the other database, the transfer machine adds a copy of the record to the other database.
US09361348B1	Database replication A database server receives a request from a client application for performing a data transaction on persistent data storage. The request is sent to a set of replication servers. An acknowledgement for the request is received from each replication server, including a start sequence number and an end sequence number for data that is stored in local cache of the replication server, and a latest committed sequence number for data that was written to the persistent data storage by the replication server. A maximum value of latest committed sequence numbers received from the set of replication servers is determined. For each replication server, it is examined whether there is a gap between the start sequence number for data stored in local cache and the maximum value of the latest committed sequence numbers. Based on the examining, it is determined whether there is an occurrence of loss of data.
US09361347B2	Method, apparatus, and computer program product for determining data signatures in a dynamic distributed device network An apparatus for determining data signatures in a dynamic distributed device network may include a processor. The processor may be configured to receive a first query and generate a local partial closure of the data identified by the first query. The processor may be further configured to synthesize a data signature of the local partial closure. In this regard, the data signature may be an irreducible polynomial expression and the data signature may be orthogonal to remote data signatures generated from remote partial closures. Further, the processor may be configured to store the data signature in an information store within a dynamic distributed device network. Associated methods and computer program products may also be provided.
US09361346B2	Mapping information stored in a LDAP tree structure to a relational database structure A method for mapping an information directory such as a LDAP directory tree to a relational database structure. The method includes accessing an information directory, which has a number of data entries at nodes of its tree structure and each of these entries may include a number of attributes defined by one or more object classes. The method includes storing a distinguished name (DN2ID) index table including generating records the data entries that include a DN field containing the entry's attributes. The method includes forming a relational table associated with each of the object classes defined for the information directory, and the records of the relational tables may be linked to the records/entries of the DN2ID index table. The method may include determining an entry identifier for each of the entries of the directory and storing these in the records of the DN2ID index table and in the relational tables.
US09361333B2	Reducing lock occurrences in server/database systems Limiting the number of concurrent requests in a database system. Arranging requests to be handled by the database system in at least one queue. Defining a maximum value (SS) of concurrent requests corresponding to the at least one queue. Monitoring at least one queue utilization parameter corresponding to the at least one queue and calculating a performance value based on the at least one queue utilization parameter. Adapting the maximum value (SS) of concurrent requests of the at least one queue dynamically based on the performance value (PF) in order to improve system performance. Limiting the number of concurrent requests of the at least one queue dynamically based on the dynamically adapted maximum value (SS).
US09361332B2	Index record-level locking for file systems using a B+ tree structure In one embodiment, a process includes determining a data node for a data record to be inserted and/or updated in an index structure of a record-oriented file system. A lock on the corresponding data node is created, and the data record in the corresponding data node is stored and/or updated. However, when the corresponding data node does not have free space sufficient to store and/or update the data record, the corresponding data node is split sequentially into two data nodes. The new data record is stored in one of the two data nodes. The process continues by creating a lock on and updating a parent node in a sequence set which includes information about the corresponding data node and any parent index nodes above the parent index node which are affected by splitting the parent index node.
US09361327B1	Rolling bloom filter for data with retention policy A data structure comprising two or more sub data structures representing a given data set is maintained. Each of the two or more sub data structures comprises an array of bit positions and has a set of hash functions associated therewith. Each of the hash functions is operable to map an element of the given data set to at least one of the bit positions of the array. One of the two or more sub data structures is recognized as a master sub data structure and the others of the two or more sub data structures as slave sub data structures. Insertion and deletion of elements in the data structure is based on the recognition of each of the two or more sub data structures as the master sub data structure or one of the slave sub data structures.
US09361323B2	Declarative specification of data integration workflows for execution on parallel processing platforms A system for receiving a declarative specification including a plurality of stages. Each stage specifies an atomic operation, a data input to the atomic operation, and a data output from the atomic operation. The data input is characterized by a data type. Links between at least two of the stages are generated to create a data integration workflow. The data integration workflow is compiled to generate computer code for execution on a parallel processing platform. The computer code configured to perform at least one of data preparation and data analysis.
US09361321B1	Backend capacity report for de-duplicated storage systems One example method includes identifying a space that includes pointers that each point to a respective piece of data in the set of data, selecting a first pointer using a sub sample ratio, checking the first pointer to see if the first pointer points to data previously observed in an associated backup stream, if the first pointer points to data not previously observed in the associated backup stream, recording a number of data pieces to which the first pointer points, and if the first pointer points to data previously observed in the associated backup stream, selecting a second pointer using the sub sample ratio. The selecting, checking and recording processes are repeated until the entire space has been sampled, and the required storage capacity is calculated using the sub sample ratio and a sum of the recorded number of data pieces.
US09361313B2	System and method for filtering and organizing items based on common elements A system and method for filtering and organizing items from computer memories based on common elements is provided. Filters can be provided for manipulating the items, which serve as tools for narrowing down a set of items. The filters can be dynamically generated based on the properties of the separate items. The system can utilize virtual folders. The virtual folders can expose regular files and folders to users in different views based on their metadata instead of the actual physical underlying file system structure on the disk. Quick links can be provided, which serve as a set of predefined links (e.g., located on the left side of the display) that can be clicked on to generate useful views of the sets of items. Libraries, which can provide large groups of usable types of items that can be associated together, may also be used.
US09361307B2	Rejecting rows when scanning a collision chain that is associated with a page filter Provided are techniques for locating a row. A page filter in a page is stored, wherein the page filter is associated with a collision chain and includes a portion of a hash value of the row in the collision chain that has overflowed to an overflow area. In response to a request to locate a target row, the page filter is used to determine that the row has overflowed based on a portion of a hash value of the target row matching the portion of the hash value of the row that has overflowed.
US09361306B1	Managing concurrent write operations to a file system transaction log Systems and methods of managing concurrent log writes to a transaction log are provided. A system may include: a transaction log residing on a non-volatile storage medium for logging metadata transactions of a file system; and a plurality of transaction log buffers, associated with the transaction log, residing in volatile memory. A first write operation may be initiated to write first contents of at least a first of the plurality of transaction log buffers to the transaction log. Concurrently to a performance of the first write operation, a second write operation may be initiated to write second contents of at least a second of the plurality of transaction log buffers to the transaction log.
US09361305B2	Image forming apparatus having a file system An image forming apparatus includes a main storage unit; an auxiliary storage unit; a file system configured to manage a file stored in the auxiliary storage unit; and an input-output processing unit configured to use an area in the main storage unit to perform file access to a file in the file system. The area is in a storage area that is not managed by an operating system and the area is specified with a physical address in an instruction from a user process.
US09361302B1	Uniform logic replication for DDFS In one embodiment, the storage system determines if a first format of a first segment tree of the first file system is different from a second format of a second segment tree of the second file system representing a file stored in the first and second file systems, respectively. The storage system identifies, in response to determining that the first and second formats are different, a second level within the first and second segment trees that have different formats. In one embodiment, the storage system further identifies one or more segments of the second level of the first segment tree that have been modified based on a comparison of fingerprints of a third level of the segment trees. For each modified second level segment, the storage system resegments the segment from the first to the second format, and replicates the resegmented segments to the target storage system.
US09361298B2	Media content management System, computer implemented process and computer program product for managing media content among a plurality of devices which includes the exchange of device status data among two or more devices. The exchanged device status data includes individual device capabilities and indicia of available media content stored within each of the devices. Each device determines from the exchanged device status data whether any differences exist in available media content stored among the plurality of devices and also whether any of the determined differences in media content will require transcoding to compatible data formats. Once the determinations have been completed, synchronizing and optionally transcoding of the available media content is performed based on the determinations made from the exchanged device status data. Any required transcoding may be performed either before or after media content synchronizing.
US09361297B2	Web service-based, data binding abstraction method A method for providing a data binding abstraction. The method includes serving an interactive document via a digital data communications network using a server. The method includes generating, with intelligence in the document, a data binding request to resolve a data value placeholder that has no static data location or source reference. With a data binding web service, the method includes generating a data dictionary request that includes a placeholder identifier. The method includes using the data binding web service to process a data dictionary response which includes placeholder content for the placeholder to determine a source of the data value. The method includes the data binding web service accessing the determined data source to obtain the data value and providing the interactive document with a response including the placeholder identifier and the resolved placeholder data value. The interactive document then replaces the placeholders with the returned data value.
US09361294B2	Publishing tool for translating documents Some embodiments of a publishing tool to translate documents have been presented. In one embodiment, a master document written in a first natural language is received. The master document is repurposed to generate a set of output documents in one or more predetermined formats, wherein each of the output document is in a distinct one of a set of natural languages.
US09361287B1	Non-collaborative filters in a collaborative document Systems and methods for viewing filters on a collaborative spreadsheet stored on a cloud computing service include accessing, from each of a plurality of client computers, a first sheet of a spreadsheet stored on a cloud computing service, where a plurality of filters is associated with the first sheet. A first client computer in the plurality of client computers receives a command by a first user to apply a first filter in the plurality of filters to the first sheet, and applies the first filter to the first sheet on the first client computer. The filtered first sheet is displayed to the first user, and a second client computer in the plurality of client computers concurrently displays an unfiltered first sheet.
US09361271B2	Systems and methods to enable eco-driving Systems and methods for enabling eco-driving are herein provided. Systems and methods in accordance with the present disclosure allow for real-time monitoring of greenhouse gas emissions and other variables that influence the environmental friendliness of vehicle operation. Systems and methods in accordance with the present disclosure also provide analytical tools for quantifying the environmental friendliness of vehicle operation and driving patterns.
US09361267B2	Splitable and scalable normalizer for vector data A hardware circuit component configured to support vector operations in a scalar data path. The hardware circuit component configured to operate in a vector mode configuration and in a scalar mode configuration. The hardware circuit component configured to split the scalar mode configuration into a left half and a right half of the vector mode configuration. The hardware circuit component configured to perform one or more bit shifts over one or more stages of interconnected multiplexers in the vector mode configuration. The hardware circuit component configured to include duplicated coarse shift multiplexers at bit positions that receive data from both the left half and the right half of the vector mode configuration, resulting in one or more coarse shift multiplexers sharing the bit position.
US09361251B2	Interrupt signal accepting apparatus and computer apparatus managing operations of at least two operating systems An interrupt signal accepting apparatus manages two OSs, relates devices sharing the same interrupt number respectively with an OS caused to perform an interrupt processing and an interrupt priority unique to a device, and manages an interrupt number priority conversion table showing the relation between the interrupt number and the interrupt priority. Each device continuously outputs an interrupt request having the same interrupt number until the interrupt processing is completed. An interrupt controller converts the interrupt number into the interrupt priority in accordance with the interrupt number priority conversion table when there is an interrupt signal from the devices. An interrupt signal control section causes a running OS to perform the interrupt processing to change the interrupt priority in the interrupt number priority conversion table when the converted interrupt priority matches an interrupt priority related to the running OS, and stops the running OS and starts the other OS when the interrupt priorities do not match.
US09361249B2	Communication apparatus, communication system and adapter A communication apparatus for carrying out communications to and from an external apparatus that includes a first interconnecting unit and a first non-transparent port and effects an interconnection for communications via the first non-transparent port is provided. The communication apparatus includes a second interconnecting unit that includes a second non-transparent port communicably connected to the first non-transparent port. The second interconnecting unit effects an interconnection for communications via the second non-transparent port. The second interconnecting unit performs, when the communication apparatus carries out communications to and from the external apparatus, address translation between an address for use by the communication apparatus and an address for use by the second non-transparent port.
US09361247B1	Intrinsic barrier device with software configurable IO type An intrinsic barrier device, method and computer program product for isolating a communication channel of an input/output (IO) module from a field device. The intrinsic barrier device includes a front end having a programming input adapted to receive an analog input (AI), analog output (AO), digital input (DI) or digital output (DO) IO type configuration signal. The intrinsic barrier device also includes a processor to process the IO type configuration signal and an associated memory device storing an intrinsic barrier IO type configuration (IBTC) program. The processor is programmed to implement the IBTC program. The processor, responsive to the IO type configuration signal configures the intrinsic barrier device to operate as the AI, AO, DI or DO for supporting communications through the intrinsic barrier device over the communication channel between the IO module and the field device in the AI, AO, DI or DO.
US09361243B2	Method and system for providing restricted access to a storage medium A system, apparatus, method, or computer program product of restricting file access is disclosed wherein a set of file write access commands are determined from data stored within a storage medium. The set of file write access commands are for the entire storage medium. Any matching file write access command provided to the file system for that storage medium results in an error message. Other file write access commands are, however, passed onto a device driver for the storage medium and are implemented. In this way commands such as file delete and file overwrite can be disabled for an entire storage medium.
US09361235B2	Information processing apparatus, method of controlling the same and computer-readable storage medium A cache storage apparatus has an entry including a tag bit for managing an address in the memory of the data, the data, and a reference count for managing a number of times that the data is referenced. If it is possible to read in the data from the entry, in a case where the reference address is for a prefetch, a value of the reference count of the entry is increased, and in a case where the reference address is for a fetch, the value of the reference count of the entry is decreased. If it is not possible to read in the data from the entry, in a case where the reference address is for a prefetch, a replacement of prefetched data in the entry is prohibited until the value of the reference count of the entry becomes zero.
US09361232B2	Selectively reading data from cache and primary storage Techniques are provided for using an intermediate cache to provide some of the items involved in a scan operation, while other items involved in the scan operation are provided from primary storage. Techniques are also provided for determining whether to service an I/O request for an item with a copy of the item that resides in the intermediate cache based on factors such as a) an identity of the user for whom the I/O request was submitted, b) an identity of a service that submitted the I/O request, c) an indication of a consumer group to which the I/O request maps, or d) whether the intermediate cache is overloaded. Techniques are also provided for determining whether to store items in an intermediate cache in response to the items being retrieved, based on logical characteristics associated with the requests that retrieve the items.
US09361231B2	Implicit I/O send on cache operations A method for implicit input-output send on cache operations of a central processing unit is provided. The method comprises an aggregation queue of a central processing unit, storing input-output data of the central processing unit, wherein the aggregation queue transmits the input-output data to an input-output adaptor, and wherein the input-output data is transmitted in parallel with operations of the central processing unit. The method further comprises, a memory management unit of the central processing unit, interpreting address space descriptors for implicit input-output transmittal of the input-output data of the aggregation queue. The method further comprises, a cache traffic monitor of the central processing unit, transmitting the input-output data in an implicit input-output transmittal range between the cache traffic monitor and the aggregation queue, wherein the cache traffic monitor transmits cache protocol of the central processing unit to the memory management unit.
US09361230B2	Three channel cache-coherency socket protocol A system and method are disclosed for communicating coherency information between initiator and target agents on semiconductor chips. Sufficient information communication to support full coherency is performed through a socket interface using only three channels. Transaction requests are issued on one channel with responses given on a second. Intervention requests are issued on the same channel as transaction responses. Intervention responses are given on a third channel. Such an approach drastically reduces the complexity of cache coherent socket interfaces compared to conventional approaches. The net effect is faster logic, smaller silicon area, improved architecture performance, and a reduced probability of bugs by the designers of coherent initiators and targets.
US09361227B2	Systems and methods for faster read after write forwarding using a virtual address Methods for read after write forwarding using a virtual address are disclosed. A method includes determining when a virtual address has been remapped from corresponding to a first physical address to a second physical address and determining if all stores occupying a store queue before the remapping have been retired from the store queue. Loads that are younger than the stores that occupied the store queue before the remapping are prevented from being dispatched and executed until the stores that occupied the store queue before the remapping have left the store queue and become globally visible.
US09361223B1	Storage method and apparatus for random access memory using codeword storage A memory circuit, such as an embedded DRAM array, stores information as groups of bits or data using information coding in storage and retrieval data, instead of each bit being stored separately. Write data words can be mapped to storage format words that are stored and defined by a Hadamard matrix. The storage format word is stored as charge levels in an addressable memory location. For retrieving stored data, charge levels are read from the storage cells and interpreted to a valid storage format word. Hadamard code maximal likelihood decoding can be used to derive a read data word corresponding to a previously written write data word. The write data word is then output as the result of a read of the selected addressable location, or a portion thereof. The mapping can be two or more Hadamard matrix mappings concatenated for each of a plurality of storage format words.
US09361222B2	Electronic system with storage drive life estimation mechanism and method of operation thereof Systems, methods and/or devices are used to enable storage drive life estimation. In one aspect, the method includes (1) determining two or more age criteria of a storage drive, and (2) determining a drive age of the storage drive in accordance with the two or more age criteria of the storage drive.
US09361220B2	Apparatus and method of using dummy data while storing data at a multi-bit storage element A storage device includes non-volatile memory and a controller. A method performed in the data storage device includes receiving, at the controller, first data and second data to be stored at the non-volatile memory. The method further includes sending, from the controller, the first data, the second data, and dummy data to the non-volatile memory to be stored at respective logical pages of a single physical page in the non-volatile memory. The single physical page includes multiple storage elements that are programmable into multiple voltage states according to a mapping of bits to states. The dummy data prevents a storage element of the single physical page from being programmed to a particular voltage state of the multiple voltage states.
US09361212B2	Computation apparatus with coordination of the access to an internal memory and operating method A programmable logic controller (PLC) with changing memory access times is intended to interact with a subordinate system, i.e., a discontinuous virtualized system, wherein a computation apparatus is provided, in which the PLC is implemented and in which the system that is subordinate to the PLC with respect to an operation to access the memory access is implemented. A memory to which a component of the PLC has access is integrated in the PLC. Also implemented in the computation apparatus is a proxy device that coordinates access to the memory of the PLC by the subordinate system such that simultaneous access by the component of the PLC has priority over access by the subordinate system and it is thus possible to ensure that the PLC always complies with a predefined cycle time of the PLC.
US09361211B2	Automated generation of test cases for regression testing Systems, methods and computer program products for performing software regression testing are disclosed. The systems, methods and computer program products are configured to execute a test case against an application under test on a programmable digital computer, to obtain from the programmable digital computer an identity of a first code module invoked by the test case, to associate the test case identifier with the first code module, to identify a second code module that is related to the first code module, and to associate the test case identifier with the second code module.
US09361202B2	Filtering system noises in parallel computer systems during thread synchronization Various embodiments monitor system noise in a parallel computing system. In one embodiment, at least one set of system noise data is stored in a shared buffer during a first computation interval. The set of system noise data is detected during the first computation interval and is associated with at least one parallel thread in a plurality of parallel threads. Each thread in the plurality of parallel threads is a thread of a program. The set of system noise data is filtered during a second computation interval based on at least one filtering condition creating a filtered set of system noise data. The filtered set of system noise data is then stored.
US09361201B2	Memory system and memory controller According to one embodiment, a memory system includes a NAND-type flash memory and a memory controller. The memory controller includes a monitoring module and a determination module. The monitoring module acquires an elapsed time from the start of data erase of a first block in the NAND-type flash memory. The determination module determines whether the elapsed time has exceeded a reference time before completion of the data write in the first block.
US09361190B2	Recovery of a transaction after XA end Embodiments of the present invention disclose a method for recovery of a two-phase commit transaction. A computer transmits a first transaction identifier to a data store, wherein the first transaction identifier defines a two-phase commit transaction. The computer transmits a prepare command for the first transaction identifier to a first resource manager. The computer determines if a failure and restart occurred within a distributed data processing environment, wherein the failure and restart occurs after the first resource manager receives an end command, but prior to completing execution of the prepare command for the first transaction identifier. Responsive to determining the failure and restart did occur within the distributed data processing environment, the computer retrieves the first transaction identifier from the data store. The computer transmits a rollback command for the retrieved first transaction identifier to the first resource manager.
US09361189B2	Optimizing disaster recovery systems during takeover operations Exemplary method, system, and computer program product embodiments for optimizing disaster recovery systems during takeover operations are provided. In one embodiment, by way of example only, a flag is set in a replication grid manager to identify replication grid members to consult in a reconciliation process for resolving intersecting and non-intersecting data amongst the disaster recovery systems for a takeover operation. Additional system and computer program product embodiments are disclosed and provide related advantages.
US09361186B1	Interfacing with a virtual database system User interactions with a database storage system allow creation of virtual databases based on point-in-time copies associated with a source database. Multiple point-in-time copies are obtained for each source database. A point-in-time copy retrieves data changed in the source database since the retrieval of a previous point-in-time copy. A virtual database (VDB) is created by creating a set of files in the data storage system and mounting the files on a database server allowing the database server to access the files. User interactions allow the user to specify the source database, a point in time associated with the source database and a destination server to create the virtual database. User input can specify other attributes associated with the virtual database including the file paths, database parameters etc. The user can specify schedules of various actions, including making and retention of point-in-time copies.
US09361184B2	Selecting during a system shutdown procedure, a restart incident checkpoint of an incident analyzer in a distributed processing system Methods, apparatuses, and computer program products for selecting during a system shutdown procedure, a restart incident checkpoint of an incident analyzer in a distributed processing system. Embodiments include the incident analyzer determining whether at least one incident is in a queue. If at least one incident is in the queue, the incident analyzer selects as the restart incident checkpoint, a last incident completed checkpoint. If at least one incident is not in the queue, the incident analyzer determines whether the last incident completed checkpoint matches a last incident analysis pool selection checkpoint. If the last incident completed checkpoint matches a last incident analysis pool selection checkpoint, the incident analyzer selects as the restart incident checkpoint, a monitor checkpoint. If the last incident completed checkpoint does not match the last incident analysis pool selection checkpoint, the incident analyzer selects as the restart incident checkpoint, the last incident completed checkpoint.
US09361175B1	Dynamic detection of resource management anomalies in a processing system According to an aspect, dynamic detection of resource management anomalies in a processing system includes collecting data from a plurality of on-line data sources on the processing system. The collected data includes performance data and power consumption data. Anomalous operation of a resource manager of the processing system is identified based on the collected data from the on-line data sources. The identification of the anomalous operation is conducted absent a baseline of reference performance data. A corresponding palliative action is initiated based on identifying the anomalous operation.
US09361171B2	Systems and methods for storage of data in a virtual storage device In accordance with the concepts described herein, a system for providing data storage includes at least one virtual server comprising at least one virtual storage device; at least one physical server comprising at least one physical storage device; a data structure, stored on each of the at least one physical storage devices, the data structure comprising: at least one table of contents, the table of contents configured to map storage locations within the virtual storage device to node structures that provide pointers to corresponding storage locations within the physical storage device; a tree structure having a predetermined number of hierarchical levels, each level containing node structures, the node structures containing pointers that point to other node structures or to data locations on the physical storage device; and one or more core software modules executed by one or more virtual machines, one or more physical machines or both and configured to receive requests to access data in the storage locations within the virtual storage device and, in response to the requests, traverse the data structure to access data in the corresponding storage locations within the physical storage device.
US09361168B1	Accessing resources across a network boundary Remote computing resource service providers, including online retailers, provide externally facing computer systems that allow users to interact with the service provider. Furthermore, the service provider may maintain computer systems and services inside an isolated network not exposed to users. Occasionally, service providers may test these externally facing computer systems using one or more external hosts operating on a public network. As a result side effects may occur within the isolated network that is not accessible from the public network. The side effects may be recorded in a queue which may be accessed from inside the isolated network by one or more services. The one or more services may then reverse the side effects based at least in part on information contained in the queue.
US09361166B2	Extensible data interface for shared service module A method and associated system for interfacing between a caller application and a service module. Upon receiving a request for performing a transaction that includes at least one caller application attribute describing the request, the service module builds a service module data structure pursuant to the received request. The service module data structure includes a generic service document and at least one service module attribute. Each service module attribute is stored in a relational table of the service module data structure. The request is serviced within the service module data structure, resulting in instantiating the generic service document. The generic service document is returned to the caller application. Building each service module attribute includes: constructing the generic service document and creating at least one container in the generic service document. Each container is respectively associated with each service module attribute in each mapping of at least one mapping.
US09361165B2	Automated merger of logically associated messages in a message queue Embodiments of the invention provide a method, system and computer program product for message merging in a messaging queue. In an embodiment of the invention, a method for message merging in a messaging queue can be provided. The method can include receiving a request to add a new message to a message queue in a message queue manager executing in memory by a processor of a host computing platform. The method can also include a merge indicator to stipulate whether or not a merge should take place. The method also can include identifying an association key associating the new message with an existing message in the message queue and locating an associated message in the message queue corresponding to the identified association key. Finally, the method can include merging the new message with the located associated message in the message queue.
US09361161B2	Workload routing for managing energy in a data center Approaches that manage energy in a data center are provided. In one embodiment, there is an energy management tool, including an analysis component configured to determine a current energy profile of each of a plurality of systems within the data center, the current energy profile comprising an overall rating expressed as an integer value, the overall rating calculated based on a current workload usage and environmental conditions surrounding each of the plurality of systems; and a priority component configured to prioritize a routing of a workload to a set of systems from the plurality of systems within the data center having the least amount of energy present based on a comparison of the overall ratings for each of the plurality of systems within the data center.
US09361159B2	Runtime chargeback in a simultaneous multithreading (SMT) environment A technique for chargeback with simultaneous multithreading (SMT) by a computer is provided. One or more of an operating system and a second-level hypervisor of the computer manage a logical core configuration for simultaneous multithreading, the operating system and/or the second-level hypervisor has control over a logical core and control over logical threads on the logical core. The operating system and/or the second-level hypervisor is configures a host hypervisor to assign an entirety of the logical core to a single physical core, such that one logical core executes per physical core. The logical core is run on the single physical core on an exclusive basis for a period of time, such that the logical threads of the logical core execute on physical threads of the single physical core. A capacity use time is determined for each of the logical threads executing on the physical threads of the single physical core.
US09361155B2	Time critical tasks scheduling A method and system for scheduling a time critical task. The system may include a processing unit, a hardware assist scheduler, and a memory coupled to both the processing unit and the hardware assist scheduler. The method may include receiving timing information for executing the time critical task, the time critical task executing program instructions via a thread on a core of a processing unit and scheduling the time critical task based on the received timing information. The method may further include programming a lateness timer, waiting for a wakeup time to obtain and notifying the processing unit of the scheduling. Additionally, the method may include executing, on the core of the processing unit, the time critical task in accordance with the scheduling, monitoring the lateness timer, and asserting a thread execution interrupt in response to the lateness timer expiring, thereby suspending execution of the time critical task.
US09361153B2	Management system and control program for management system Provided is a management system, comprising an interface, a processor and a storage device, wherein the interface has coupled thereto at least one maintenance target machine to be a target of a maintenance operation, which is identified by one piece of identification information, and wherein the management system is configured to: store information indicating a scheduled start time and scheduled finish time of the maintenance operation; determine, based on the scheduled start time, the scheduled finish time, and a login and logout for the maintenance operation on the at least one maintenance target machine detected by the management system, whether or not the maintenance operation is in execution on the at least one maintenance target machine; and determine, based on a result of the determination, whether or not to execute predetermined processing associated with an event transmitted from the at least one maintenance target machine.
US09361146B2	Predictive fetching and decoding for selected return instructions Predictive fetching and decoding for selected instructions. A determination is made as to whether an instruction to be executed in a pipelined processor is a selected return instruction, the pipelined processor having a plurality of stages including an execute stage. Based on the instruction being the selected return instruction, obtaining from a data structure a predicted return address, the predicted return address being an address of an instruction to which it is predicted that processing is to be returned. Additionally, based on the instruction being the selected return instruction, operating state for the instruction at the predicted return address is predicted. The instruction is fetched at the predicted return address, prior to the selected return instruction reaching the execute stage, and decoding of the fetched instruction is initiated based on the predicted operating state.
US09361144B2	Predictive fetching and decoding for selected return instructions Predictive fetching and decoding for selected instructions. A determination is made as to whether an instruction to be executed in a pipelined processor is a selected return instruction, the pipelined processor having a plurality of stages including an execute stage. Based on the instruction being the selected return instruction, obtaining from a data structure a predicted return address, the predicted return address being an address of an instruction to which it is predicted that processing is to be returned. Additionally, based on the instruction being the selected return instruction, operating state for the instruction at the predicted return address is predicted. The instruction is fetched at the predicted return address, prior to the selected return instruction reaching the execute stage, and decoding of the fetched instruction is initiated based on the predicted operating state.
US09361141B2	Systems and methods for controlling, by a hypervisor, access to physical resources A system for controlling, by a hypervisor, access to physical resources during execution of a virtual machine includes a physical disk and a hypervisor. The physical disk is provided by a computing device and stores at least a portion of a virtual disk. The hypervisor executes on the computing device. The hypervisor allocates, to the virtual disk, an amount of access to the physical disk. The hypervisor determines that a level of utilization of the physical disk has exceeded a threshold. The hypervisor limits, in response to the determination, access by the virtual disk to the physical disk.
US09361139B1	System and method for visualizing virtual system components A method includes receiving status information regarding a plurality of virtual system components. Each of the virtual system components is associated with a respective virtual component category. The method also includes determining a hierarchy of the virtual component categories. The hierarchy includes a plurality of levels, each associated with a respective one of the virtual component categories. The method further includes determining a cluster threshold that defines a maximum number of the virtual system components having equivalent virtual component categories to be associated with a single node of a topology. The method still further includes determining that a subset of the virtual system components having equivalent ones of the virtual component categories exceed the cluster threshold, and generating the topology based upon the hierarchy and the cluster threshold. The method even further includes representing the subset of the virtual system components using a shared node of the topology.
US09361133B2	Management screen for image processing apparatus and method thereof An information processing apparatus configured to display a management screen, used for managing a connected peripheral device, based on control information described with respect to a function that can be instruct d from the management screen includes a storing unit, and a registration unit. The registration unit may register in the storing unit a type of language displayed on a screen provided by software that runs on the information processing apparatus. A display about the software is performed on the management screen based on the type of language registered by the registration unit and the control information.
US09361132B2	System and method for providing application-based user interface features on a computing device A system and method for operating a mobile computing device is disclosed. Each of a plurality of applications that are stored or installed in the mobile computing device is associated with a corresponding design scheme. A user interface feature is displayed on the display of the mobile computing device. The user interface feature is present independent of the operation of the plurality of applications. A change in the state of an application is detected and the appearance of the user interface feature is affected based on the design scheme associated with the application that is changed in state.
US09361128B2	Fast computer startup Fast computer startup is provided by, upon receipt of a shutdown command, recording state information representing a target state. In this target state, the computing device may have closed all user sessions, such that no user state information is included in the target state. However, the operating system may still be executing. In response to a command to startup the computer, this target state may be quickly reestablished from the recorded target state information. Portions of a startup sequence may be performed to complete the startup process, including establishing user state. To protect user expectations despite changes in response to a shutdown command, creation and use of the file holding the recorded state information may be conditional on dynamically determined events. Also, user and programmatic interfaces may provide options to override creation or use of the recorded state information.
US09361126B1	Device driver aggregation in operating system deployment A tool for managing device driver aggregation during operating system deployment. The tool receives, by a first computer processor, a request for a device bundle, the request including a unique identifier. The tool determines, by the first computer processor, whether an available driver bundle matches the requested device bundle based, at least in part, on the unique identifier. Responsive to determining an available driver bundle does not match a requested device bundle, the tool creates, by the first computer processor, an associated driver bundle for the requested device bundle.
US09361124B2	Computer system and startup method A computer system comprising a plurality of computers on which a plurality of operating systems run, wherein a memory stores a first hardware control unit, wherein a storage device stores a first OS image, a second OS image, a second hardware control unit for executing start processing of the second OS, and an address rewrite unit, wherein the second hardware control unit includes a start unit for starting the second hardware control unit, wherein the address rewrite unit which is started by the first OS is configured to: obtain an address of a storage area, in which address data to be rewritten is stored, as a target address, rewrite the address data stored in the storage area corresponding to the obtained target address and start the start unit, wherein the start unit is configured to start the second hardware control unit by using the rewritten address data.
US09361120B2	Pluggable cloud enablement boot device and method that determines hardware resources via firmware A pluggable cloud enablement boot device (PCEBD) is a bootable device that includes all information needed to automatically provision hardware and software to create a computing solution that meets customer requirements. This allows for quickly deploying a computing solution in a manner that eliminates many manual steps that are typically performed today. The PCEBD uses firmware to verify a given platform has sufficient resources to deploy the PCEBD. The computing solution, once provisioned and running, can be modified, and these modifications may be reflected in the definition of the PCEBD. In addition, a computing solution may include multiple resources provisioned from multiple PCEBDs, which can be packaged into a PCEBD that will include other PCEBDs. The result is a way to deploy computing solutions that is much more efficient than the manual methods used in the prior art.
US09361119B1	Active code component identification and manipulation for preprocessor variants The present application is generally directed to mediums, methods, and systems for identifying and manipulating active code components. In exemplary embodiments, a user control interface is provided for displaying a source design which includes instructions in a preprocessor language and instructions in a source language. A resolvable preprocessor condition may be identified along with an instruction in the source language that is associated with the resolvable condition. The resolvable condition and the associated condition may be displayed, and the associated condition may be graphically indicated as controllable by the resolvable condition. A user may supply an input that provides a value for the resolvable condition. In some embodiments, instructions in the source language are displayed and, upon selection of one or more source language instructions by a user, a preprocessor condition that is associated with the selected source language instructions may be displayed.
US09361117B2	Tag-based implementations enabling high speed data capture and transparent pre-fetch from a NOR flash Embodiments disclosed herein generally relate for efficiently retrieving boot code for a processor from serial NOR flash memory. When a boot code request is received, a request handler in data capture logic tags successive address read requests to indicate whether the requests indicate contiguous addresses in the NOR flash memory for the boot code. Different circuitry in the data capture logic operates on different mesochronous clock signals. One clock signal drives the capture of boot code from NOR flash, and the other controls synchronized tagging, storing, pre-fetching, and transmitting of the captured boot code data.
US09361102B2	Methods for enforcing control flow of a computer program One aspect of the invention provides a method of controlling execution of a computer program. The method comprises the following runtime steps: parsing code to identify one or more indirect branches; creating a branch ID data structure that maps an indirect branch location to a branch ID, which is the indirect branch's equivalence class ID; creating a target ID data structure that maps a code address to a target ID, which is an equivalence class ID to which the address belongs; and prior to execution of an indirect branch including a return instruction located at an address: obtaining the branch ID associated with the return address from the branch ID data structure; obtaining the target ID associated with an actual return address for the indirect branch from the target ID data structure; and comparing the branch ID and the target ID.
US09361096B1	Linking code and non-code in a programming environment A device may receive information that identifies code included in a document provided via a programming environment. The code may include executable program code capable of being executed via the programming environment. The device may receive information that identifies non-code included in the document. The non-code may include information other than executable program code. The device may receive an indication to link a code portion, included in the code, and a non-code portion, included in the non-code, and may create a link between the code portion and the non-code portion based on receiving the indication. The device may provide, via a user interface, content included in the document. The content may include the code portion, the non-code portion, and other information included in the document. The device may provide, via the user interface, a link indicator that identifies the link between the code portion and the non-code portion.
US09361089B2	Secure patch updates of a virtual machine image in a virtualization data processing system Virtual Machine (VM) images in a virtualized environment are updated through the use of patches. A virtualization data processing system includes a hypervisor that manages a VM image. The hypervisor is configured to retrieve a patch for an instance of the VM image from a secure site. The hypervisor blocks all other network access to the VM image. The hypervisor is configured to apply the patch to the instance of the VM image and unblock all network access to the VM image
US09361071B2	Implicit parameters and implicit arguments in programming languages An embodiment of the present invention consists of methods for parameter declaration in implicit way and of methods for argument usage in implicit way. An embodiment of the present invention is useful in programming languages which support at least one concept that can be interpreted as a method. This invention: raises code readability; reduces redundancy of parameter name and parameter type information making specific parts of the programming language code more compact; allows reduction of global variables making code more parallelizable and suitable for parallel computing systems.
US09361063B2	Function execution instruction system, function execution instruction method, and function execution instruction program To appropriately execute a function based on a plurality of words, a function-execution instruction server of a function-execution instruction system includes: a function-execution instruction unit that issues an instruction of the execution of one or more tasks; a word input unit that inputs information containing a plurality of words that are arranged in order; and an executed-function determination unit that determines a task the execution of which is instructed on the basis of the order of words input.
US09361055B2	Information processing apparatus managing a number of printed pages An information processing apparatus that communicates with a first printing device and a second printing device that manages a number of printed pages in color in different color levels and a number of printed pages in black and white. The information processing apparatus includes a managing unit configured to manage a number of printed pages in black and white and a number of printed pages classified into each level in the plurality of color levels; a first acquiring unit configured to acquire status information and first log information relating to the first job; a second acquiring unit configured to acquire second log information relating to a second job; and an adjusting unit configured to adjust the number of printed pages relating to the first job based on the status information and the first log information.
US09361051B2	Image forming apparatus that transmits and receives maintenance work data to and from information processing apparatus, method of controlling the same, and storage medium An information processing apparatus without bothering a user, even when it is necessary to disconnect and restart the image forming apparatus which has been connected to the information processing apparatus so as to transmit and receive maintenance work data for performing the maintenance work on the image forming apparatus. When the image forming apparatus is required to be disconnected and reconnected after restarting the image forming apparatus during connection with the information processing apparatus, identification information for identifying an information processing apparatus to be reconnected is stored in a storage section. The image forming apparatus is reconnected to the information processing apparatus identified by the identification information stored in the storage section after the image forming apparatus is restarted.
US09361039B2	Method, related apparatus, and system for virtual network migration A method, related apparatus, and system for virtual network migration are provided. A method provided by an embodiment of the present disclosure includes: locating a source physical node in a regional physical network; obtaining information of a virtual element corresponding to each virtual network on the source physical node and state information of each physical node in the regional physical network; determining, according to information of the virtual elements and the state information, a physical node that can execute virtual network migration in the regional physical network; reconstructing a mapping relationship between each virtual network and the regional physical network on the physical node; comparing the mapping relationships of each virtual network; selecting a mapping relationship with minimum migration consumption as a mapping relationship for executing migration; and sending, according to the mapping relationship for executing migration, a migration instruction to a physical node to execute virtual network migration.
US09361035B1	Performing copies in a storage system A system and method for performing copy offload operations. When a copy offload operation from a first volume (pointing to a first medium) to a second volume (pointing to a second medium) is requested, the copy offload operation is performed without accessing the data being copied. A third medium is created, and the first medium is recorded as the underlying medium of the third medium. The first volume is re-pointed to the third medium. Also, a fourth medium is created, the second volume is re-pointed to the fourth medium, and the second medium is recorded as the underlying medium of the targeted range of the fourth medium. All other ranges of the fourth medium have the second medium as their underlying medium.
US09361022B2	Character input apparatus A plurality of characters that are candidates for entry are displayed on a display surface of a display corresponding to an operation surface of a touch panel as character buttons. A touch detector judges whether a user touches the operation surface either with a single point or plural points, and detects a position touched by the user. An input receiver receives an entry of a character associated with a character button in the position touched by the user among the plurality of characters displayed on the display surface of the display. Then, the input receiver receives the entry of the character which varies in type depending on whether the user touches an area in the operation surface corresponding to an identical character button with a single point or plural points.
US09361010B2	Imaging device, image processing method, and program thereof An imaging device includes a display unit for displaying a video image being captured, an index operating unit for inputting an instruction for an index, and an index setting unit for setting as an index section, a section in the video image captured for a predetermined time period including a time point of a user's operation of inputting the instruction for the index, in response to one user's operation on the index operating unit while the video image is captured.
US09361003B2	Overlay maps for navigation of intraoral images Methods and systems for viewing images. One system includes a source of images, a computer, and a screen. The computer includes a processor and a user interface module configured to generate a graphical user interface or GUI. The GUI includes a first window in which one or more of the images are displayed. The GUI is displayed on the screen and the graphical user interface module generates an output or modifies the GUI in response to user input (e.g., tap, click, etc.). In response to the input, the graphical user interface generates an image-navigation map. The image-navigation map is displayed in a foreground of the first window and the one or more images are in displayed in a background of the first window. The image-navigation map includes one or more thumbnail images of at least one of the one or more images.
US09360999B2	Method and apparatus for presenting media content A method that incorporates teachings of the present disclosure may include, for example, receiving a selection from a media device corresponding to a first media content, generating a play list at a server where the play list includes second media content that is associated with the first media content by at least one of genre, artist and being published in temporal proximity, and providing play list content comprising at least a portion of the first and second media content to the media device, where at least one of the generation of the play list and the providing of the play list content is based on metadata pointers associated with the first and second media content. Other embodiments are disclosed.
US09360996B2	Intelligently enabled menu choices based on online presence state in address book A computer implemented method for intelligently enabling menu choices includes rendering, on a client system, an address book user interface comprising information related to one or more contacts, selecting a contact from the address book user interface, determining an online presence state for the selected contact, enabling one or more menu options based upon the determined online presence state, with the menu options enabled for a first online presence state differing from the menu options enabled for a second online presence state, and presenting the enabled menu options to a user in a user interface.
US09360994B2	Partial-height panes as a method for optimizing palette layout and screen real estate usage A tool panel docking application is described that manages the docking of tool panels and palettes on an edge of an IDE workspace. As the user selects to dock various tool panels, the IDE monitors the positioning of each panel so as not to overlap the content of any of the individual panels making up the combined docked palettes and that allow the user to select how much of the underlying workspace is obscured by the combined docked palettes.
US09360990B1	Location-based applications In some embodiments, a technique for providing location-based functionality comprises providing functionality, wherein the functionality uses information provided by a location-aware device.
US09360988B2	Browsing and quality of service features Embodiments are configured to provide browsing and other functionality that can be used to provide viewable data based in part on a current viewable space of a browser interface, but the embodiments are not so limited. In an embodiment, components of a system can operate to communicate viewable data to a browser engine based in part on a configuration of the browser engine and/or a display architecture. In one embodiment, a computing device includes a browser application that can be used to provide data associated with viewable portions of a browser display, wherein the provided data can be used to monetize advertising revenue according to monetization and/or advertising requirements.
US09360987B2	Browser supporting multiple users A client machine initiates a browser instance of a browser. The client machine selects a first user identifying state for the browser instance prior to accessing any web pages by the browser instance, wherein the first user identifying state is associated with a first data structure set that comprises a first browser history, a first browser cache and/or a first cookie that are stored at the client machine. The client machine uses the first user identifying state in a session between the browser instance and a server. The client machine updates one or more of the first browser history, the first browser cache or the first cookie of the first data structure set based on the session without updating a second data structure set associated with a second user identifying state.
US09360986B2	Mode-switching in ultra mobile devices Arrangements for managing displays of ultra-mobile devices (UMD's). Automatically or manually, a small-mode interface on a UMD screen, wherein one application window is visible, is switched to a large-mode interface.
US09360985B2	Method and system for automatically linking a cursor to a hotspot in a hypervideo stream Automatically linking a cursor to a hotspot in a hypervideo stream comprising a plurality of video frames that are associated with at least one selectable hotspot include receiving a hypervideo stream of a first video frame associated with a selectable hotspot in a first activiation region of the first video frame, and determining whether a first position of a cursor is substantially within the first activiation region corresponding to the selectable hotspot. The cursor is associated with the selectable hotspot when the first position of the cursor is substantially within the first activiation region corresponding to the selectable hotspot in the first video frame. The hypervideo stream of a second video frame associated with the selectable hotspot in a second activation region different from the first activation region is received, and the cursor is automatically moved to a second position in the second video frame based on the association.
US09360974B2	Touch panel and method of manufacturing the same Disclosed are a touch panel and a method of manufacturing the same. The touch panel includes a substrate on which an active area and an inactive area surrounding the active area are defined; a first printing layer on the inactive area; a transparent electrode provided on the substrate to sense a position; and a second printing layer spaced apart from the substrate. A method of manufacturing a touch panel includes preparing a substrate on which an active area and an inactive area surrounding the active area are defined; printing a first printing layer on the inactive area of the substrate; preparing a transparent electrode provided on the substrate and on which the second printing layer is formed to sense a position; and bonding the transparent electrode with the substrate.
US09360963B2	Portable terminal and operation inhibition area control method A mobile phone 10 comprises a display 14 that is provided on a case 12 so as to be rendered as a narrow frame, a touch panel 16 that is provided on the display 14, etc. An operation inhibition area (80a, 80b) is set to the left side and the right side of a touch effective area of the touch panel 16, respectively. If the operation inhibition area is touched in a state where an arbitrary function is being executed, for example, the operation inhibition area and a cancellation icon (82) are displayed on the display 14. If a temporary cancellation operation is performed at this time, the operation inhibition area is temporarily canceled.
US09360947B2	Input device with swing operation An input device includes a printed circuit board for outputting a signal, a supporting base fixed on the printed circuit board, and a cap pivoted to the supporting base. A protrusion is formed on an end of the cap for contacting against the printed circuit board when the cap is not pressed down. The cap pivots relative to the supporting base when the cap is pressed down. The input device further includes a resilient conductive component disposed between the printed circuit board and the cap for being pressed by the cap to conduct the printed circuit board when the cap is pressed down.
US09360944B2	System and method for enhanced gesture-based interaction Described herein is a wireless remote control device (100) which can be used on the hand (150) of a user to provide both hardware-based control signals which can be associated with gesture-based control signals for enhanced gesture recognition systems. The device (100) comprises a housing (110) having a sensing unit having at least one control button (120, 130, 140) which is capable of generating a control signal for an associated computerized system. A computerized system utilizes information obtained from the control device (100) together with information obtained from a gesture recognition system to resolve any ambiguities due to, for example, occlusion of the hand performing the gesture or the hand being outside the field of view of an imaging system associated with the computerized system, and to trigger interactions within the gesture based interaction system.
US09360937B2	Handheld devices using tactile feedback to deliver silent status information Handheld weapons using tactile feedback to deliver silent status information are described. One embodiment comprises a handheld weapon comprising: a housing comprising a user contactable region, a tactile element coupled to the user contactable region, and an actuator coupled to the tactile element and capable of outputting a haptic sensation localized to the tactile element.
US09360936B2	Head mounted display apparatus A head mounted display (HMD) apparatus is disclosed. The HMD apparatus comprises a pico projector, a lens, a half reflective film, an application processor, and an eyeglass frame. The half reflective film covers the lens. The application processor controls the pico projector to project a virtual image beam to the half reflective film. The eyeglass frame carries the pico projector, the lens, and the application processor.
US09360927B2	Power efficient processor architecture In one embodiment, the present invention includes a method for receiving an interrupt from an accelerator, sending a resume signal directly to a small core responsive to the interrupt and providing a subset of an execution state of the large core to the first small core, and determining whether the small core can handle a request associated with the interrupt, and performing an operation corresponding to the request in the small core if the determination is in the affirmative, and otherwise providing the large core execution state and the resume signal to the large core. Other embodiments are described and claimed.
US09360917B2	Report updated threshold level based on parameter Example embodiments disclosed herein relate to reporting a first updated threshold level related to a battery. A parameter related to power to be drawn by the computing device for the first OS to enter a hibernate state is monitored. The first updated threshold level are set based on the parameter. The first updated threshold level is reported to the first OS. The first OS is to vary the first battery level threshold based on the first updated threshold level.
US09360915B1	Dynamically controlling clocking rate of a processor based on user defined rule Systems, methods, and other embodiments associated with controlling a clocking rate of a processor clock are described. According to one embodiment, an apparatus includes a register, a selector, and a clock gate. The register stores a set of bits arranged in a clocking pattern. In response to receiving an edge of a first clock signal, the selector selects a bit of the set of bits in the register. With each edge of the first clock signal, the selector selects a next bit in the clocking pattern. The clock gate implements a conjunction of the selected bit and the edge. The clock gate then outputs the conjunction of the selected bit and the edge as a second clock signal.
US09360912B2	Shutdown processing mode with forcible power off An information processing apparatus includes a selection unit configured to select a mode of processing to be executed when a power supply state of the information processing apparatus is shifted from a first power supply state to a second power supply state, a determination unit configured to determine time necessary for executing the processing based on the mode selected by the selection unit, an execution unit configured to execute the processing in the mode selected by the selection unit, and a control unit configured to control the execution unit to execute the processing again when the processing has not been completed within the time determined by the determination unit.
US09360906B2	Power management for multiple compute units An interface couples a plurality of compute units to a power management controller. The interface conveys a power report for the plurality of compute units to the power management controller. The power management controller receives the power report, determines a power action for the plurality of compute units based at least in part on the power report, and transmits a message specifying the power action through the interface. The power action is performed.
US09360903B2	System for controlling electric power supply to devices A system for controlling an electric power supply to devices is provided. The system includes a plurality of power supply sources, devices operated by an electric power, and a control part that determines the power supply source to be used for supplying the electric power to the devices. Further, the control part controls the amount of electric power to be supplied to the devices by the determined power supply source.
US09360895B2	Assembly and method for display device mounting An assembly for mounting a display device in a vehicle. The assembly includes a mounting plate having opposite edges, a front surface extending therebetween, and a rear surface opposite the front surface. The mounting plate is mountable to the vehicle with the front surface of the mounting plate facing outward. The assembly includes a first locking mechanism disposed proximate one edge of the mounting plate and a second locking mechanism disposed proximate the other edge. Each locking mechanism includes a jaw extending over the front surface of the mounting plate and pivotable between closed and open positions. Each jaw includes a resiliently deformable biasing member connected to the jaw and biasing the jaw towards the closed position. The assembly includes an electrical connector attached to the mounting plate. The electrical connector has an opening for mating with another connector.
US09360894B1	Water-resistant electronic device and water resistant key module A water-resistant electronic device includes a casing, a key body, a first circuit board and an elastomer. The casing has an opening and a recess communicating with the opening. The key body is disposed in the opening. The first circuit board has a switch. The elastomer envelops the first circuit board and is embedded with interference fit in the recess to achieve a water-resistant effect. The key body is pressed to trigger the switch. Besides, a water-resistant key module is suitable for the water-resistant electronic device and includes the key body, the first circuit board and the elastomer above.
US09360891B1	Recessed USB port A computer housing comprises a recessed Universal Serial Bus (USB) slot located along a top surface of a computer adjacent to the keyboard portion. The USB slot is recessed into the computer in order to allow a user to attach a USB mass storage device below a top surface portion in a secure position, thereby avoiding damage to the mass storage device if accidentally impacted while connected.
US09360886B2	Case assembly A case assembly of an electronic device includes a first outer case and an inner case. The first outer case includes a holding groove and a holding plate for forming the holding groove. The holding plate includes a touching surface and a pressing surface that are opposite to each other, and the touching surface forms a part of the holding groove. The inner case is disposed on one side of the first outer case. The inner case includes a surface and at least one supporting component protruding from the surface. The at least one supporting component abuts against the pressing surface, and the inner case and the at least one supporting component are integrated together.
US09360879B2	Sense current generation apparatus and method A sense current generation apparatus constituted of: a main electronically controlled switch arranged to provide a current path for an input current; a sense electronically controlled switch arranged to generate a sense current; a voltage matching circuit arranged to adjust the voltage across the first and second terminals of the sense switch to equal the voltage across the first and second terminals of the main switch, within a predetermined maximum error voltage, such that the sense current is representative of the input current; and a voltage governor arranged to: receive an indication of the voltage across the first and second terminals of the main switch; and responsive to the received voltage indication, adjust the control voltage of the main switch such that the absolute value of the voltage across the terminals thereof is maintained above a predetermined voltage threshold greater than a boundary of the error range.
US09360872B2	Fuel tank vent valve assembly and method of assembly A vent valve assembly includes a first housing component, a second housing component, and a third housing component, as well as a first valve and a second valve. The first, second, and third housing components are configured to assemble together along one directional axis with the second housing component, the first valve and the second valve between the first and third housing components and with the second valve laterally-spaced from the first valve. A vapor flow path directs vapor from the first valve to the second valve, thereby reducing an overall height of the vent valve assembly.
US09360865B2	Transitioning from autonomous vehicle control to driver control Data is obtained concerning at least one attribute of a vehicle operator. The attribute is used to determine an instruction for positioning a vehicle component during autonomous operation of the vehicle. Autonomous operation of the vehicle, including positioning the vehicle component according to the instruction, is performed.
US09360862B2	PLC network extension system Provided is a PLC network extension system, the system including a basic base generating a control data for controlling a plurality of extension bases, generating a network frame using the control data, and transmitting the network frame to one extension base in the plurality of extension bases via a network cable, and the plurality of extension bases extracting a control data from the received network frame to control a pre-installed module based on the control data.
US09360852B2	Wireless network machine control or a hydraulic system A machine control system, comprises at least first and second nodes of a wireless network in communication with each other, each node including a three axis accelerometer having a data output coupled to a respective sensor input of the node; and a hydraulic machine having a manifold and a plurality of hydraulic mechanisms coupled to respective outputs of the manifold, the manifold being responsive to electrical actuating signals provided from respective electrical outputs of the first node.
US09360849B2	Numerical control method In this numerical control method that drives the feed shaft of a machine tool (10) by means of a servo control unit (52), a transmission function is determined by modeling the operation of the servo control unit (52) of the feed shaft, the closed loop transmission function (GBP) of the position loop and/or the closed loop transmission function of the velocity loop of the servo control unit (52) of the machine tool is measured using the frequency response of the feed shaft, the control subject (PP) of the position loop and/or the control subject of the velocity loop is determined using the measured closed loop transmission function, the position loop modeling error (ΔPP) and/or the velocity loop modeling error is determined from the control subject, and at least one control parameter of the servo control unit (52) is calculated using the closed loop transmission function and/or the modeling error. As a result, the optimum plurality of control parameters corresponding to the state of the feed shaft is determined easily and automatically.
US09360831B2	Developing unit, process cartridge and image forming apparatus A developing unit includes: a frame; a flexible container, provided inside the frame, for accommodating a developer, wherein the flexible container includes an opening for permitting discharge of the developer; an urging member, provided inside the frame, for urging the flexible container to deform the flexible container; and a developer carrying member for carrying the developer discharged from the opening of the flexible container. The flexible container includes a projected portion projecting toward an outside of the flexible container. The projected portion is moved depending on deformation of the flexible container, by urging of the flexible container, to stir the developer discharged from the opening.
US09360830B1	Image forming apparatus having a support unit to move a light element of the image forming apparatus An image forming apparatus includes a light emitting element unit disposed at an operating position closely opposed to a photoconductor in a printing operation and having a light emitting element that forms an image on the photoconductor, a support unit mounted in the image forming apparatus to support the light emitting element unit, and an elastic member disposed between the light emitting element unit and the support unit. In a state in which the light emitting element unit is disposed at the operating position, the support unit supports the light emitting element unit with the elastic member being disposed therebetween.
US09360829B2	Image processing apparatus including two portions for receiving discharged sheet In an image processing apparatus, a control device controls a releasing member to release a release object onto a sheet to perform an image processing; controls a first rotating body to rotate to convey the sheet on which the releasing member has released the release object; controls a second rotating body to rotate to convey the sheet whose leading edge has passed through the first rotating body; determines whether a cover is in an open position or a close position relative to a housing of the image processing apparatus based on a signal outputted by a cover sensor; and restricts, when the cover is determined to be in the open position based on the signal, a rotation of the second rotating body while the first rotating body rotates.
US09360825B2	Cleaning device, process cartridge, and electrophotographic image forming apparatus A cleaning device for a printer includes a cleaning member including a blade and a supporter having first and second surfaces, and a bent portion connecting them, the blade extending in a longitudinal direction at an end of the first surface opposite from the bent portion; and a resin sealing member provided between the cleaning member and the frame, the sealing member including a first portion between the cleaning member and the frame in a region from the blade to the second surface by way of the first surface along the crossing direction at each of one and the other longitudinal ends of the cleaning member, and a second portion sealing between the second surface and the frame in a region between the first portions at the one and the other ends along the longitudinal direction. The second portion is contacted to the second surface with an inclination.
US09360822B2	Photoconductor overcoat having radical polymerizable charge transport molecules containing two ethyl acrylate functional groups and urethane acrylate resins containing six radical polymerizable functional groups An improved overcoat layer for an organic photoconductor drum of an electrophotographic image forming device is provided. The overcoat layer is prepared from a curable composition including a triphenylamine charge transport containing two ethyl acrylate functional groups and a urethane resin containing six radical polymerizable functional groups. The amount of the triphenylamine charge transport containing two ethyl acrylate functional groups in the curable composition is about 20 to about 80 percent by weight. The amount of the urethane resin containing six radical polymerizable functional groups in the curable composition is about 20 to about 80 percent by weight. This overcoat layer improves wear resistance of the organic photoconductor drum without negatively altering the electrophotographic properties, thus protecting the organic photoconductor drum from damage and ultimately providing a photoconductor with a longer useful life when compared to other organic photoconductors commercially available.
US09360816B1	Toner bottle driving device control method and image forming apparatus A toner bottle driving device control method includes driving one of multiple toner bottle driving devices connected to a single toner container at a time, detecting abnormality of a toner bottle driving device being driven, determining a first abnormality phase of the toner bottle driving device being driven when a number of times the abnormality is detected exceeds a threshold, inhibiting the toner bottle driving device being in the first abnormality phase from driving until the first abnormality phase is resolved, driving a drivable toner bottle driving device containing a non-empty toner bottle when the toner bottle contained in the toner bottle driving device being driven is determined as empty, determining that the multiple toner bottle driving devices are in a second abnormality phase when each of the multiple toner bottle driving devices is determined as being in the first abnormality phase, and inhibiting image formation.
US09360804B2	Image forming apparatus and control method thereof An image forming apparatus to control a distance between paper sheets by sensing a surface pattern of fed paper and a method of controlling the same is provided. The image forming apparatus may include a paper transport unit configured to transport paper, a paper sensing unit disposed in a transport path of the paper and configured to sense a surface pattern of the transported paper, and a controller configured to control the paper transport unit to adjust a distance between paper sheets based on a change in the sensed surface pattern of the paper.
US09360803B2	Image forming apparatus, fixing device, drying device, developer, and liquid droplets for use in image formation An image forming apparatus includes an image forming unit that forms an image on a recording medium by using a developer and an energy generating unit that generates energy that causes the developer on the recording medium, on which the image has been formed by the image forming unit, to generate heat.
US09360801B2	Image forming apparatus with removably attached toner leakage preventing member An image forming apparatus includes a main housing, a drum unit, a developing unit, a toner container, and a paper conveyance unit. The drum unit includes a photosensitive drum. The developing unit includes a developer roller that develops a toner image on the photosensitive drum. The toner container contains toner. The paper conveyance unit is openable and closable. The image forming apparatus includes a toner leakage preventing member that is removably attached to the housing so as to extend through a space formed between the paper conveyance unit and each of the drum unit and the developing unit.
US09360798B2	Developer replenishing apparatus and image forming apparatus with rotational velocity control A replenishing apparatus includes a rotatable cylindrical-shaped container having a discharge opening through which toner is discharged, and a guide member provided rotatably with the container. The guide member has a first face on an inner face of the container and a second face which guides the toner scooped by the first face toward the discharge opening. A controller controls a drive portion to rotate the container in a first mode that performs replenishment control in a first drive condition and in a second mode that performs replenishment control in a second drive condition in which a quantity of rotation of the container per unit time is less than the first drive condition. The controller switches the mode from the first mode to the second mode based on a detection result about a quantity of developer.
US09360795B2	Method of supplying developing unit with toner and image forming apparatus using the same A method of supplying a developing unit with toner and an image forming apparatus using the method are provided. The method may include supplying toner to a developing unit separate from a toner bottle in an image forming apparatus. The method includes: detecting a remaining amount of toner in the developing unit during printing; comparing the remaining amount of toner with a first reference value; if the remaining amount of toner is greater than the first reference value, continuing printing; and if the remaining amount of toner is not greater than the first reference value, determining whether to supply toner based on a preset mode. Deterioration of printing quality in a toner supply mode may be markedly reduced according to a user's settings.
US09360790B2	Optical scanning device and image forming apparatus An optical scanning device that performs optical scanning across an object to be scanned with a light deflected, comprises: a deflection unit that causes a deflection mirror driven by a driving source to deflect the travel direction of light emitted from a light source and generates the light deflected; a resonator that includes a resonance space for reducing sound emitted from the deflection unit and a resonance passage communicating with the resonance space to direct sound from outside to inside the resonance space; a housing that accommodates the deflection unit and the resonator, and a partition wall that partitions a deflection unit accommodating space acting as a space for accommodating the deflection unit in the housing and a resonator accommodating space acting as a space for accommodating the resonator in the housing.
US09360785B2	Toner for electrostatic image development, two-component developer, and image formation process Disclosed are a toner for electrostatic image development and an image formation process using the same which can achieve high varnish application property and high adhesion of a heat-fixed image to a varnish layer even when the varnish layer is formed on the fixed image formed by an image formation process of an electrophotographic system.The toner for electrostatic image development includes toner particles containing at least a binder resin, a colorant and a parting agent, and the binder resin contains a polyfunctional acrylate-modified polyester resin obtained by modification with a polyfunctional acrylate compound. In the toner for electrostatic image development, it is preferable that the toner particles have a core-shell structure, in which the surface of a core particle is coated with a shell layer, and the polyfunctional acrylate-modified polyester resin is contained in the shell layer.
US09360772B2	Carrier method, exposure method, carrier system and exposure apparatus, and device manufacturing method A carrier system equipped with a fine movement stage holding a mounted wafer and can move along a predetermined plane, a chuck main section which holds the wafer above a predetermined position and can move vertically, and vertical movement pins supporting the wafer held by the chuck main section on the fine movement stage from below when the fine movement stage is positioned at the predetermined position and are vertically movable. A controller drives the chuck main section and the vertical movement pins downward until a lower surface of the wafer comes into contact with the fine movement stage while maintaining a hold state by the chuck main section to the wafer and a support state by the vertical movement pins to the wafer, and when the lower surface of the wafer comes into contact with the fine movement stage, the hold state and the support state are released.
US09360770B2	Method of determining focus corrections, lithographic processing cell and device manufacturing method A method of, and associated apparatus for, determining focus corrections for a lithographic projection apparatus. The method comprises exposing a plurality of global correction fields on a test substrate, each comprising a plurality of global correction marks, and each being exposed with a tilted focus offset across it; measuring a focus dependent characteristic for each of the plurality of global correction marks to determine interfield focus variation information; and calculating interfield focus corrections from the interfield focus variation information.
US09360769B2	Method of determining focus corrections, lithographic processing cell and device manufacturing method A method of, and associated apparatus for, determining focus corrections for a lithographic projection apparatus. The method comprises exposing a plurality of global correction fields on a test substrate, each comprising a plurality of global correction marks, and each being exposed with a tilted focus offset across it; measuring a focus dependent characteristic for each of the plurality of global correction marks to determine interfield focus variation information; and calculating interfield focus corrections from the interfield focus variation information.
US09360758B2	Semiconductor device process filter and method In accordance with an embodiment, a method of filtering a process fluid such as a negative tone developer is provided. The negative tone developer is introduced to a filter membrane that comprises a fluorine-based polymer. The negative tone developer is then filtered through the filter membrane. By using these materials and methods, polyethylene from the filter membrane will not contaminate the photoresist during development and reduce defects that arise from polyethylene contamination.
US09360752B2	Pattern formation method According to one embodiment, a pattern formation method is disclosed. The method is configured to transfer a shape of a pattern to a plurality of shot regions of an object using a mold including a first pattern region and a second pattern region aligned with the first pattern region. The method can include transferring the shape of the pattern to each of the plurality of shot regions sequentially in a first direction from the first pattern region toward the second pattern region when the shape of the pattern is transferred using the first pattern region. The method can include transferring the shape of the pattern to each of the plurality of shot regions sequentially in a second direction from the second pattern region toward the first pattern region when the shape of the pattern is transferred using the second pattern region.
US09360749B2	Pellicle structure and method for forming the same A pellicle structure, a pellicle-mask structure, and a method for forming the pellicle structure are provided. The pellicle structure includes a pellicle film made of a carbon-based material. In addition, the pellicle film is configured to protect a mask structure in a lithography process. The pellicle-mask structure includes a mask substrate having a mask pattern formed over the mask substrate and the pellicle frame disposed on the mask substrate. The pellicle-mask structure further includes the pellicle film disposed on the pellicle frame.
US09360747B2	Transmission type screen This is to provide a transmission type screen where a viewing angle at which an image projected by a projector can be visually recognized is extremely wide, and image visibility from the both surfaces of the screen is excellent.The present invention relates to a transmission type screen comprising a light transmissive support and a light diffusion layer on at least one surface of the light transmissive support, wherein the light diffusion layer contains light diffusion fine particles and a xerogel. It preferably relates to the above-mentioned transmission type screen wherein the xerogel contains inorganic fine particles and a resin binder, and the inorganic fine particles are particles dispersed in an aggregated form having an average primary particle diameter of 18 nm or less and an average secondary particle diameter of 500 nm or less.
US09360742B1	Swivel camera mount A swivel camera mount is configured to attach a camera to a mount base which, in turn, may be secured to sport equipment, musical instruments, vehicles, and the like. The swivel camera mount includes an inner rotating component that couples to a camera or camera housing and allows a user to rotate a camera within a horizontal plane. The inner rotating component is securely coupled within an outer sleeve component by a coupling mechanism that allows the swivel camera mount and a coupled camera or camera housing to couple to the mount base. Additionally, the outer sleeve component includes protrusions that allow the swivel mount component to pivot in one or more vertical planes.
US09360736B2	Camera module A camera module may include: a frame having an opening formed therein; an auto-focusing unit mounted on the frame; and a position adjusting part formed in the auto-focusing unit. A distance from an optical axis to the position adjusting part may be smaller than a distance from the optical axis to the opening.
US09360735B2	Camera module Disclosed herein is camera module including: a lens barrel; an auto-focusing actuator; and a handshake compensating actuator, wherein the auto-focusing actuator and the handshake compensating actuator include a common magnet for actuating auto-focusing and handshake compensation, an auto-focusing corner magnet, a coil for auto-focusing, and a coil for handshake compensation, one surface of the common magnet for actuating auto-focusing and handshake compensation and the auto-focusing corner magnet face the coil for auto-focusing and the other surface of the common magnet for actuating auto-focusing and handshake compensation faces the coil for handshake compensation.
US09360732B2	Display unit and method of driving same, as well as electronic apparatus Provided is a display unit capable of improving display performance. The display unit includes an electrophoretic particle disposed between a pair of electrodes for each pixel; and a voltage control circuit applying a voltage for each pixel, to move the electrophoretic particle. The voltage control circuit counts, for each pixel, a number of applications of a first voltage and a number of applications of a second voltage, the first voltage being applied to move the electrophoretic particle towards one of the electrodes, and the second voltage being applied to move the electrophoretic particle towards the other of the electrodes. Further, at an arbitrary timing following start of display, when the number of applications of the second voltage in part of pixels is smaller than that in other pixel, the voltage control circuit applies the second voltage to the pixel with the smaller number of applications, to bring this smaller number of applications closer to the number of applications in the other pixel.
US09360730B2	Display panel, method for manufacturing the same, and display device comprising the same A display panel, a method for manufacturing the display panel and a display device are provided. The display panel comprises a first transparent substrate (1) and a second transparent substrate (2) disposed opposite to the first transparent (1), the display panel further comprises a black matrix (3) disposed between the first transparent substrate (1) and the second transparent substrate (2), wherein the black matrix (3) together with the first transparent substrate (1) and the second transparent substrate (2) forms a plurality of pixel spaces separated from each other, electrochromatic material (4) disposed in each of the pixel spaces, and the display panel further comprises a first electrode and a second electrode, the plurality of pixel spaces being disposed between the first electrode and the second electrode. The method for manufacturing the display panel and the display device utilize the electrochromatic material instead of liquid crystals, thus having various advantages, such as a simple structure, simple manufacturing processes, low cost, good economic effect, good display effect and etc.
US09360719B2	Display device A tip edge (31) of an FPC (30E) bonded at a most outward position in an arrangement direction (30D) of a plurality of FPCs (30) has an edge (32) inclined relative to an edge (3e) of a terminal region (3T) to face a center of a display panel (X). An IC chip (20E) facing the tip edge (31) of the FPC (30E) bonded at the most outward position is arranged parallel to the inclined edge (32) of the FPC (30E).
US09360716B2	Liquid crystal display device A liquid crystal display device includes a thin film transistor substrate, a counter substrate that faces the thin film transistor substrate, a liquid crystal composition that is arranged between the thin film transistor substrate and the counter substrate, an oriented film that arranges orientation of the liquid crystal composition contacting with the thin film transistor substrate, a seal material that seals the liquid crystal composition between the two substrates, and a driver circuit. The driver circuit has a light transmission area that is formed inside of the driver circuit, and is higher in light transmittance than an area in which a non-transparent conductive film forming the driver circuit is formed, and a high sealing property area in which the seal material and an insulating film come into direct contact with each other between the light transmission area and an outer edge of the thin film transistor substrate.
US09360712B2	LCD device and manufacturing method thereof The invention provides a liquid crystal display (LCD) device comprising a first substrate, a first electrode, a second substrate, a liquid crystal layer, a main spacer and an auxiliary spacer. The first electrode is disposed on the first substrate and has a first thickness and a second thickness, wherein the first thickness is smaller than the second thickness. The second substrate and the first substrate are disposed oppositely. The liquid crystal layer is disposed between the first substrate and the second substrate. The main spacer is disposed between the first substrate and the second substrate and corresponding to a part of the first electrode having the first thickness. The auxiliary spacer is disposed between the first substrate and the second substrate and corresponding to a part of the first electrode having the second thickness.
US09360708B2	Cinnamic acid derivative, polymer thereof, and liquid crystal alignment layer comprising cured product thereof Provided is a liquid crystal alignment layer of which a constituent member is a compound represented by the general formula (I).
US09360704B2	Liquid crystal display device, electronic device, and driving methods thereof An object of the present invention is to provide a driving method by which excellent image quality and high video performance can be obtained as well as liquid crystal display devices and electronic devices with excellent image quality and high video performance. A pixel for monitor use is provided in a liquid crystal display device, and luminance of the pixel is detected using a light sensor. Herewith, because changes in luminance of a backlight with changes in the environment and the amount of time it takes for response of the liquid crystal become able to be calculated, control of the backlight in real time using the calculated information can be performed.
US09360700B2	Half-transmitting and half-reflecting color film substrate, manufacture method thereof and liquid crystal display device A half-transmitting and half-reflecting color film substrate, manufacture method thereof and liquid crystal display device are provided. The half-transmitting and half-reflecting color film substrate comprises a transparent substrate (1) and a black matrix (2) arranged on the transparent substrate (1). The black matrix (2) has a plurality of notches, and a plurality of color filters (3, 4, 5) are arranged in the notches of the black matrix (2). The plurality of color filters (3, 4, 5) are used for presenting different primary color, wherein the first color filter (5) of the plurality of color filters (3, 4, 5) is made of negative photosensitive resin, and the other color filters (3, 4) are made of positive photosensitive resin.
US09360696B1	Electronic device stack assembly An electronic device includes a stack assembly and a cover glass. The stack assembly includes an electronic paper display sub-assembly for rendering content, a front light sub-assembly for illuminating the electronic display sub-assembly, and a capacitive touch sensing sub-assembly for detecting touch inputs. The cover glass includes two apertures for the placement of control buttons for the electronic device. Prior to assembly of the electronic device, the cover glass is strengthened after the two apertures are formed so as to strengthen the interior edges of the apertures.
US09360692B2	Display device and driving method thereof A display device includes: a display panel including a pixel that includes a first subpixel and a second subpixel, the first subpixel displaying a first image based on a first gamma curve during a first period of a first frame and the second subpixel displaying a second image based on a second gamma curve during the first period of the first frame, where the first and second gamma curves are different; a gate driver configured to transmit a gate signal to the display panel; and a data driver configured to transmit a first data voltage based on the first gamma curve and a second data voltage based on the second gamma curve to the pixel, in which the pixel includes a voltage changing member which changes luminance of at least one of the first image and the second image during a second period of the first frame.
US09360691B2	Display substrate and method of repairing the same A method of repairing a display substrate includes electrically separating a defective pixel circuit from a pixel electrode and irradiating a laser beam on first and second intersection regions. The laser beam is irradiated on the first intersection region to weld a pixel connection part to a first repair line. The pixel connection part is connected to the pixel electrode at the first intersection region, and intersects the first repair line. The first repair line includes a first welding hole at the first intersection region. The laser beam is irradiated on the second intersection region to weld a dummy connection part of a dummy circuit to a second repair line. The second repair line intersects the dummy connection part at the second intersection region, and is separated from the pixel circuit. The second repair line includes a second welding hole at the second intersection region.
US09360687B2	Contact lens cleaning systems A cleaning system configured to use a hydrogen peroxide solution to clean contact lenses. The cleaning system includes a reservoir to hold the cleaning solution and a complex base coupled to the reservoir to insure a hermetically closed reservoir environment. The complex base is separated into at least a first and a second segment. A lens holder assembly holds the lenses within the solution and is coupled to the complex base in the first segment. A motor is located in the second segment of the complex base to selectively introduce a catalyst to the cleaning solution. The cleaning system has additional features that permit the system to allow for the storage of the contact lenses by converting a neutralized cleaning solution into a storage solution to prevent recontamination.
US09360683B2	Anti myopia lens A pair of multifocal contact lenses, each including an optical zone portion and a stabilization zone portion. The optical zone portion has a distance prescription zone and a near prescription zone. The near prescription zone has a near vision add power appropriate to reduce accommodative effort to substantially zero for a selected working distance and convergence support having base-in prism combined between the pair of multifocal lenses appropriate to reduce convergence effort to substantially zero for the selected working distance. The stabilization zone portion is structured to maintain orientation of the pair of lenses with a base of the base in prism directed substantially nasally.
US09360679B2	Illumination device, projection type image display device, and optical device To provide an illumination device and a projection type image display device that illuminate an area to be illuminated (image formation area) under conditions where speckle noise is less noticeable.An illumination device according to the present invention includes: a light source 11 that emits coherent light; an optical scanning section 15 that scans the coherent light emitted from the light source 11; and an optical path conversion system 21 configured to allow the coherent light scanned by the optical scanning section 15 to illuminate an area to be illuminated sequentially in an overlapping manner. An incident angle of the coherent light that enters respective points of the area to be illuminated changes with time.
US09360674B2	Dual-view display substrate and display device A dual-view display substrate and a dual-view display device are provided. The dual-view display substrate includes a base substrate; first display areas and second display areas are alternately arranged and disposed on the base substrate; the first display areas and the second display areas are respectively provided with display units; main light-emitting directions of the display units of each first display area are consistent with each other and correspond to a first view region from which only the first display areas can be viewed; and main light-emitting directions of the display units of each second display area are consistent with each other and correspond to a second view region from which only the second display areas can be viewed.
US09360663B1	Target feature integrated laser phase and amplifier compensation system An Integrated Laser Phase and Amplifier Compensation System (ILPACS) for end-to-end compensation of high-energy laser for propagation through turbulence with non-cooperative target are described. ILPACS using interferometric slaving technique and stand-alone adaptive optical systems to effect pre-compensation of phase aberrations in turbulent medium, providing pre-compensation for aberrations in a laser amplifier is presented. ILPACS enables integration with a short pulse mode locked laser for use in Target Feature Adaptive Optics (TFAO) or with a mode locked ultra short pulse laser with carrier envelope phase stabilization for use in Broadband Coherent Adaptive Optics (BCAO).
US09360658B2	Optical imaging assembly and system with optical distortion correction An optical imaging assembly is provided, having an optical axis, an object axis, a light-transmissive sleeve enclosing the object axis, being telecentric in object space, having at least three refractive lens elements, at least one of said elements having surfaces having at least one of cylindrical and acylindrical prescription, with an image plane, wherein the object being imaged lies within the sleeve.
US09360657B2	Imaging lens module An imaging lens module includes first, second, third and fourth optical lens elements that are arranged sequentially from an object side to an image side along an optical axis and that respectively have positive, positive, negative and negative refractive powers, and a fixed aperture stop that is disposed between the object side and the second optical lens element. The fourth optical lens element has an object-side surface and an image-side surface that has a concave surface segment near the optical axis. At least one of the object-side surface and the image-side surface of the fourth optical lens element has at least an inflection point.
US09360655B2	Lens barrel A lens barrel includes at least one lens, the optical axis of the lens; the first frame (the fixed frame 900) having the first restricting portion (901, 902) and having an approximately cylindrical shape about the optical axis; the second frame (1000) having the cam groove (1036) and having an approximately cylindrical shape about the optical axis; the third frame (510) having the guide portion (511) which restricts inclination thereof with respect to the first contact portion (514) and the optical axis and having an approximately cylindrical shape about the optical axis; the drive arm (520) having a cam follower (523), the second restricting portion (524, 525) and the second contact portion (526), and having an approximately arcuate shape constituted of a portion of a circular cylinder about the optical axis or an approximately plate shape; the guide shaft (601) for guiding the guide in a movable manner in the optical axis direction; and the spring (603). The first restricting portion engages with the second restricting portion. The cam engages with the cam groove (1036). The drive arm moves approximately parallel to the optical axis due to the relative rotation of the second with respect to the first frame, the third is biased by the thus bringing the first contact portion and the second contact portion into contact with each other, and the third frame moves in the optical axis direction in an interlocking manner with the drive with the inclination of the guide being restricted by the guide.
US09360644B2	Laser die and photonics die package A multi semiconductor device package includes a laser die and a photonics die. The laser die generates light and includes a laser facet that emits light from a light emitting surface. The photonics die modulates light emitted from the laser light emitting surface and includes a device side cavity that exposes an embedded waveguide optically connected with the laser facet. A laser die and photonics die attachment method includes positioning a device side of the laser die relative to a device side of the photonics die, engaging an alignment feature of the photonics die with an alignment feature of the laser die, installing the laser die within a device side recess of photonics die, electrically connecting the laser die with the photonics die, and optically connecting a laser facet of the laser die with an embedded waveguide of the phonics die.
US09360640B2	Ferrule fixing member A ferrule fixing member includes a fixing member configured to fix a ferrule to hold an optical fiber to a retaining member including a retaining hole to insert the ferrule, a locked portion configured to be locked to a locking portion formed on the retaining member and to be restricted from moving, with respect to the retaining member, in an insertion direction of the ferrule and in a direction orthogonal to the insertion direction, and a main body configured to elastically press the ferrule toward the bottom of the retaining hole by elastic deformation thereof.
US09360632B2	Ferrule A ferrule 10 includes holding holes 16, a light incidence/emission plane 21 to pass light entering or emitted from optical fibers F2 respectively held at the holding holes 16, lenses 31 disposed on an optical axes between the respective holding holes 16 and the light incidence/emission plane 21, and two or more guide portions. A second optical axis L2 between the light incidence/emission plane 21 and the ferrule 10 on the other side is inclined relative to a Z direction. A positional relation between the guide portions is 180-degree rotationally symmetric around a reference axial line extending in the Z direction. The lenses 31 is disposed disproportionately in a direction opposite to an inclination direction of the second optical axis L2 from a position line-symmetric relative to a straight line crossing with the reference axial line and parallel to an X direction.
US09360618B2	Index matched grating inscription The disclosed embodiments provide systems and methods for mitigating lensing and scattering as an optical fiber is being inscribed with a grating. The disclosed systems and methods mitigate the lensing phenomenon by surrounding an optical fiber with an index-matching material that is held in a vessel with an integrated interferometer (e.g., phase mask, etc.). The index-matching material has a refractive index that is sufficient to reduce intensity variations of the actinic radiation within the optical fiber. Some embodiments of the system include different vessels for holding the index-matching material, with the vessel having an interferometer integrated into the vessel. These vessels permit the optical fiber to be surrounded by the index-matching material while the gratings are written to the optical fiber.
US09360615B1	Laminated light guide collimator The subject matter disclosed herein relates to an optical device comprising: a light guide film to transport light rays via total internal reflection; a first optical layer covering at least a portion of a first side of the light guide film, the first optical layer to receive an exiting portion of the light rays; a second optical layer covering at least a portion of the first optical layer; and a grating pattern located at an interface between the first optical layer and the second optical layer to out-couple light rays travelling in the light guide film, wherein the grating pattern is configured so that the exiting portion of the light rays transmit through the grating pattern twice before being total internally reflected by the grating pattern.
US09360613B2	Planar light source apparatus and display apparatus using same A planar light source apparatus includes a point light source and a light guide plate shaped like a flat plate with a rectangular shape in a plan view. The light guide plate includes an output surface confronting an opening portion, a pair of second side surfaces opposed to each other, and a hole opening in a non-output surface and formed near one of the first side surfaces at a position where the point light source is to be arranged. Each of the pair of second side surfaces is at least partially configured as a prism whose ridge line extends in a direction perpendicular to the output surface and whose cross-section, when sectioned in a direction parallel to the output surface, has a sawtooth-like shape in which concavity and convexity are repeated. A light of the point light source can be efficiently uniformized in the light guide plate, and thus unevenness of brightness can be prevented.
US09360609B2	2D/3D projector with rotating translucent cylinder for alternating light polarisation A 3D image projector having a translucent rotatable hollow cylinder, the hollow cylinder having differently polarized sections, and the projector being capable of passing a light beam generally orthogonally through a wall of the hollow cylinder is disclosed.
US09360605B2	System and method for spatial and spectral imaging A system and method for acquiring images containing spatial and spectral information of an object include acquiring defocused images using an optical system based on extended depth of field. The optical system further includes a filter array comprising an array of at least six different sub-filters that are arranged such that any group of four immediately adjacent sub-filters includes at least one red sub-filter, at least one green sub-filter and at least one blue sub-filter. The filter array is located at the aperture stop of the optical system. A coded mask is located at the focal plane of the optical system, and an imager is located beyond the focal plane such that images acquired by the imager are defocused. The images are refocused, and spectral and spatial information is restored by designated software.
US09360592B2	Thin microstructured optical films Presently described are optical films, such as a brightness enhancing film, having a polymerized microstructured surface disposed on a preformed polymeric film wherein the film has a thickness of no greater than 3 mils and the polymerized microstructured surface consists of the reaction product of a substantially non-brominated polymerizable resin composition.
US09360589B1	Articles containing non-visible identifying marks formed from carbon nanomaterials and methods utilizing the same Identifying marks are often used for authentication and tracking purposes with various types of articles, but the marks themselves can sometimes be subject to replication or removal by an outside entity, such as a person or group having malicious intent. This can make it easier for an outside entity to produce a counterfeit article or to sell a stolen article. Carbon nanotubes and other carbon nanomaterials can be used to form identifying marks that are not visible to the naked eye, thereby making the marks more difficult for an outside entity to tamper with. Various articles can include an identifying mark that is localized and not visible to the naked eye, the identifying mark being electrically conductive and containing a carbon nanomaterial. By electrically interrogating the article, such as through spatially measuring eddy currents about the article, the marks can be located and authenticated.
US09360580B2	Method and apparatus for directional well logging A method and apparatus are provided for making directional measurements toward a formation of different resistivity that is proximate to the borehole, but which is not penetrated by the borehole. The methods and apparatus include the use of at least one insulated gap and at least one magnetometer positioned within a non-magnetic housing that is disposed within a non-magnetic tubular. An electric current is applied across the insulated gap, which results in current leaking into the surrounding formations. When a formation of contrasting resistivity is proximate to the logging apparatus, the magnetometer detects a secondary magnetic field due to the contrasting formation. The direction of the secondary magnetic field can be used to determine the direction to the contrasting formation. The magnitude of the secondary magnetic field can be used to determine the distance position to the contrasting formation.
US09360576B2	Methods and apparatus for generating deghosted seismic data One embodiment relates to a method for deghosting seismic data from a marine seismic survey. The seismic data from the marine seismic survey is obtained, where the marine seismic survey was performed using multiple sub-sources towed at two or more different depths and fired at distinct time-delays. The seismic data is sorted into common receiver gathers, and the common receiver gathers are transformed from horizontal source coordinates to horizontal wavenumbers. For each selected frequency, a matrix operator is constructed, and an inversion procedure is applied to a system of equations based on the matrix operator to generate source-deghosted seismic data. Other embodiments, aspects and features are also disclosed.
US09360567B2	Scintillating organic materials and methods for detecting neutron and gamma radiation Embodiments incorporate a method and apparatus for detection of radiation. Embodiments detect fast and/or thermal neutrons. Embodiments detect neutrons in high backgrounds of gamma rays. Embodiments can have high sensitivity and/or high gamma discrimination. Embodiments include a given single material that detects fast neutrons and simultaneously detect gamma rays with moderate energy resolution. Embodiments utilize liquid, viscous liquid, gel, and/or solid scintillating materials. Embodiments incorporate a scintillating matrix, such as a liquid, having a highly polar matrix, such as a liquid solvent, dissolved dyes, and a high concentration of a dissolved organo metallic compound. The use of a single material for a large area detector of fast neutrons and gamma rays can provide material and cost benefits.
US09360561B2	Radiation imaging apparatus, radiation imaging system, and control method for the radiation imaging apparatus A radiation imaging apparatus includes a pixel array including a plurality of pixels arranged in a matrix in which each pixel includes a conversion element configured to convert radiation into a charge and a switch element configured to transfer an electric signal based on the charge, a plurality of wirings arranged in the pixel array, and a detecting unit configured to detect radiation irradiation to the pixel array, in which the detecting unit includes a detecting circuit configured to detect the radiation irradiation to the pixel array on the basis of a plurality of currents flowing through the plurality of wirings detected for each of the plurality of wirings.
US09360557B1	Systems, methods, devices and subassemblies for rapid-acquisition access to high-precision positioning, navigation and/or timing solutions Position, navigation and/or timing (PNT) solutions may be provided with levels of precision that have previously and conventionally been associated with carrier phase differential GPS (CDGPS) techniques that employ a fixed terrestrial reference station or with GPS PPP techniques that employ fixed terrestrial stations and corrections distribution networks of generally limited terrestrial coverage. Using techniques described herein, high-precision PNT solutions may be provided without resort to a generally proximate, terrestrial ground station having a fixed and precisely known position. Instead, techniques described herein utilize a carrier phase model and measurements from plural satellites (typically 4 or more) wherein at least one is a low earth orbiting (LEO) satellite. For an Iridium LEO solution, particular techniques are described that allow extraction of an Iridium carrier phase observables, notwithstanding TDMA gaps and random phase rotations and biases inherent in the transmitted signals.
US09360541B2	Local shim coil within a local coil for local B0 homogenization in an MRT examination A local coil for an imaging system, in particular an MRI scanner, is provided. The local coil is an MRI scanner local coil within which the head of a patient may be positioned, and that includes at least one shim coil. A conductor of a shim coil of the at least one shim coil is disposed in a region for a molded nape section of the patient.
US09360532B2	Current detection apparatus A current detection apparatus for detecting a current from a battery flowing through a harness. The apparatus includes a resistor having a current carrying member disposed between a terminal of the battery and the harness, a circuit board provided thereon with a current detection circuit for detecting a current flowing through the resistor, and a casing having a recessed portion for accommodating the circuit board, a cover for closing an opening of the recessed portion. The circuit board includes a solder junction between the circuit board and a terminal protruding from an inside bottom of the recessed portion and passing through a through hole arranged on the circuit board, and an open end of the recessed portion that can be engaged with the cover is non-parallel to the circuit board so that at least a portion of the circuit board including the solder junction lies outside of the recessed portion.
US09360528B2	Method and system for voltage sense input A circuit that includes a bridge rectifier configured to convert a sensed input signal into a rectified output signal and a regulator configured to convert the rectified output signal into a voltage source signal. The circuit further includes a variable period timer configured to be powered by the voltage source signal and to convert the rectified output signal into a low duty cycle timer signal in which 50% is a low duty cycle and the low duty cycle timer signal has a frequency that is correlated to an input voltage level of the sensed input signal, wherein the voltage sensing circuit is configured to operate on input voltage levels of sensed alternating current (AC) and direct current (DC) input signals over one or more determined dynamic ranges.
US09360527B2	System and method for energy prediction in battery packs In an embodiment, a system includes a battery management unit (BMU) coupled to a battery pack of an xEV. Further, the BMU is configured to determine an energy remaining value for the battery pack based, at least in part, on a minimum cell temperature and a minimum cell state of charge percentage (SOC %) determined by the BMU for the battery pack.
US09360524B2	Testing system for serial interface A testing system includes a circuit board, and an inserting unit. The circuit board includes a first serial interface and a serial chip connected to the first serial interface. The first serial interface connects a second serial interface of a motherboard to receive a first signal of the second serial interface. The inserting unit includes a first plug connected to a pin Transmit Data of the first serial interface. The first plug connects a testing device. When the first signal is transmitted to the first serial interface by the second serial interface, the serial chip receives the first signal and sends the first signal back to the first serial interface. The first plug sends a second signal of the pin Transmit Data to the testing device to be tested.
US09360513B2	Method and system for determining parameters of a satellite signal A method and system for determining parameters of a satellite signal present in a coaxial cable, the method including the steps of aligning two capacitive coupling sensors in proximity to a length of the coaxial cable, wherein the distance between the capacitive coupling sensors is below 10 centimeters; receiving from two capacitive coupling sensors a signal being a differential voltage in the coaxial cable between the locations of the capacitive coupling sensors wherein the voltage is relative to a voltage level in a coaxial cable; amplifying the differential voltage by a bandpass amplifier; detecting a valid DiSEqC command sequence being indicative of signal quality.
US09360510B2	Parasitic capacitance cancellation in capacitive measurement An integrated circuit compensates for parasitic capacitance in a capacitive measuring apparatus wherein a capacitance measurement is done by repeatedly transferring charge from a capacitor to be measured to a reference capacitor.
US09360508B2	Detecting device, power receiving device, contactless power transmission system, and detecting method Disclosed herein is a detecting device including a coil electromagnetically coupled to the external, a resonant circuit that includes at least the coil, and a detecting section that superimposes a measurement signal for measuring the Q-factor of the resonant circuit on a power transmission signal transmitted to the coil in a contactless manner and removes the power transmission signal from an alternating-current signal obtained by superimposing the measurement signal on the power transmission signal. The detecting section measures the Q-factor by using the alternating-current signal from which the power transmission signal is removed.
US09360484B2	Anti-FcRH5 antibodies and immunoconjugates and methods of use The present invention is directed to compositions of matter useful for the treatment of hematopoietic tumor in mammals and to methods of using those compositions of matter for the same.
US09360477B2	Polymer conjugate enhanced bioassays Modified branched polymers are combined with bioactive agents which are one member of a binding pair for use in an assay.
US09360472B2	Cell line, system and method for optical-based screening of ion-channel modulators A variety of applications, systems, methods and constructs are implemented for use in connection with screening of ion-channel modulators. Consistent with one such system, drug candidates are screened to identify their effects on cell membrane ion channels and pumps. The system includes screening cells having light responsive membrane ion switches, voltage-gated ion switches and fluorescence producing voltage sensors. A chemical delivery device introduces the drug candidates to be screened. An optical delivery device activates the light responsive ion switches. An optical sensor monitors fluorescence produced by the voltage sensors. A processor processes data received from the optical sensor. A memory stores the data received from the optical sensor.
US09360456B2	Detecting apparatus, power receiving apparatus, power transmitting apparatus, and contactless power supply system There is provided a detecting apparatus including one or a plurality of magnetic coupling elements that include a plurality of coils, a positioning unit disposed near at least one coil from among the plurality of coils included in the one or plurality of magnetic coupling elements, and a detector that measures an electrical parameter related to the one or plurality of magnetic coupling elements or to a circuit that at least includes the one or plurality of magnetic coupling elements, and determines from a change in the electrical parameter whether a foreign matter capable of generating heat due to magnetic flux is present.
US09360434B2	Optical inspection apparatus and method thereof An object of the present invention is to provide an optical inspection apparatus that suppresses an influence of quantum noise and obtains superior defect detection performance even when an amount of light is small and a method thereof.In order to resolve the above problem, the present invention provides an optical inspection apparatus that includes a light source which radiates light to a sample; a light interference device which causes target light transmitted, scattered, or reflected from the sample and reference light to interfere with each other, such that strength of light after the interference becomes lower than strength of the target light; a photon counter which measures a photon number of the light after the interference by the light interference device; and a defect identifier which identifies the presence or absence of a defect, on the basis of a detected photon number obtained by the photon counter.
US09360418B2	Nondestructive inspection using hypersound A method and apparatus for inspecting an object. The apparatus comprises a wave generator and a detection system. The wave generator is positioned away from an object. The wave generator emits an ultrasonic wave in a direction towards a location on the object such that the ultrasonic wave encounters a portion of the object. The detection system is positioned at a same side of the object as the wave generator. The detection system detects a feature response of a feature within the portion of the object to the ultrasonic wave encountering the portion of the object.
US09360415B2	Dynamic reconstruction of a calibration state of an absorption spectrometer A reference harmonic absorption curve of a laser absorption spectrometer can have a reference curve shape derived from a reference signal generated by the detector in response to light passing from the laser light source through a reference gas or gas mixture. The reference gas or gas mixture can include one or more of a target analyte and a background gas expected to be present during analysis of the target analyte. A test harmonic absorption curve having a test curve shape is compared with the reference harmonic absorption curve to detect a difference between the test curve shape and the reference curve shape. Operating and/or analytical parameters of the laser absorption spectrometer are adjusted to correct the test curve shape to reduce the difference between the test curve shape and the reference curve shape.
US09360412B2	Rotating optics for multiple cuvette array A system includes a testing instrument to hold a test card having multiple cuvettes radially spaced about a point on the card. A rotatable mount is supported in relation the point on the card when the card is held in the testing system. Optics are supported on the rotatable mount to provide radiation to the multiple cuvettes.
US09360406B2	Method and apparatus for self-calibration of density profiler A process and system for self-calibration of a density profiler is disclosed. The process may include measuring a density profile of a fluid in a vessel using a plurality of sensors or a single sensor, and measuring a density profile of the fluid in the vessel using a plurality of sample ports. A density of the fluid proximate a location of at least one of the plurality of sample ports based on the sensor measured density profile may then be interpolated. A density of the fluid proximate a location of at least one of the plurality of sensors based on the sample port measured density profile may also be interpolated. Adjustment of a calibration of at least one of the plurality of sensors may then be made based on both the interpolated sample port density and the interpolated sensor density.
US09360404B2	Filtering member and filtering method It has been difficult to conduct high-sensitivity, high-precision measurement due to externally generated contamination or cross-contamination. Thus, the invention includes (1) a filter unit having a filter at a bottom of a container for holding a liquid, the filter being adapted to filter a liquid, and (2) an attachment cover having a first opening and a second opening, the filter unit being attachable to and detachable from the attachment cover via the first opening, and the attachment cover being adapted to, when the filter unit is attached to the attachment cover, allow filtration by the filter in a state in which an inner face of the attachment cover is tightly in contact with an outer face of the filter unit, and discharge a resulting filtrate through the second opening.
US09360401B2	Sample stack structure and method for preparing the same The present invention provides a sample stack structure with multiple layers. The sample stack structure has at least a substrate, an adhesive layer and a target layer. The target layer is directly sandwiched between the substrate and the adhesive layer.
US09360398B2	Devices and methods for the collection and detection of substances The present invention provides a single self-contained device for collecting, extracting, on-site testing, and transferring for forensic confirmatory analysis, a wide variety of substances including, but not limited to, drugs of abuse, explosives, weapons of mass destruction, food toxins and industrial wastes. Samples can be obtained from a surface by swabbing a suspect area or the testing of solid materials (pills, capsules, powders), air samples and biological and non-biological fluids by placing the substance in the device. The device includes a swab, a retention well including a wash, and analysis technologies that can be, for example, a lateral flow testing system. The swab is rinsed with a wash prior to testing thereby not compromising the chemistry of the detection technologies and allowing for a wide variety of applications under a number of field conditions. Also, the device is a single self-contained unit instead of having a separate reagent droppers or sprays, making it compact and easy to use. Moreover, the device is designed to not only collect and test samples but to seal the originally target analyte, not affected by testing procedures, in a specially designed cap for shipping under chain of custody documentation to a forensic laboratory for confirmatory testing.
US09360395B2	Method and device for dynamometer testing of a motor vehicle A dynamometer test unit for use in dynamometer testing of a vehicle, where the vehicle includes at least a first wheel shaft and at least one first vehicle power source for providing power to the first wheel shaft. The first wheel shaft is, during testing, connected to a dynamometer test unit which includes a first individually controllable dynamometer power source for applying a first power to the first wheel shaft. The dynamometer test unit further includes a second individually controllable dynamometer power source for applying a second power to the first wheel shaft. The first and the second dynamometer power source apply a controllable power to the first wheel shaft during testing. The invention also relates to a dynamometer test system.
US09360392B2	Calibration of optical time domain reflectometry optical loss measurement in optical fibers having potentially dissimilar light backscattering efficiencies Calibration of optical time domain reflectometry optical loss measurement in optical fibers having potentially dissimilar light backscattering properties is disclosed. For example, an optical time domain reflectometer (OTDR) can be employed to perform a single-ended optical loss measurement on an optical fiber before and after joinder (e.g., a splice) to determine the efficiency of the joinder. The individual optical fibers provided in a joined optical fiber may have dissimilar backscatter light collection efficiencies resulting in an erroneous OTDR optical loss measurement, because an OTDR assumes the backscatter light collection efficiency of the joined optical fiber is identical before and after joinder. An OTDR calibration factor is first determined before an OTDR optical loss measurement of the joined optical fiber is made. The OTDR calibration factor is used to correct any error in an OTDR optical loss measurement of the joined optical fiber.
US09360390B2	Pressure measuring instrument and substrate processing apparatus provided with the pressure measuring instrument There is provided a pressure measuring instrument including: a detecting unit including the reference pressure chamber therein and formed in a cylindrical shape, the diaphragm being disposed inside the detecting unit; a communicating unit for providing communication between the diaphragm and the measurement pressure chamber, and formed in a circular tube shape having an inner diameter smaller than an inner diameter of the detecting unit; and an annular flow-path forming unit disposed between the detecting unit and the communicating unit, and configured to form a substantially annular path. The communicating unit introduces a gas of the measurement pressure chamber into the substantially annular path. The annular flow-path forming unit allows the gas introduced from the communicating unit to pass through the substantially annular path and to supply the passing gas to a side surface of the diaphragm.
US09360388B2	Pressure sensing system and method of housing a pressure sensor A pressure sensing system includes a pressure sensor, an optical fiber in operable communication with the pressure sensor, and a body having a diaphragm integrally formed therein and separated a distance from the optical fiber.
US09360384B2	System, method, and device for sensing pressure of a fluid A pressure sensor for sensing a pressure of a fluid includes a Bourdon tube that has a helical segment and an anvil. A portion of the anvil is positioned within the helical segment. The sensor also includes a dielectric material positioned between the portion of the anvil and the helical segment. The anvil, the dielectric material, and the helical segment form a variable capacitor. A capacitance of the variable capacitor changes based on a pressure applied to the Bourdon tube.
US09360382B2	Device for measuring a heat flux The invention relates to a device for measuring a heat flux, comprising a thermopile formed of a plurality of thermojunctions of distributed type. The device is formed of a first and a second ceramic substrate (Ce1, Ce2), a first face of the first substrate (Ce1) is composed of cavities which are separated by ceramic spacers (Ca1, Ca2, Ca3, Ca4), the thermopile is placed on a second planar face of the first substrate which is located opposite the first face, the spacers of the first substrate are arranged beneath one thermojunction (Tj2, Tj4, Tj6, Tj8) in two of the thermopile, a face of the second substrate (Ce2) is composed of cavities which are separated by ceramic spacers (Ca5, Ca6, Ca7, Ca8, Ca9), the spacers of the second substrate rest on a thermojunction (Tj1, Tj3, Tj5, Tj7, Tj9) beneath which a spacer of the first substrate is not arranged.
US09360372B2	System and method for using a portable near IR LED light source and photogrammetry for boresight harmonization of aircraft and ground vehicle components Disclosed is a system and method for using a portable near (infrared light emitting diode) IR LED light source and photogrammetry for boresight harmonization of aircraft and ground vehicle components. In one embodiment, orientation and positional parameters of two or more fixed points and distances between the two or more fixed points are measured using the portable near IR LED light source with a photogrammetric system. The two or more fixed points are reference points within the aircraft or the land vehicle. Further, the measured orientation and positional parameters of the two or more fixed points and the distances between the two or more fixed points on the aircraft or the land vehicle are compared with specified design parameters of the component in the aircraft or the land vehicle. Furthermore, the component in the aircraft or the land vehicle is harmonized based on an outcome of the comparison.
US09360369B1	System for determining average ellipsometric parameters for planar or non-planar shaped objects, and method of its use A system for easily determining average ellipsometric parameters based on data obtained from two different locations on a planar or non-planar shaped object, along with its method of use.
US09360366B1	Self-referencing spectrometer on mobile computing device This invention discloses a self-referencing spectrometer that simultaneously auto-calibrate and measure optical spectra of physical object utilizing shared aperture as optical inputs. The concurrent measure and self-calibrate capabilities makes it possible as an attachment spectrometer on a mobile computing device without requiring an off-line calibration with an external reference light source. Through the mobile computing device, the obtained spectral information and imagery captured can be distributed through the wireless communication networks.
US09360365B2	Optical sensor device for detecting a pulse of a living body An optical sensor device includes a light emitter for emitting, to a living body, lights having two wavelengths and blinking at a predetermined frequency, and a light receiver for receiving the lights from the living body. The light receiver outputs first and second detection signals corresponding to the respective wavelengths. A filter circuit extracts, from the first and second detection signals, modulation signals that are obtained with amplitude modulation of signals of the predetermined frequency. The modulation signals are amplified by a post-amplifier and are taken into an arithmetic processing unit after being converted to digital signals by an AD converter. The arithmetic processing unit calculates DC components and AC components of the first and second detection signals by employing the modulation signals converted the digital signals.
US09360358B2	Coriolis mass flow meter, vibrating tube density meter and vibrating sheet used therein The present invention relates to a Coriolis mass flow meter, a vibrating tube density meter and a vibrating sheet used therein, and more particularly, to a vibrating sheet for use in a Coriolis mass flow meter or a vibrating tube density meter, the vibrating sheet having at least one welded connecting portion that is fixedly welded to the flow tube of the Coriolis mass flow meter or the vibrating tube density meter, the flow tube being excited to vibrate around a revolving axis at the welded junction of the vibrating sheet and the flow tube. The welded connecting portions of the vibrating sheet are only formed in the stress insensitive region of the vibrating sheet, wherein the stress insensitive region is the region of the vibrating sheet which has an angle of not more than 45 degrees with respect to the revolving axis. In addition, the present invention also provides a Coriolis mass flow meter and a vibrating tube density meter using the vibrating sheet. The present invention not only simplifies the process, but also improves the measurement precision and service life of the Coriolis mass flow meter and the vibrating tube density meter.
US09360357B2	Micromachined mass flow sensor with condensation prevention and method of making the same The design and manufacture method of a silicon mass flow sensor made with silicon micromachining (a.k.a. MEMS, Micro Electro Mechanical Systems) process for applications of gas flow measurement with highly humidified or liquid vapors is disclosed in the present invention. The said silicon mass flow sensor operates with an embedded heater and an adjacent control temperature sensor beneath the integrated calorimetric and thermal dissipative sensing thermistors. When the condensation takes place at the surface of the said silicon mass flow sensor, the embedded heater shall be turned on to elevate the temperature of the supporting membrane or substrate for the sensing thermistors. The elevated temperature shall be adjusted to above the vaporization temperature with the feedback data of the adjacent temperature sensor such that the surface condensation due to the presence of the liquid vapors in a gas flow can be effectively eliminated.
US09360356B2	Magneto inductive flow measuring device having a coil core protruding out from the coil A magneto inductive flow measuring device comprising a measuring tube and coil systems arranged thereon, wherein each coil system includes a coil and a coil core so led through the coil that the coil core protrudes from the coil, wherein two coil systems are so arranged on the measuring tube on a line parallel to a longitudinal axis of the measuring tube that a pole shoe is arranged between the measuring tube and the coil cores protruding from the coil systems.
US09360353B2	Measurement device and method for determining a fluid fill level in a fuel tank The invention relates to a measurement device (12) for determining a fluid fill level (14) in a fuel tank (10) for a vehicle. The position of a float (18) in relation to a signal generating unit (22) which can be attached on the fuel tank (10) can hereby be converted into a signal that is correlated with the fill level (14) of the undeformed fuel tank (10). A correction device (48, 54, 56) is designed for measuring a deformation of the fuel tank (10) and is used for correcting the signal. The invention also relates to a method for determining a fluid fill level (14) in a fuel tank (10) for a vehicle.
US09360340B1	Customizable presentation of navigation directions Presentation of navigation directions in mapping applications is customized by obtaining navigation instructions that direct a user from a starting point to a destination. The navigation instructions are displayed via a user interface. For each of the navigation instructions, an individually operable user control for specifying an instruction-specific presentation rule is provided. Instruction-specific presentation rules are received prior to the user departing from the starting point toward the destination. The navigation instructions are presented during navigation in accordance with the received instruction-specific presentation rules.
US09360333B2	Method and apparatus calculating estimated time of arrival from multiple devices and services An approach is provided for calculating a final estimated time of arrival to at least one destination location based, at least in part, on multiple estimated time of arrival provided by one or more devices and/or services for one or more routing segments. The approach involves determining at least one route, wherein the at least one route includes a plurality of segments navigated using a plurality of devices or services. The approach also involves receiving at least one individual estimated time of arrival from at least one of the plurality of devices or services, wherein the at least one individual estimated time of arrival is for at least one of the plurality of segments associated with the at least one of the plurality of devices or services, and wherein the at least one individual estimated time of arrival is calculated independently by the at least one of the plurality of devices or services. The approach further involves causing, at least in part, a calculation of a total estimated time of arrival based, at least in part, on the at least one individual estimated time of arrival.
US09360322B2	System and method for separating ambient gravitational acceleration from a moving three-axis accelerometer data A method based on separating ambient gravitational acceleration from a moving three-axis accelerometer data for determining a driving pattern is presented. A server may receive telematics data originating from a client computing device and combine the telematics data. The server may estimate a gravitational constant to the combined telematics data and generate a function for pitch and a roll angle from the combined telematics data. The server may further determine a driving pattern using at least the pitch and the roll angle.
US09360305B2	Tactile microprobe arm fastened to freestanding end of an optical fiber A device for the tactile determination of a surface shape of a measuring object includes a micro probe arm having a stylus tip, the micro probe arm being fastened on an optical fiber having a fiber end, which is mounted in a probe housing, a reference mirror is provided in the probe housing, and an optical measuring device is provided for determining the position of the fiber end in relation to the reference mirror. The contactless interferometric determination of the distance between the fiber end of the optical fiber and the reference mirror attached in the probe housing allows precise determination of the surface shape of the measuring object.
US09360293B2	Contour band matching tool and methods The invention is directed to tools and methods for matching a first ring to a second ring. The apparatus comprises a plurality of contour bands, each contour band having a contoured portion that differs from the contoured portion of the other bands. Preferably the bands differ by increments such that a wide range of matching can be performed to identify a correct contour, which is then provided to a manufacturer for creation of the matching band.
US09360291B2	Systems and methods for control and calibration of a CMM A method of operating an articulated arm CMM is provided. Instructions for the CMM can be inputted to the CMM arm by an action chosen from the group consisting of placing the arm in a predefined position and moving the arm in a predefined manner.
US09360286B2	Rotationally stabilized guidable projectile and method for guiding the same The invention relates to a rotationally stabilized projectile (1) for launching from a barrel, which projectile (1) comprises a front projectile part (22), a rear projectile part (20) comprising a rotating band (4), and an intermediate projectile part (21) comprising a freely rotatable middle section (2) arranged with guide wings (3) for improving the gliding capability and guidance capability during the gliding phase and end phase of the projectile. The guide wings (3) are arranged extensibly on the freely rotatable middle section (2), and the intermediate projectile part (21) also comprises a regulator device (14) for regulating the rotation of the middle section (2). The invention also relates to a method for guiding a rotationally stabilized projectile.
US09360281B1	Rapidly deploying ballistic barrier curtain A ballistic barrier curtain deployment system deploys a ballistic resistive curtain using a deployment firing mechanism. The ballistic barrier curtain can protect military personnel, equipment, diplomats, celebrities, etc. The deployment firing mechanism utilizes an inflator unit that operates using the same principles as an airbag inflator. The curtain is stored in a barrier curtain storage channel. The deployment firing mechanism is located in a ballistic barrier curtain deployment mechanism integrated at each end of the storage channel. A curtain deployment support column extends vertically from the curtain deployment mechanism. Each edge of the curtain is supported by the support column. The inflator unit is activated upon an activation request from a visual monitor, an audible monitor, heat/thermal monitor, or a manual directive. The inflator unit drives each edge of the curtain vertically, deploying the curtain between the support columns.
US09360277B2	Multiple missile carriage and launch guidance module A multiple missile carriage and launch guidance module comprising a plurality of missile launch rails that are each configured to carry and guide the launch of a missile and are carried on a common missile carriage wall in respective positions and orientations allowing for missile carriage and launch from the rails.
US09360274B2	Sling strap retention device A sling strap retention device is provided. The sling strap retention device includes a structure with a first flexible member and a second flexible member, the first flexible member and the second flexible member further comprising a first end and a second end, a first side and a second side, a front surface, and a back surface, wherein the first and second flexible members may be oriented one over the other with the back sides of the first and second flexible members in opposition and coupled along a length of the members. The first and second flexible members may be configured to flex and couple to one another to form opposing closed loops. These closed loops may be configured to couple to and retain therein a sling strap of a weapon.
US09360273B1	Firearm retaining apparatus Embodiments provide a firearm retaining apparatus.
US09360271B1	Vibration damper In at least one embodiment, a firearm comprises a stock comprising a vibration damper. The vibration damper comprises a first resilient member, a second resilient member and a mass. Each resilient member is attached to the stock and comprises a first material and a second material. Each of the first and second materials is elastomeric. The first material defines a body of the resilient member, the body defining apertures therein and spokes extending between adjacent apertures. The second material of each resilient member occupying an entire cross-section of each aperture defined in the first material of the resilient member. The mass is supported by said first and second resilient members.
US09360261B2	Method and system for conditioning air An air conditioning method that reduces the amount of cooling energy and the amount of dehumidification energy to approximately a limiting amount, and also reduces the amount of humidifying energy to approximately a limiting amount. If an absolute humidity of the process air is calculated by use of measurements of changes in work conditions and variations in atmospheric pressure, the required amount of air to be cooled and dehumidified flowing downstream through the main-stream duct and the required amount of humidification can be determined. Therefore, by outputting a signal indicative of the required amount of cooled-dehumidified air to actuate a controller of flow-rate regulating means, and outputting a signal indicative of the required amount of humidification to actuate a controller of humidifying means, the amount of air to be cooled and dehumidified can be reduced to the required amount of cooled-dehumidified air close to the limiting amount.
US09360257B2	Transient heating burner and method A transient heating burner including at least two burner elements each having a distribution nozzle configured to flow a fuel, and an annular nozzle surrounding the distribution nozzle and configured to flow an first oxidant, at least one staging nozzle configured to flow a second oxidant, and a controller programmed to independently control the fuel flow to each distribution nozzle such that at least one of the distribution nozzles is active and at least one of the distribution nozzles is passive, wherein an active distribution nozzle fuel flow is greater than an average fuel flow to the distribution nozzles and a passive nozzle fuel flow is less than the average fuel flow, and to control a staging ratio to be less than or equal to about 75%.
US09360253B2	Metal kiln temperature control system and method A rotary aluminum kiln temperature regulation system comprising a temperature sensing device in the kiln that is configured to take temperature readings in an area of the kiln in proximity to the temperature sensing device. The system including a wireless transmitter operatively associated with the temperature sensing device and a receiver wirelessly associated with the transmitter, such that the transmitter and receiver wirelessly transmit the temperature readings taken by the temperature sensing device from the transmitter to the receiver. The system also including a control unit operatively connected to the receiver that is configured to receive the transmitted temperature readings and determine when the transmitted temperature readings exceed a predefined temperature set point. The control unit operatives one or more forward feed control loop subsystems that assist in safely operating the kiln in accord with a predetermined temperature profile programmed into the control unit.
US09360250B2	Process and apparatus for the separation of air by cryogenic distillation The present invention relates to a process and apparatus for the separation of air by cryogenic distillation. In particular, it relates to a process for separation of air using three cryogenic distillation columns for the production of gaseous oxygen. Certain embodiments of the invention are particularly efficient for the production of gaseous oxygen at pressures between 30 and 45 bars abs, in which the oxygen is produced by removing liquid oxygen from a distillation column, pressurizing the oxygen and vaporizing the pressurized liquid by heat exchange with air.
US09360248B1	Beverage cooler with a separate, removable shaker receptacle A beverage cooler having an insulated housing wherein the housing has a bottom and top with the top including a (i) center opening configured to receive a removable lid and (ii) a threaded member on an underside thereof and substantially circumscribing the center opening with the threaded member configured to removably receive a first shaker receptacle within a portion of a total volume defined by the housing. The first shaker receptacle may receive a second shaker receptacle therein such that the first shaker receptacle acts as a sleeve to keep the second shaker receptacle out of contact with a liquid in the beverage cooler. The first and second shaker receptacles may be removed by removing the top and unscrewing the first shaker receptacle from the threaded member on the underside of the top.
US09360245B2	Refrigerator A refrigerator is disclosed. The refrigerator includes a cabinet comprising a storage chamber, a cold air generation chamber provided above the storage chamber, an evaporator provided in the cold air generation chamber, and a refrigerant tube configured to pass through a predetermined wall of the cold air generation chamber, not passing the storage chamber, to be connected with the evaporator. An object of the present disclosure is to provide a refrigerator which has an efficient installation structure of a refrigerant tube connected with an evaporator provided in a cold air generation chamber provided above a storage chamber to enlarge storage space of the storage chamber.
US09360228B2	Ventilation control system and method A system and method of controlling a ventilation system is provided based on a determination of local dew point and automatically activating an exhaust fan before condensate appears on structure and objects and ideally before visible condensation forms in the air of an enclosed area. Firmware in the control circuit detects the presence of hardware components and operates a control circuit in one of a plurality of modes based on the detected hardware components that are coupled to the control circuit.
US09360226B2	Heat pump system A heat pump system includes a heat-source-side refrigerant circuit and a controller. The heat-source-side refrigerant circuit has a plurality of usage units having usage-side heat exchangers. The plurality of usage units are connected to a heat source unit having a plurality of heat-source-side heat exchangers and a heat-source-side compressor configured to compress a heat-source-side refrigerant. The controller causes the plurality of heat-source-side heat exchangers to function as evaporators and radiators of heat-source-side refrigerant to perform an air-cooling operation and an air-warming operation using an aqueous medium. The heat pump system operates so that the heat-source-side condensing temperature is below 40° C. in the case that an outside air temperature is 25° C. or lower and the cooling and heating operations coexist.
US09360209B2	Method for controlling a combustion process, in particular in a firing chamber of a fossil-fuel-fired steam generator, and combustion system A method for controlling a combustion process, in particular in a firing chamber of a fossil-fired steam generator, is provided. The method includes determining spatially resolved measuring values in the firing chamber. Spatially resolved measuring values are transformed into state variables that may be used for control engineering, and they are subsequently fed as actual values to control circuits. The changes in the controlled variables determined in the control circuits are divided among a plurality of actuators in a backward transformation considering an optimization target. A corresponding combustion system is also provided.
US09360205B2	Lighting apparatus for vacuum apparatus A lighting apparatus for a vacuum apparatus that allows light to enter the inside of the vacuum apparatus through an observation window and makes it possible to see the inside of the vacuum apparatus through the observation window by illuminating the inside of the vacuum apparatus includes a coupling adapter that is removably coupled to the observation window via a coupling unit, an opening that is formed in a central part of the coupling adapter and allows the inside of the vacuum apparatus to be seen through the observation window, and a plurality of LEDs (light-emitting diodes) that are placed in the coupling adapter and face the observation window. The lighting apparatus is attached to the observation window for seeing the inside of the vacuum apparatus and illuminates the inside of the vacuum apparatus.
US09360203B2	Illumination device and method for assembly of an illumination device The present invention discloses an illumination device (100) and a method (4000) for assembly of such an illumination device. The illumination device (100) comprises a light source (110) arranged to generate light, a carrier (120) arranged to support the light source and an envelope (130) enclosing the light source and the carrier. The envelope comprises at least two enveloping parts which, when joined together, form the envelope. Further, the carrier is arranged in thermal contact with at least one of the enveloping parts for dissipating heat out of the illumination device. The method comprises the steps of mounting (4100) the light source in thermal contact with the carrier and enclosing (4200) the light source and the carrier with the envelope. The present invention is advantageous in that it provides a convenient design which facilitates the assembly of the illumination device. Further, the present invention is advantageous in that it provides an illumination device with improved heat transfer.
US09360199B2	Electric actuator system An electric actuator system for hospital and care beds (1, 20) for adjusting e.g. the lying surface of the bed (1, 20). The actuator system is connected to one or more light sources (19, 23, 24), which may be switched on if a change in the patient's movement pattern and/or position in the bed (1, 20) is registered. The electric actuator system may thus help the patient navigate around the room.
US09360195B2	Utility illumination device A utility illumination device comprises a first end member, a second end member and a light tube coupled between the first end member and the second end member. The first end member has at least one faceted surface along an edge thereof. Analogously, the second end member has at least one faceted surface along an edge thereof. The illumination device further comprises an illumination assembly within the light tube that comprises a light source. The illumination device is manually adjustable to change the direction of light emitted from the illumination device.
US09360188B2	Remote phosphor element filled with transparent material and method for forming multisection optical elements Lighting components and fixtures having optical elements with multiple portions are disclosed. A wavelength conversion element can be mounted over a source, the wavelength conversion element including wavelength conversion material remote to the source, such as on or near the outside surface of a conversion element. The element can be filled with a transparent and thermally conductive material which thermally couples the remote conversion material and the source, aiding in thermal dissipation and improving fixture efficacy. An optical element can be formed by using an embossing plate to form a first portion, partially curing the first portion, removing the embossing plate, and introducing material to form a second portion.
US09360177B2	Portable light, such as a stick light A portable light includes an elongated housing having a first end and a second end, and an opening formed in a side of the elongated housing between the first and second ends. The portable light also includes a light source positioned within the opening of the elongated housing, and an actuator positioned within the opening of the elongated housing and electrically coupled to the light source. The actuator is operable to control operation of the light source. The portable light further includes a faceplate removably coupled to the elongated housing over the opening. The faceplate includes a lens that covers the light source and a movable member that covers the actuator.
US09360174B2	Linear LED illumination device with improved color mixing A linear multi-color LED illumination device that produces uniform color throughout the output light beam without the use of excessively large optics or optical losses is disclosed herein. Embodiments for improving color mixing in the linear illumination device include, but are not limited to, a shallow dome encapsulating a plurality of emission LEDs within an emitter module, a unique arrangement of a plurality of such emitter modules in a linear light form factor, and special reflectors designed to improve color mixing between the plurality of emitter modules. In addition to improved color mixing, the illumination device includes a light detector and optical feedback for maintaining precise and uniform color over time and/or with changes in temperature. The light detector is encapsulated within the shallow dome along with the emission LEDs and is positioned to capture the greatest amount of light reflected by the dome from the LED having the shortest emission wavelength.
US09360164B2	Particle manipulation system with stay-wet algorithm A MEMS-based particle manipulation system which uses a particle manipulation stage and a sensor to detect when the sample volume is exhausted or nearly exhausted. The sensor sends a signal to a fluid control means that reverses the pressure between one of the output channels and the input channels, to keep the surfaces wet with a volume of the sample fluid. This volume can be maintained in the channel until an operator intervenes, or it can be repeatedly shuttled back and forth between the input channel and an output channel. By keeping the channels wet, material from the sample stream does not become adhered to the channel walls, which might otherwise irreversibly change or damage the device.
US09360159B2	Fluidtight and thermally insulating tank A fluidtight and thermally insulating tank wall comprises:a multi-layer structure comprising a fluidtight barrier (5) and a thermally insulating barrier (4), retaining rods (22) attached to the bearing wall (7) between the insulating elements and extending in the direction of the thickness of the multi-layer structure to hold the multi-layer structure on the bearing wall, in which crossmembers (30) are attached to the retaining rods (22) such that in each instance a crossmember extends between two retaining rods at the interface between two insulating elements, the cover panels (11) of the insulating elements being connected to the crossmembers (30) so as to be held against the bearing wall via the crossmembers, and the fluidtight barrier (5) being connected to the crossmembers (30) so as to be held against the cover panels of the insulating elements via the crossmembers.
US09360154B2	Systems and apparatuses to support an electronic device Mounting apparatuses, electronic device holders, and components of electronic device holders are shown and described herein. A mounting apparatus is removably connected to an object and the electronic device holder. The electronic device holder is configured to hold an electronic device and has one or more of an adaptor, a movable stand, and one or more portions of a backside thereof that are either clear or removed. The adaptor is removable from the electronic device holder for removal and replacement thereof with one or more additional, different adaptors.
US09360148B2	Bursting head device Provided are articulating, rotating pipe bursting head devices for bursting a buried pipe and simultaneously pulling a replacement pipe through the same location. The bursting heads can comprise an integrated, substantially hollow cone body having one or more cutting knives arranged radially about its outer surface, and an end cap at its posterior end. Protruding from the posterior end of the end cap is a swiveling quick release coupling means for linking the bursting head to a replacement pipe carrier such as a universal duct puller. The swiveling quick release coupling means allows for rotation and articulation of the replacement pipe relative to the bursting head during operation, enhancing entry of the replacement pipe into an existing pipe underground. The bursting head body further can comprise an axial opening at its anterior end for receiving a cable, an internal magnetized cable gripping mechanism and a quick-release tool.
US09360147B2	Heatable fluid line, use thereof and method for producing same A heatable fluid line having a pipeline and an electrical heat conductor extending at least over a section of the pipeline. The pipeline has at least two longitudinal sections that are configured differently in respect of the material properties and/or design thereof. At least one first longitudinal section is formed of a first material and a second longitudinal section is formed of a second material. The material of the second longitudinal section is more flexible and/or has a higher resilience than the material of the first longitudinal section. A described method for producing the fluid line relates to an adaptive attachment of the heat conductor on the outside of the pipeline that permits the heat conductor to be wound around fluid coupling and/or connector parts, in particular the housings by means of which the line is assembled, without strand separation.
US09360146B2	Pipe assembly and flow assurance system A pipe assembly comprising an outer pipe in surrounding relation about an inner pipe, wherein the inner pipe is suspended in free inner ends of legs extended in an annular space that is formed between the outer and inner pipes, the legs reaching radially towards the inner pipe from an inner periphery of the outer pipe. At least one of the legs carries in its inner end a support foot that is formed with a recess facing towards the inner pipe. The recess forms a tunnel that is defined through an outer periphery of the inner pipe and opposite tunnel walls that reach from the leg to the inner pipe.
US09360142B2	Female quick coupling element and quick coupling including such an element This female quick coupling (2) element (10) is intended to cooperate, by press fitting (F1) along a press fitting axis (X10-X20), with a male element (20). It comprises a body (102) centred on a longitudinal axis (X10) of the passage of fluid and comprising a flat front face (108), a relief valve (120) comprising a valve (110) housed in the duct for the passage of fluid and mobile along the longitudinal axis, a manoeuvring ring (130) mounted slidingly around the body and defining, at its distal end (134), a mouth (E10) for receiving the male element. The manoeuvring ring is provided with at least one relief (136) of engagement with a corresponding relief (226) of the male element. The female coupling element further comprises a safety ring (150) mounted around the body (102), radially inside the manoeuvring ring (130), mobile axially in relation to the body (102) between a first position and a second position. The female element further comprises means (170, 158) for transforming, when the safety ring (150) is in its second position, a movement of rotation of the manoeuvring ring, about the longitudinal axis (X10) and in relation to the safety ring (150), into a movement of axial translation of the body (102) in relation to the manoeuvring ring (130).
US09360140B2	Sealing device for a vehicle A sealing device is insertable into a port having an internal wall. The device includes a seal member and a ring member operatively connected to each other. The seal member includes an inner seal surface defining a seal opening. The ring member includes an inner ring surface defining a ring opening. The seal opening and the ring opening share a common central axis. The seal member defines a first rib extending circumferentially around the seal opening, the first rib being raised a first height relative to the inner seal surface at the seal opening. The first rib is configured to be deformable in response to a compression force from the internal wall of the port when the seal member is inserted into the port. The seal member may define a second rib axially spaced from the first rib.
US09360139B1	Non-corrosive low friction pipe support A pipe and pipe support interface structure comprised of a fiberglass C-shaped bearing surface saddle structure having a high strength, low friction, non-corrosive bearing surface block comprised of UHMWPE or other suitable polymer materials is disclosed. The bearing surface saddle structure is adhesively bonded to the exterior surface of a pipe following appropriate pipe surface preparation at locations where the pipe contacts a pipe support surface. The bearing surface block of the bearing surface structure provides an interface between the pipe and pipe support surface in order to protect the pipe from wear caused by bearing on a pipe support. The C-shaped bearing surface saddle structure described will increase the load bearing area of the pipe at the pipe support and serve to prevent wear on both the pipe and the pipe support. The C-shaped bearing surface saddle structure and method may be employed in the field as part of a maintenance and repair program.
US09360130B2	Method for greasing the mated threads of a threaded connector and related device A method for greasing the mated threads of a valve stem and a stem nut of a motor-operated valve without the need to actuate the valve and without the need for an internal grease path within the stem nut includes pressurizing one end of the thread interface defined by the mating threads with pressurized grease. A device for carrying out the method may include a thread lubricator that has a bore that receives the free end of the valve stem and an adapter nut that attaches the thread lubricator to the valve housing. Pressurized grease flows into the thread lubricator and to the one end of the tread interface.
US09360128B2	Graphite/metal valve seal assembly for high temperature control valves A sliding stem control valve includes a valve body, a seat ring located within the valve body and a valve plug slidably mounted within the valve body, the valve plug and the valve seat cooperating to control fluid flow through the control valve. A seal assembly is located between the valve plug and the valve seat, the seal assembly including a metal/graphite seal ring located between a first backup ring and a second backup ring. A biasing element is located adjacent the second backup ring and a retainer ring is located adjacent the biasing element to maintain the biasing element adjacent the second backup ring.
US09360123B2	Valve Disclosed herein is a valve. The valve includes a first member having a first port therethrough, a second member in operable communication with the first member having a sealing surface thereon on an inner radial surface of the second member and a second port therethrough that is movable relative to the first member. The valve also has a seal sealingly engaged with the first member and slidably sealingly engagable with the second member, and a support member movably disposed relative to the first member and the second member. The support member has a support surface dimensioned similarly to the sealing surface, and is movable with the second member relative to the first member so that upon such movement the seal is continuously supported by at least one of the sealing surface and the support surface.
US09360106B2	Hydraulic pressure supply system of automatic transmission A hydraulic pressure supply system supplies hydraulic pressure generated at a hydraulic pump provided with first and second pump chambers formed therein to a high pressure portion and a low pressure portion of the automatic transmission through a high-pressure regulator valve, first and second switch valves, and a low-pressure regulator valve.
US09360103B2	Lubrication system and method for reducing dip lubrication power loss Energy loss in a dip lubrication system is reduced by reducing the immersion depth of the gear within a pool of oil. This can be accomplished by increasing the pressure within the dip lubrication system which effectively reduces the flow rate of the oil so that the oil remains separated from the oil pool for a longer period of time thereby reducing the oil level and the immersion depth of the gear within the oil pool. Alternately, this can be accomplished by substituting a higher density gas for air which has the same effect. In a third embodiment the immersed gear includes wind vanes that direct air against the oil pool creating a trough which effectively reduces the immersion depth of the gear within the oil pool.
US09360094B2	Mechanical member The invention relates to a mechanical member wherein a first part in contact with a second part movable relative to the first part, at least one of the parts including a coating of solid lubricant at least at contact zones between the first part and the second part, the solid lubricant being suitable on its own for lubricating the mechanical member. According to the invention, the mechanical member includes retention and capillary distribution means for distributing a fluid between the parts in such a manner as to form a film between said parts, which film can be pierced temporarily at each contact zone.
US09360088B2	Chain drive tensioner spring force control mechanism A tensioner which adjusts the mean tensioner force to keep the chain tension as low as possible without sacrificing chain control, significantly improving drive efficiency as the chain wears and is subject to low dynamic loads.
US09360084B2	Cutting and splicing apparatus for conveyor belts and method A belt cutting and splicing apparatus is provided for joining together the ends of one or more monolithic conveyor belts. In one form, a belt support is configured to support the belt ends in spaced relation to each other and a non-contact heating device is provided for being disposed between the belt ends to generate thermal radiation for joining the belt ends together. In another form, a drive mechanism is operable to cause relative movement of a pair of platens, for supporting belt ends, toward and away from each other and a heating device between heating and stowed positions. An actuator of the drive mechanism is movable by an operator between at least three operation positions corresponding to three different operation positions of the platens. An on-board belt cutting mechanism is provided for precision cutting of the belt ends using the same apparatus for both belt cutting and splicing operations.
US09360080B2	Torsional compensator A parallel, torque additive torsional compensating device for an internal combustion engine is provided. The torsional compensating device comprises a first gear, a first joint assembly, an intermediate shaft, a second joint assembly, a torsional element, and a second gear. The first gear and the second gear are in respective driving engagement with a first engagement portion and a second engagement portion of an output of the engine. The intermediate shaft is in driving engagement with the first joint assembly and the second joint assembly. The torsional element is in driving engagement with the second joint assembly and the second gear. An angular deviation of at least one of the first joint assembly and the second joint assembly causes a cyclical acceleration of the torsional element. The cyclical acceleration applies a torque to the output of the internal combustion engine through the second gear and the second engagement portion.
US09360072B2	Brake mechanism and clutch unit Provided is a brake mechanism including a brake-side outer race, a brake-side cam having an outer peripheral surface, a first movable piece disposed between the inner peripheral surface of the brake-side outer race and the outer peripheral surface of the brake-side cam, and a transmission member provided adjacent to the brake-side cam in an axial direction. The brake-side cam includes a plate-like main body and a first protrusion protruding from a side of the main body facing the transmission member. The first movable piece is disposed to have a portion thereof protruding beyond the side of the main body facing the transmission member. The transmission member is shaped like a flat plate, and includes a first opening configured to allow the first protrusion to be received and engaged therein and a second opening configured to allow the first movable piece to be received and engaged therein.
US09360069B2	High resolution one-way clutch using graduated engagement in a radial arrangement An automatic slack adjuster for a vehicle brake includes a one-way clutch having first and second parts rotatable about an axis. The first part is rotatable in both a drive direction and a slip direction opposite to the drive direction, while the second part is driven about the axis by the first part when the first part rotates in the drive direction, but not driven when the first part rotates in the slip direction. Movable elements are carried within receptacles distributed circumferentially about and projecting into one of the parts, and are displaceable so as to move within the receptacles in radial directions relative to the axis. The movable elements engage corresponding surfaces of teeth that are immovably fixed on or form part of a circumferential surface of the other of the parts.
US09360063B2	Method for the reconditioning and use of brake discs of the rear stator type with studs, assembled disc and corresponding stack of discs A method for the reconditioning and use of brake discs of the rear stator type with studs. The method includes the steps of using a first disc (12) during a first life, using a second disc (112) during a first life, after the first life of the first disc and the first life of the second disc, machining a friction surface on one of the discs and a rear surface on the other of the discs so that one of the surfaces has at least one shoulder (17) and the other of the surfaces has at least one notch (118). Finally, the first disc is nested in the second disc such that the notch and the shoulder cooperate so as to center the discs.
US09360061B2	Prime mover arrangement comprising a fluid-actuated clutch arrangement and a freewheel The invention relates to a prime mover arrangement comprising an internal combustion engine (1) for driving a first shaft (2) and comprising a steam engine (4), which is connected to the first shaft by means of a clutch arrangement (3), for driving a second shaft (5). Furthermore, a freewheel (6) which interacts with the clutch arrangement (3) is arranged between the first shaft (2) and the second shaft (5) in order to transmit a rotational movement of the second shaft (5) to the first shaft (2) in a first operating mode and to allow the first shaft (2) to freewheel relative to the second shaft (5) in a second operating mode. The clutch arrangement (3) is designed as a fluid-actuated clutch arrangement (3) which can be operated with positive pressure or negative pressure and bridges the freewheel (6) in a friction-fitted or form-fitted manner in order to transmit the rotational movement of the internal combustion engine (1) to the second shaft (5) via a flange (7) arranged on the first shaft (2).
US09360060B2	Ratchet wrench with a direction switching device A ratchet wrench includes a direction switching device. The direction switching device includes two switching members for controlling the rotational direction of a gear, a resilient unit disposed among a body and the switching members for biasing the switching members away from the gear, and a ring unit disposed rotatably on the body. The ring unit includes a convex portion and a concave portion, and is operable to allow the convex portion and the concave portion to act on the switching members, so that one of the switching members comes into contact with the gear, while the other of the switching members is removed from the gear. When no external force is applied to the ring unit, the switching members are biased by the resilient unit to remove from the gear.
US09360056B2	Hydraulic transmission control system and method thereof The present disclosure provides a method of controlling a transmission of a powered vehicle. The method includes determining if the powered vehicle is in a launch condition, activating a solenoid, controlling a hydraulic valve to a first position, and providing hydraulic pressure from at least one of a first hydraulic pump and a second hydraulic pump to the hydraulic valve. The method also includes controlling the hydraulic pressure through the hydraulic valve to a first clutch, determining if the launch condition is complete, deactivating the solenoid after the launch condition is complete, controlling the hydraulic valve from the first position to a second position, and substantially limiting hydraulic pressure from passing through the hydraulic valve to the first clutch.
US09360052B2	Shaft collar In one embodiment there is provided a shaft collar having a two component structure defined by a first component having a central bore for receipt of a shaft or axle and a second component positioned partially within the first component. The second component also having a relatively harder stiffness than the first component. The second component further includes a pair of opposing ribs positioned within the first component and about the central bore and a pair of C-shaped caps separately positioned against upper and lower ends of the pair of ribs and wherein the pair of opposing ribs have a height such that the at least a portion of the pair of C-shaped caps protrude from the upper and lower faces of the first component.
US09360034B2	Locking device and method for fixation of components to tubes A locking device designed to lock objects to tubes or other elongated elements that generally comprises one or more lock plates and lock housings. In one exemplary embodiment, when assembling the locking device to a tube, two lock housings are put together with open sides against each other around a tube with a dimension corresponding to approximately half of a recess which is found on the lock housing's sides and are oriented in the tube's axial direction. The two lock housings form a closed geometry around the tube. Lock plates are used to connect the two lock housings together. By applying a screw in a threaded hole in one of the lock housings' cover, the through tube is pressed against an opposite lock housing at substantially the same time as the lock plates hold the lock housings together.
US09360032B2	Fastening system for connecting non-load bearing wall to truss A fastener assembly for connecting a non-load bearing wall to a truss comprises a fastener with a sleeve retained on the fastener and axially displaceable along the fastener. The fastener has unthreaded shank portion and the sleeve is disposed about the unthreaded shank portion. The sleeve has a length less than the axial length of the unthreaded shank portion. The fastener assembly is employed to form a truss/non-load bearing wall connection system, wherein the non-load bearing wall is disposed below the truss and has a top plate with at least one bore. A fastener assembly is disposed in each bore and threaded into the truss so that a gap is formed between the truss and its top plate. Upon deflection of the truss, one or more fasteners vertically slide axially relative to its associated sleeve.
US09360029B2	Frictional Coupling A coupling between a first surface and a second surface is disclosed. The first surface includes a first shape and has a surface roughness average that is less than or equal to about 500 microinches (13 microns). The second surface includes a second shape and projections, in a preselected pattern, forming at least a portion of the second surface. The first shape of the first surface and the second shape of the second surface are substantially complementary. The projections are configured to produce a friction fit between the first surface and the second surface when the first and the second surfaces are biased against each other. An average elastic compressive range, substantially equal to the surface roughness average of the first surface, is associated with the projections.
US09360019B2	Fan A blower fan includes a heat source contact portion. A side wall portion includes a tongue portion. In a plan view, The heat source contact portion is arranged to cover a portion of a region surrounded by a third imaginary straight line tangent to an outer circumferential surface of a blade support portion and extending in parallel with the second imaginary straight line toward the air outlet in the first region, a fourth imaginary straight line tangent to the outer circumferential surface of the blade support portion and extending in parallel with the first imaginary straight line in the third region, the outer circumferential surface of the blade support portion, and the air outlet.
US09360016B2	Body cooling system A system for cooling a user's body is provided. The body cooling system provides a rigid head covering, a ventilation component and an internal deflector component. The ventilation component may be integrated into or be removably attached to the rigid head covering. The internal deflector component directs air flow from the ventilation component along the user's body.
US09360014B2	Chopper pump with mixing nozzles for a sewage wet-well Systems and methods for conditioning sewage having entrained solids which clog sewage pumps, are disclosed. Systems include a sewage pump, a chopper pump, and a mixing nozzle connected to the chopper pump. Specifically, the sewage pump is a non-clog centrifugal pump having an inlet for drawing fluid into the pump and an outlet for discharging the fluid into a pipe, while the chopper pump has an inlet for drawing fluid into the pump and an outlet for discharging the fluid into the wet-well. The chopper pump may be positioned either in or adjacent to the wet-well. The mixing nozzle fluidly coupled to the chopper pump discharge, is positioned in the wet-well. Methods include the steps of positioning a chopper pump within the wet-well, drawing in liquid sewage, including the entrained solids, reducing the size of entrained solids, and discharging the sewage and reduced size solids into the wet-well.
US09360013B2	Scroll pump having axially compliant spring element A scroll pump includes a frame, a stationary plate scroll, an orbiting plate scroll, a tip seal(s), an eccentric drive mechanism which drives the orbiting plate scroll, and an axial compliance system. The eccentric drive mechanism includes a crankshaft, and bearings and a counterbalance disposed on the crankshaft. The counterbalance is mounted so as to be slidable along the crankshaft in the axial direction of the crankshaft. The axial compliance system includes a flexure and one set of springs for pre-loading the bearings. The flexure is interposed between one of the bearings and the counterbalance. The flexure allows the orbiting plate scroll to move away from the stationary plate scroll in the case of an assembly process which would otherwise result in the tip seal(s) being too forcefully engaged with the plate of the opposing plate scroll.
US09360012B2	Differential pressure regulating valve and motor-driven compressor having differential pressure regulating valve A differential pressure regulating valve is disposed in a fluid passage. The differential pressure regulating valve includes a valve chamber, a valve hole, a valve body, a support member and an urging member. The valve chamber is formed in the fluid passage and having a cylindrical shape. The valve hole is formed in the fluid passage as an opening which communicates with the valve chamber. The valve body is disposed in the valve chamber and adapted to open and close the valve hole. The support member is fixedly mounted to the valve chamber and extending across flowing direction of the fluid in the valve chamber. The support member has a communication passage for fluid communication between a first valve chamber and a second valve chamber. The urging member is disposed between the support member and the valve body for urging the valve body toward the valve hole.
US09360006B2	Primary piston correction during transfer A method for controlling operation of a pump unit, where the pump unit includes a primary piston pump having a primary piston and a secondary piston pump having a secondary piston. The primary piston pump is fluidically connected with the secondary piston pump. The primary piston pump includes an inlet valve and an outlet valve, and the pump unit operates periodically according to a pump cycle. The method includes determining a fluid pressure of fluid dispensed by the pump unit, and performing a closed loop control of a position of the primary piston in dependence on the fluid pressure of the fluid dispensed by the pump unit during a first time interval of the pump cycle.
US09360001B2	Suction valve for a refrigeration compressor and its mounting process The compressor comprises a valve plate, to be affixed to a compressor block, and a suction valve (V) formed by a spacer body, having a median opening and a flexible vane, which has a fixing end portion provided with a contour, symmetrical or asymmetrical, in relation to a longitudinal axis (X) of the flexible vane and which presents peripheral edge portions to be seated against respective inner edge portions of the median opening for restricting coplanar, linear and angular displacements of the flexible vane in relation to the spacer body upon seating the flexible vane against the valve plate, in the interior of the median opening.
US09360000B2	Reciprocating pumps and related methods Reciprocating fluid pumps include a pump body including a cavity therein, a plunger located at least partially within the cavity, and a shift canister assembly disposed within the cavity. The shift canister assembly includes a sealing surface for forming a seal against the pump body. An area covered by the seal between the sealing surface and the pump body is less than about 75% of an outer cross-sectional area of the shift canister assembly. The shift canister assembly may include a shift canister and a shift canister cap attached thereto, the shift canister cap comprising the sealing surface. Reciprocating fluid pumps include a shift canister, a shift piston at least partially disposed within the shift canister, and a shift canister cap attached to the shift canister on a longitudinal end of the shift canister opposite the shift piston. Methods include forming such reciprocating pumps.
US09359997B2	Method and system for producing electricity from airport acoustical energy A system and method for generating electricity from acoustic energy from an aircraft on a runway. Acoustic wave collectors mounted along the runway collect the acoustic energy and direct such acoustic energy to an associated acoustic converter assembly. A vibrating element is mounted within a housing of the acoustic converter assembly. The vibrating element moves in response to the acoustic energy. This movement draws air into the housing below the vibrating element and then forces the air downward to form an output air flow. The output air flow is directed to an associated turbine assembly to cause a shaft to rotate at a rate proportional to the magnitude of the received output air flow. An associated generator that is coupled to the shaft generates electricity proportionally to the rate of rotation of the shaft. The electricity from each generator is converted and sent to a substation for distribution.
US09359994B2	Module-handling tool for installing/removing modules into/from an electromagnetic rotary machine having a modularized active portion A module-handling tool for facilitating installation, servicing, and/or dismantling of a electromagnetic rotary machine, such as an electrical power generator or electric motor, having a modularized active portion. In one embodiment, module-handling tool is configured for a machine having a modularized stator having a number of removable modules. In one example of such stator-module-handling tool, the tool is designed and configured to hold a stator module and be temporarily secured to the rotor of the machine during the process of installing the stator module into the machine or removing the module from the machine. In this example, the module-handling tool also acts as a module carrier for transporting a module to or from the machine.
US09359993B2	Wind turbine assembling method and wind turbine assembled according to said method A wind turbine tower that may be assembled fast, including a nacelle and a rotor, the tower comprising at least two stackable annular sections made of concrete connected through a main connecting arrangement adapted to withstand loads induced by the wind turbine rotor, and an auxiliary connector.
US09359991B2	Energy conversion systems and methods An energy conversion system may include a stationary structure, a rotatable structure configured to rotate relative to the stationary structure, wherein the rotatable structure defines an axis of rotation. The system may further include at least one blade member mounted to and extending radially outward from the rotatable structure, the at least one blade member being configured to interact with fluid currents flowing in a direction substantially parallel to the axis of rotation to cause the rotatable structure to rotate about the axis of rotation, and at least one bearing mechanism disposed to provide at least one of a radial and axial bearing between the rotatable structure and the stationary structure as the rotatable structure rotates about the stationary structure. The system may be configured to convert rotation of the rotatable structure to at least one of electricity and hydrogen production.
US09359982B2	Air cleaner assembly and filter element providing improved dynamic wall stiffness An air cleaner assembly and a filter element reduce wall noise by rigidly coupling the movement of opposing air cleaner housing sidewalls through the installed filter element. The sidewalls are rigidly coupled through the filter element with the sidewalls coupled to move together in unison such that wall deflection forces created by the pressure pulsations tend to cancel each resulting in improved dynamic stiffening of the air cleaner walls and reduced wall noise.
US09359977B2	Fuel vapor recovery canister A vehicle fuel system includes a vapor recovery canister containing at least two carbon beds. Each carbon bed is configured to capture hydrocarbon material associated with fuel vapor discharged from a vehicle fuel tank into the canister.
US09359974B2	High performance liquid rocket propellant Disclosed is a process of fueling a rocket engine or air-breathing engine for a hypersonic vehicle with a high performance hydrocarbon fuel characterized by a hydrogen content greater than 14.3% by weight, a hydrogen to carbon atomic ratio greater than 2.0 and/or a heat of combustion greater than 18.7 KBtu/lb. The disclosed fuels generally have a paraffin content that is at least 90% by mass and a C12-C20 isoparaffin content of at least 40% by mass.
US09359971B2	System for controlling deposits on cylinder liner and piston of reciprocating engine A system includes a reciprocating engine having a cylinder liner and a piston disposed within the cylinder liner. The cylinder liner includes an inner wall and extends around a cavity. The inner wall includes a first axial end, a second axial end, a piston travel portion, and a top portion. The top portion is nearer to the first axial end of the cylinder liner than to the second axial end of the cylinder liner. The top portion has a first surface finish with a first roughness average (Ra1) greater than approximately 2 μm and a total waviness (Wt) less than approximately 0.1 mm. The piston is configured to move in a reciprocating manner within the cylinder liner. The piston includes a top land configured to be radially opposite the top portion of the inner wall of the cylinder liner when the piston is at a top dead center position.
US09359967B2	Method for identification of a threshold-level catalyst Systems and methods for estimating catalyst transfer function gain are disclosed. In one example, an air-fuel ratio forcing function is applied to a catalyst. Air-fuel ratios upstream and downstream of the catalyst are manipulated to determine a transfer function gain of the catalyst. The transfer function gain may be a basis for indicating the presence or absence of catalyst degradation.
US09359966B2	Evaporative emission control A method for operating a fuel system is disclosed. The method includes sequentially purging fuel vapors from each of a plurality of regions of a canister. Purging a region includes opening an air inlet valve associated with that region and maintaining air inlet valves associated with each other region closed to direct fuel vapors to at least one purge outlet.
US09359957B2	Planet gear for air turbine starter system A planet gear for use in an air turbine starter is formed of a first part having a set of gear teeth at a first axial location. A shaft extends axially away from the first set of gear teeth. A second part is interference fit on the first part, with the second part having a second set of gear teeth. The second part is mounted on the shaft of the first part. An outer diameter of the shaft is selected to be significantly larger than an inner diameter of a cylindrical portion of the second part which is interference fit on the shaft. A ratio of the outer diameter to the inner diameter is between 1.0005 and 1.0100. A planetary gear system, an air turbine starter and a method of installing a planet gear are also disclosed.
US09359955B2	Apparatus and method incorporating a transition AFT support for a gas turbine engine An apparatus for supporting an aft portion of a transition duct in a gas turbine engine includes a transition aft frame that engages with an annular shaped stator component disposed in a turbine section of the gas turbine engine. The transition aft frame includes radially inner and outer panels and circumferentially spaced first and second side panels connecting the inner and outer panels. A forward face of the stator component includes first and second connection points circumferentially spaced apart. The transition aft frame includes first and second attachment structures that respectively engage with the first and second connection points when the transition duct is aligned axially with the stator component. The first and second attachment structures are spaced apart in a manner effective to transfer moment load from the first and second attachment structures to the first and second side panels respectively.
US09359952B2	Turbine engine heat recuperator plate and plate stack A heat recuperator includes a plurality of channel walls composed substantially of thermally-conductive material and supported in spaced-apart relation, defining fluid channels and interstices therebetween. The fluid channels receive at least one primary fluid flow and the interstices receive at least one secondary fluid flow so as to effect heat exchange between the two flows. In use, the plurality of channel walls are deformable by pressure differential between the primary and secondary fluid flows. When at least some of the channel walls are in a deformed state, the plurality of channel walls are stabilized through press fit engagement of mutually opposed contact regions formed in adjacent pairs of the channel walls.
US09359951B2	Inlet bleed heat system and related method for a compact gas turbine inlet An inlet system for a gas turbine includes an inlet air duct; a silencer disposed in the inlet air duct, the silencer including a plurality of panels with spaces between the panels; and a conduit with orifices disposed to inject inlet bleed heat into each of the spaces. A method of conditioning inlet air for a gas turbine includes flowing air through spaces between panels of a silencer in an inlet air duct of the gas turbine, and injecting inlet bleed heat through orifices and into each of the spaces.
US09359946B2	Internal combustion engine and method for manufacturing the same An internal combustion engine having an anodic oxidation coating formed on at least a part of a wall surface that faces a combustion chamber, wherein the anodic oxidation coating has voids and nano-holes smaller than the voids; at least part of the voids are sealed with a sealant derived by converting a sealing agent; and at least a part of the nano-holes are not sealed.
US09359922B2	Valve control means for an internal combustion engine and internal combustion engine The invention relates to a valve control means (1) for an internal combustion engine, having two cams (2, 3) which are arranged one behind another on a camshaft (20), the cams (2, 3) having different cam contours, a drag lever system (4), having a first lever (5), a second lever (7) which is connected to the first lever (5) such that it can be rotated about a pivot point (6), and a third lever (8) which is connected fixedly to the first lever (5), the first lever (5) having a roller pickup (15) for a first cam (2) and the second lever (7) having a roller pickup (17) for the second cam (3), the third lever (8) having a slotted guide (9) for the rectilinear positive guidance of a valve (30), the drag lever system (4) being mounted at the pivot point (6) such that it can be adjusted on a circular path (10) about the rotational axis (21) of the camshaft (20) in a cylinder block or cylinder head of the internal combustion engine, and having a play compensation element (11) between the second lever (7) and the first lever (5) or the third lever (8) for play compensation and for limiting the rotatability of the second lever (7) with respect to the first lever (5) and the third lever (8). Furthermore, the invention relates to an internal combustion engine, having at least one valve control means of this type.
US09359910B2	Method and apparatus for measuring operational gas turbine engine housing displacement and temperature by a distributed fiber optic sensing system utilizing optical frequency domain reflectometry Operational gas turbine engine housing or casing dynamic strain, temporary or permanent displacement and/or temperature is measured by a distributed fiber optic sensing system (DFOSS) utilizing optical frequency domain reflectometry (OFDR) that is coupled to the turbine engine housing. The DFOSS/OFDR system measures localized variances in strain along the length of an optical fiber (OF), which are correlated with turbine engine housing displacement. Temperature influence on the measured localized strain variances is accounted for by obtaining temperature information from an another measurement system or by taking the same type OFDR measurements on unrestrained optical fiber (OF) and deriving compensated strain measurements that are not temperature influenced. The derived strain measurements along the DFOSS are correlated with housing displacement. Other embodiments include separate displacement measuring modules, each including DFOSS optical fibers, coupled along the engine housing.
US09359908B2	Film riding seal assembly for turbomachinery An aerodynamic seal assembly for a rotary machine includes multiple sealing segments disposed circumferentially intermediate to a stationary housing and a rotor. Each of the segments includes a shoe plate with a forward load-bearing section and an aft load-bearing section configured to generate an aerodynamic force between the shoe plate and the rotor. The shoe plate includes at least one labyrinth teeth facing the rotor and positioned between the forward load-bearing section and the aft load-bearing section. The sealing segment also includes at least one spring connected to a pedestal located about midway of an axial length of the shoe plate and to a stator interface element. Further, the sealing segment includes a rigid segmented secondary seal attached to the stator interface element at one first end and in contact with the pedestal of the shoe plate at one second end.
US09359898B2	Systems for heating rotor disks in a turbomachine A system includes a turbomachine. The turbomachine includes at least one rotor disk. The system also includes a rotor disk heating system configured to resistively heat at least a portion of the at least one rotor disk via an electrical current or voltage applied to the portion of the at least one rotor disk.
US09359891B2	LWD in-situ sidewall rotary coring and analysis tool An apparatus for estimating a property of an earth formation includes a carrier configured to be conveyed through a borehole penetrating the formation and a single probe configured to be extended from the carrier and to seal with a wall of the borehole. The apparatus further includes a fluid analysis sensor disposed at the carrier and configured to sense a property of a formation fluid sample extracted from the formation by the probe. A coring device is disposed at the carrier and configured to extend into the probe, to drill into the wall of the borehole, and to extract a core sample. A core sample analysis sensor is disposed at the carrier and configured to sense a property of the core sample. A processor is configured to receive data from the fluid analysis sensor and the core sample analysis sensor and to estimate the property using the data.
US09359889B2	System and methods for selective shorting of an electrical insulator section A bottom hole assembly attached to a drillstring includes a main body including multiple electrical insulator sections along a length thereof, each of the electrical insulator sections configured to have a voltage difference generated there across, wherein a transmitting electrical insulator section having a voltage difference generated there across is configured to remain open, and wherein all remaining electrical insulator sections are configured to be electrically shorted there across.
US09359884B2	Positioning tool A positioning tool for determining the position of the tool in a case downhole. The positioning tool utilizes a detecting unit which includes at least a first magnet and a first sensor in a first plane as well as a second sensor also arranged in the first plane. The first and second sensors are configured to detect changes in a magnetic field generated by the first magnet. The first sensor is arranged at a first distance from the first magnet and the second sensor is arranged at a second distance from the first sensor in the first plane.
US09359882B2	Monitor and control of directional drilling operations and simulations Various embodiments include apparatus and methods that use hand mobile communications device with respect to a drilling operation at a drilling site. Data with respect to one or more sensors downhole at a drilling site can be wirelessly received in the hand mobile communications device. Representations of the received data can be displayed on a graphical user interface screen of the hand mobile communications device. The representations can include displaying the data in a graphical representation, a numerical representation, or a graphical and numerical representation on the graphical user interface screen. Additional apparatus, systems, and methods are disclosed.
US09359872B2	Downhole system with filtering and method A downhole system includes a tubular having a plurality of spaced apertures radially extending through a wall of the tubular. A section of the tubular blocking radial fluid flow through the wall between an interior and exterior of the tubular. The section arranged from a first end to a second end of the tubular. A plurality of filter pucks respectively inserted into at least some of the plurality of apertures. The filter pucks each including a body configured for insertion in one of the apertures and a filtering element within each body; and, at least one control or monitoring line arranged on the section. Further is a method of controlling sand in a downhole system.
US09359865B2	Pressure actuated ported sub for subterranean cement completions A shifting sleeve has differential piston areas so that applied pressure displaces the sleeve against spring bias, which preferably is a series of Belleville washer stacks associated with modular mandrel components, to obtain the desired opposing force to the movement initiated with pressure applied to differential piston areas. An indexing feature is located between the sleeve and the mandrel passage wall and on a predetermined number of cycles disables the Belleville washer stacks from biasing the sleeve in an opposed direction as when pressure is applied. At this time the pressure in the mandrel acting on the differential piston area simply shifts the sleeve to open a lateral port so that fracturing through the cement that was earlier placed with the port closed can take place.
US09359861B2	Downhole packer tool with dummy slips A packer tool having simple and reliable setting and release systems comprising three or more slips evenly distributed around a mandrel. Each slip comprises two members with gripping teeth which, except for one slip, typically have the capacity to grip a well casing in opposite axial directions. The remaining slip has only one member with teeth able to grip the casing, the other slip member has dummy teeth with nil gripping capacity. The latter teeth have blunt or rounded edges and are not slanted in a selective gripping direction as the sharper teeth of the other slip members.
US09359857B2	Setting assembly and method thereof A setting assembly including a settable member. A housing including a chamber and a setting material disposed in the chamber and having a first phase of matter and a second phase of matter. The setting material occupying a greater volume in the second phase than in the first phase. The setting material arranged to exert a setting force on the settable member during transition of the setting material from the first phase to the second phase. Also included is a method of setting a settable member.
US09359855B2	Bottom set down hole tool A flow back plug, a bridge plug, a ball drop plug and plug with a disintegratable check therein are made from a common subassembly including, in some embodiments, a mandrel, a slips/seal section, a setting assembly and a mule shoe. In other embodiments, the common components are a mandrel, a slips/seal section and a mule shoe. To make the flow back plug, a ball check is placed in the mule shoe. To make the bridge plug, an obstruction is inserted in the mule shoe. To make the ball drop plug, the mule shoe is left unobstructed so any ball dropped in a well seats in a tapered inlet to the mandrel. To make a plug with a disintegratable check, a ball dropped in the well is of a type that disintegrated in frac liquids. The setting assembly includes a setting rod connected to a setting device in the mandrel passage. When the plug is expanded into sealing engagement with a production string, the setting rod pulls out of the setting device leaving a passage through the mandrel and through the setting device. Another embodiment is an improved adapter sleeve used on conventional setting tools.
US09359854B2	Wellbore tools and methods A straddle packer tool for setting against a constraining wall includes: a drag assembly with a locking mechanism for locking a position of the drag assembly relative to the constraining wall; a mandrel installed in and axially moveable through an inner bore of the drag assembly; and a packing element housing including a first annular packing element and a second annular packing element spaced from the first annular packing element, the packing element housing positioned between a stop shoulder on the mandrel and the drag assembly, the packing element being settable to expand the first annular packing element and the second annular packing element by compression between the drag assembly and the stop shoulder. A valve sub including a pressure actuated piston is also described and may be operated to open using the straddle packer tool.
US09359851B2	High energy tubular shear A high energy tubular shear is connectable within a drilling system and includes a body forming a bore through which a tubular is disposed, a cross-bore intersecting the bore, opposing cutters moveably positioned in the cross-bore on opposite sides of the bore, and the each cutter in hydraulic communication with a respective hydraulic intensifier.
US09359844B2	Downhole driving unit having a spring member for assembling a hydraulic motor housing The present invention relates to a downhole driving unit (11) for insertion into a well, comprising a driving unit housing (51), a hydraulic motor (23) comprising a hydraulic motor housing (93), a wheel assembly (90) comprising a stationary part (91) and a rotational part (92), the stationary part being connected with the driving unit housing and being rotatably connected with the rotational part, the stationary part and the rotational part constituting the hydraulic motor housing, the rotational part comprising a wheel ring (99) closed from one end, wherein the wheel assembly comprises a spring member (113) assembling the hydraulic motor housing. The present invention also relates to a downhole system comprising the driving unit according to the invention and an operational tool connected with the driving unit for being moved forward in a well or borehole as well as to a use of the driving unit according to the invention in a well or borehole for moving itself and/or an operational tool forward in a well or borehole.
US09359838B2	Two-piece connection lift system and method A connection lift system for handling oil and gas drilling tubular components includes a core component and a ring-shaped component. A range of ring-shaped components may be screwed onto the core component. The ring-shaped component may be configured based on the tubular component to be handled, and the core may be compatible with lifting equipment. A method for handling tubular components is also provided.
US09359834B2	Method for installing multiple sensors in unrolled coiled tubing A method for installing multiple fiber optic cables in coiled tubing in oil and gas operations.
US09359832B2	Mechanical bending weak link A method and a safety device are disclosed for protection of well barrier(s) against excessive bending moments from a riser. The safety device is arranged to detect critical bending loads in or in between the well barrier(s) and/or riser, and may include: a device for detecting changes in a curvature between a load carrying riser pipe and an unloaded stiff body attached to or in the vicinity of the riser pipe, said device for detecting changes in the curvature being arranged to measure a relative distance between the load carrying riser pipe and the unloaded stiff body, and a device for triggering disconnection of a releasable riser connector when the distance between the load carrying riser pipe and the unloaded stiff body reaches a predefined critical distance.
US09359823B2	Systems and methods of adjusting weight on bit and balancing phase Disclosed are systems and methods of balancing weight distribution between downhole cutting tools. One system includes a drill bit arranged at a distal end of the bottom-hole assembly, a first sensor sub arranged proximate to the drill bit and configured to monitor one or more operational parameters corresponding to the drill bit, a reamer axially-offset from the drill bit on the bottom-hole assembly, a second sensor sub arranged proximate to the reamer and configured to monitor one or more operational parameters of the reamer, and a communications module communicably coupled to the first and second sensor subs and configured to communicate one or more corrective action signals when the one or more operational parameters of the drill bit and the reamer surpass a predetermined operating threshold.
US09359822B2	Floating plug pressure equalization in oilfield drill bits A drill bit of the type used to drill a wellbore in the earth can comprise a bore formed in the drill bit, and a plug sealingly and reciprocably disposed in the bore, whereby the plug prevents fluid communication between sections of the bore in the drill bit. The plug can comprise a spherically-shaped member. The plug can comprise a floating plug sealingly and reciprocably disposed in the bore, whereby pressure in the different sections of the bore on respective opposite sides of the plug is substantially equalized.
US09359818B1	Utility holding device A utility holding device is suitable for carrying tools and materials at a construction site. The utility holding device is especially useful for carrying tools and materials for an electrician or a plumber. The wheels provide mobility. The ladder attachment permits a utility holding device to be safely used with a ladder. The scaffold attachment permits a utility holding device to be safely used with a scaffold.
US09359815B2	Device for controlling the actuation of a group for moving a curtain/awning A device for actuating a curtain/awning in a double glazing includes a pulley supported by support elements connected to connection elements integrally connected to a wall of the double glazing at the movement group. A ring of cord is partially wound around the pulley and is maintained taught by a tensioning element, it too connected to the wall of the double glazing. By applying a tension to the cord ring, a torque is generated tending to rotate the pulley. The torque is transmitted by suitable transmission elements to the group for moving the curtain/awning. The support elements of the pulley are separated from the connection elements for values of tension applied to the cord ring that are greater than a pre-established limit value. The separation cancels the tension of the cord.
US09359814B2	Systems for maintaining window covers A spring drive system includes a housing and an extendable window cover that is coupled to the housing. The window cover has at least one lift cord that is employed to retract the window cover. The system also includes a first cord spool and a spring drive system having at least one spring having a storage end that is operably coupled to a storage spool and an output end that is operably coupled to an output spool. The lift cord extends from the first cord spool to the window cover, and the spring drive system has an output that controls tension on the first cord spool and no external hand-operated control cord as an input used to raise and lower the window cover.
US09359813B2	Roll-up coverings for architectural openings and related methods, systems and devices The disclosure provides roll-up coverings for an architectural opening, and various embodiments of ladder tapes. Embodiments of the roll-up covering include a roller, a first outer elongate tape, a first inner elongate tape and a plurality of slats disposed between the outer and inner elongate tapes. The first inner elongate tape can further defines a plurality of collapsible hinge segments disposed along the length of the first inner elongate tape. The collapsible hinge segments can be configured to collapse in order to decrease the effective length of the first inner elongate tape when the first inner elongate tape is rolled up around the roller. The collapsible hinge segments can further be configured to expand in order to increase the effective length of the first inner elongate tape when the roll-up covering is unrolled from the roller.
US09359810B2	Fluidtight fire door The subject of the present invention is a watertight fire door for closing an opening in a building or edifice comprising, on the one hand, a fixed frame and at least one opening leaf and, on the other hand, sealing means that provide sealing between the fixed frame and the opening leaf when the door is closed. The or each opening leaf comprises, on the one hand, a framework surrounding an empty space capable of accepting or forming a thermal insulator and being sandwiched between two layers and of thermal insulation each essentially produced from a material having low thermal conductivity or diffusivity and, on the other hand, if appropriate, at least one thermal break.
US09359784B2	Fast transportable drilling rig system The present invention discloses a high-capacity drilling rig system that includes novel design features that alone and more particularly in combination facilitate a fast rig-up and rig-down with a single set of raising cylinders and maintains transportability features. In particular, a transport trailer is disclosed having a first support member and a drive member which align the lower mast portion with inclined rig floor ramps and translate the lower mast legs up the ramps and into alignment for connection. A pair of wing brackets is pivotally deployed from within the lower mast width for connection to the raising cylinder for raising the mast from a horizontal position into a vertical position. A cantilever is pivotally deployed from beneath the rig floor to a position above it for connection to the raising cylinder for raising the substructure from a collapsed position into the erect position.
US09359778B1	Thixotropic concrete forming system The present invention discloses a method and a forming system that reduces the hydrostatic pressure caused by casting freshly mixed concrete or other cementicious material into a vertical form. Reducing the hydrostatic pressure in forms enables relatively weak materials to be used as forms and minimizes the amount of bracing necessary to support the forms—both of which lead to lower construction costs. The method uses the highly thixotropic properties of no-slump or low-slump concrete which enable the concrete to be quickly changed from a semi-solid state to a liquid state and back to a semi-solid state numerous times before it hardens and without affecting the concrete's quality. Since hydrostatic pressure is only present when a liquid state exists, minimizing the amount of liquid concrete in vertical forms will also minimize the hydrostatic pressure present.
US09359775B2	Substructure for supporting a wood flooring and flooring system comprising the same The present invention relates to a substructure unit (1) for a flooring system (10), said substructure unit (1) comprising a first series (2) of panels (3) arranged in parallel and being fixed under a second series (4) of panels (3) arranged in parallel, said first series and second series (2 and 4) of panels (3) being arranged in a criss-cross manner to form a diagonal lattice, said panels (3) of said first and second series (2, 4) having bevelled cut ends (5, 6) extending outwardly from said lattice to form coupling means to interconnect at least two substructure units (1).
US09359767B2	Z-shaped closure member with filter retention features A Z-closure member for raised seam roofs is formed through bending techniques into a shape having a ventilated central vertical member, an upper mounting flange terminating in an upper tab member, and a lower flange member extending in an opposing direction from the upper mounting flange member and terminating in a flexible locking tab. The lower flange is secured to a raised seam roofing panel with fasteners, while the vent cap formed with a return lip is engaged with the upper flange by capturing the upper flange within the return lip. A fastener can be inserted through the vent cap return lip and the upper flange to secure the vent cap to the Z-closure member. A mesh filter is trapped against the vertical member by the upper tab member and the lower flexible locking tab. A seal can be added to the lower flange to seal against the roofing panel.
US09359765B2	High speed granule delivery system and method A high speed granule delivery system and method is disclosed for dispensing granules in intermittent patterns onto a moving asphalt coated strip in the manufacture of roofing shingles. The system includes a granule hopper and a rotationally indexable pocket wheel in the bottom of the hopper. A series of pockets are formed in the circumference of the wheel and the pockets are separated by raised lands. A seal on the bottom of the hopper seals against the raised lands as the wheel is indexed. In use, the pockets of the pocket wheel drive through and are filled with granules in the bottom of the hopper. As each pocket is indexed beyond the seal, it is exposed to the moving asphalt coated strip below and its granules fall onto the strip to be embedded in the hot tacky asphalt. Well defined patterns of granules are possible at high production rates.
US09359761B2	Joint filling strip A joint filling strip has a uniform cross-section along its length that defines a top portion and a shaft portion coupled to the top portion. The top portion includes a rectangular section. The shaft portion includes at least one pair of opposing fins spanning a distance that is greater than a width of the rectangular section.
US09359760B2	Concrete flooring An improved concrete floor arrangement is formed from a single cast piece or alternatively a plurality smaller cast pieces linked together to form a floor surface. The floor is arranged in the form of a grid.
US09359756B2	Steel beam support embed and methods of use thereof An apparatus and method is disclosed that allows for the efficient installation and connection of steel beams to a concrete foundation. A steel beam support embed according to the present disclosure can be readily set in place during the forming of the concrete foundation via detachable anchors, thus allowing the installer to avoid rebar or other foundation components that would otherwise need to be moved or adjusted for proper placement of the embed. A steel beam support embed as disclosed herein also, after its installation in the concrete foundation, provides for adjustable connection to a steel beam without the need for field welding.
US09359752B2	Toilet discharge valve assembly having moveable buoyant float therein A toilet flush valve that has a moveable buoyant float therein, wherein the float has an open bottom end to trap air therein and wherein the housing includes controls to selectively release air to allow the float to move upwardly therein to permit flushing. By timing when one or two air vents on the housing are open, the duration and volume of the flush can be controlled, with the buoyancy provided by the water lifting the float to open the flush valve. This provides a flushing system with minimal activation energy.
US09359750B1	Method and apparatus for cleaning and clearing P-trap systems Embodiments of an apparatus for draining liquid generally include a liquid inlet, a p-trap, an additive reservoir, a fluid outlet, a float switch, a valve, and a fitting, wherein the liquid inlet allows for introduction of liquid, the p-trap allows for maintenance of a liquid level whereby contact is provided between the liquid and an additive contained in the additive reservoir, the fluid outlet is configured to maintain the liquid level above an additive reservoir bottom interior surface, the float switch provides indication of high liquid level, the valve allows for blockage of fluid flow between the p-trap and the liquid inlet, and the fitting allows for introduction of high-pressure fluid into the apparatus. Embodiments of a method for clearing a liquid draining apparatus generally include ceasing flow of liquid there into, operating a valve to substantially prevent reverse flow of liquid therefrom, and providing high-pressure fluid into the apparatus.
US09359748B1	Shower device with multi-product dispensing capability A two-stage coaxial shower head that allows conventional water flow through the shower head or a mixture of product and water through a product low flow nozzle. The product may be such liquids as soap, moisturizer, shampoo, or hair conditioner. Products are contained within product pressure reservoirs each with a product section and a piston. During a shower, a user rotates a selector dial at the multi-ported spool valve to select a product or conventional water flow for rinsing. When a product is selected water flow through a water supply tube from the multi-ported spool valve to the shower head will cease and pressure to force water down to the lower part of a product reservoir to raise the piston in the product pressure reservoir to reject product that is transported to a shower head section. A version using electronics instead of hydraulics is also presented.
US09359747B2	Sanitary fitting comprising a fitting housing and an electrical control unit A sanitary fitting having a fitting housing with an electrical control unit for controlling the water flow through at least one water line which sanitary fitting can be maintained or repaired with particularly little effort particularly in applications involving vandalism. This is achieved by having a fitting housing that can be firmly fixed at the installation site with an assembly cover, which can be released from the fitting main body and which covers electrical control unit, turbine and hydraulic control elements within the fitting housing main body and which provides direct access for maintenance and servicing purposes.
US09359743B2	Control system for hybrid construction machine A control system for a hybrid construction machine includes: a turning motor provided in a turning circuit; a pressure detector for detecting a turning pressure of the turning motor; a variable displacement type of fluid pressure motor for regeneration which is rotated by means of pressurized fluid guided from the turning motor; a motor generator adapted to be rotated integrally with the fluid pressure motor; and a controller adapted to predict a turning regeneration flow from the turning motor on the basis of the turning pressure detected by pressure detector to control a tilt angle of the fluid pressure motor on the basis of the predicted turning regeneration flow.
US09359741B2	Wind turbine generator foundation with pressure-dispersive high strength pre-stressed anchors Disclosed is a wind turbine generator foundation with pressure-dispersive pre-stressed anchor rods or anchor ropes. The foundation comprises a pile cap, a plurality of foundation piles arranged circumferentially at the bottom of the pile cap at uniform spacing, and a wind turbine generator tower connected to an upper part of the pile cap.
US09359734B2	Snow plow-blower A snow plow-blower operates as a snow plow, snow blower, or as a snow plow-blower combination. The device includes a plow head blade optionally having retractable/pivotal scoop wings and a cavity with an aperture with blower doors and a blower unit. The snow blower unit includes an auger and impeller to move snow into the unit and force it out of a discharge chute. Blower doors are provided over the snow blower unit cavity to prevent snow from entering into the cavity when the blower is off. Optionally, the blower doors move along a track and rest flush against the plow head to open and close off access to the cavity. Alternatively, the blower doors are hingedly mounted to pivot to open and closed positions. The blower doors may be constructed to operate as blower blades to direct snow into the blower unit; alternatively, separate blower blades are provided to optimize snow removal and mitigate jamming/clogging.
US09359729B2	Milling machine with location indicator system A construction machine apparatus includes a plurality of ground engaging supports, a machine frame supported from the ground engaging supports and a milling drum supported from the machine frame. A milling drum location detection system is configured to determine a drum location in an external reference system. A location indicator system includes a memory configured to store information identifying a location of one or more areas to be avoided in the external reference system, and a controller configured to compare the drum location to the location of the one or more areas to be avoided, and to provide an output corresponding to a proximity of the milling drum to the location of the one or more areas to be avoided.
US09359727B2	Adjustable bolster swing legs for mounting and aligning and reorienting crawlers for slipform paving machines A paving machine for spreading, leveling and finishing concrete having a main frame, center module, bolsters laterally movably, and a crawler track associated with respective aft and forward ends of the bolsters. A bolster swing leg for each crawler track supports an upright jacking column. A worm gear drive permits rotational movements of the crawler track and the jacking column. A hinge bracket is interposed between each swing leg and a surface of the bolsters to enable pivotal movements of the swing leg. A length-adjustable holder engages the pivot pin on the hinge bracket and pivotally engages the swing leg. The holder permits pivotal motions of the swing leg in its length-adjustable configuration and prevents substantially any motion of the swing leg in its fixed-length configuration. A feedback loop cooperates with transducers keeping the crawler tracks position. The paving machine can be reconfigured into a narrowed transport configuration.
US09359719B2	Self-crosslinkable polysiloxane-modified polyhydroxy polyurethane resin, process for producing said resin, resin material comprising said resin, and artificial leather produced utilizing said resin A problem is to provide, in the field of polyhydroxy polyurethane resins the development of applications of which has not moved ahead by conventional technologies, a self-crosslinking polyhydroxy polyurethane resin, which enables to provide products, such as imitation leathers, excellent in abrasion resistance, chemical resistance, heat resistance and the like, and moreover, which is useful from the viewpoint of a reduction in greenhouse gas, contains carbon dioxide incorporated and fixed therein, and is responsive to environmental conservation. Provided are a self-crosslinking, polysiloxane-modified, polyhydroxy polyurethane resin having masked isocyanate groups in a structure of a polysiloxane-modified, polyhydroxy polyurethane resin derived from a reaction of a 5-membered cyclic carbonate compound and an amine-modified polysiloxane compound and having polysiloxane segments therein; a production process of the self-crosslinking resin; a resin material containing the self-crosslinking resin; and an imitation leather composed of a base fabric and a resin composition composed of the self-crosslinking resin as its principal component and impregnated in or laminated on the base fabric.
US09359710B2	Laundry treating apparatus A laundry treating apparatus is disclosed. The laundry treating apparatus includes a cabinet forming an external appearance of the laundry treating apparatus, a laundry accommodation portion arranged in the cabinet and providing a space to accommodate laundry, a machine chamber including at least one of an air supply unit to supply air to the laundry accommodation portion and a moisture supply unit to supply moisture to the laundry accommodation portion, the machine chamber being provided separately from the laundry accommodation portion, a laundry supporter to support a hanger having laundry placed thereon and to move the hanger such that a free end of the hanger forms an arc trajectory in the laundry accommodation portion.
US09359704B2	High energy efficiency washing system A washing machine containing a tub and basket placed within the tub, a basket bottom, a driving shaft coupled to the basket, a motor coupled to the driving shaft, a propeller located within the bottom and impelled by an end of the driving shaft, the propeller containing a scrubber, a center and a support, the scrubbers have a transversal section made from at least three arch circumference sections; a lower face of the propeller has a fin, which along with the bottom, functions as a centrifugal pump creating a current or washing liquor flow which is led through the water tower. In a preferred embodiment, the driving shaft has a solar gear coupled thereto which rotates a satellite gear and over the upper face of the support and between the scrubbers a mini-propeller is provided, the satellite gear is coupled to an axis that rotates the mini-propeller.
US09359701B2	Contoured needle support device The present disclosure is related to a wearable knitting needle support device. The wearable needle support or knitting pad includes an anchoring filling configured to support a needle in a desired position, a needle reception area with apertures on all or parts of the surface that covers the anchoring filling, and a contoured substrate opposite of the needle reception surface. The contoured substrate is concavely curved along at least one axis and serves to produce an identical curve in the lower piece 116. The knitting pad may be connected to a belt or other attachment mechanism that secures the pad to a select position on a user.
US09359698B2	Shedding apparatus for waste selvage in a loom A shedding apparatus for waste selvage includes a pair of first swing levers and a pair of second swing levers for forming an open shed of selvage yarns. The drive force to the swing levers is transmitted by cranking through a drive shaft which is coaxial with the sun gear of a planetary gear mechanism. The crank mechanism using the cranking includes a crank, first end of which is fixedly connected to the drive shaft for rotation therewith, a drive lever for transmitting a rotational force to the swing levers, and a connecting rod connected between second end of the crank and the drive lever. A ratio between an eccentric distance of the crank and a length of the drive lever is less than 1.
US09359697B2	Adjustable spinning wheel A spinning wheel assembly, including a collapsible frame and a spinning assembly connectable thereto. The spinning assembly includes a first grooved pulley and a plurality of differently sized second grooved pulleys, each pulley being rotatably connectable to the frame. A spindle is removably connectable to a respective grooved second pulley, and an endless belt is operationally connected to the first and second pulleys. Each respective grooved second pulley has at least one circumferential groove defining an effective diameter and at least one unique effective diameter.
US09359689B2	Synthesis, capping and dispersion of nanocrystals Preparation of semiconductor nanocrystals and their dispersions in solvents and other media is described. The nanocrystals described herein have small (1-10 nm) particle size with minimal aggregation and can be synthesized with high yield. The capping agents on the as-synthesized nanocrystals as well as nanocrystals which have undergone cap exchange reactions result in the formation of stable suspensions in polar and nonpolar solvents which may then result in the formation of high quality nanocomposite films.
US09359687B1	Separation of alpha emitting species from plating baths A non alpha controlled Tin including Tin and a trace amount of Polonium is utilized as a plating anode to selectively plate Tin upon a plating cathode. Tin may be selectively plated by pulse plating the non alpha controlled Tin with current control to suppress plating of Polonium upon the plating cathode. Tin may also be selectively plated by pulse plating the non alpha controlled Tin with potential control to suppress plating of Polonium upon the plating cathode. Tin may also be selectively plated by pulse and reverse plating to plate out Polonium upon a filtering cathode. Tin may also be selectively plated by plating out Polonium upon a filtering cathode within a concentrate. Tin may also be selectively plated by plating out purified Tin upon a filtering cathode, separating the purified Tin from the filtering cathode, and utilizing the purified Tin to plate Tin upon the plating cathode.
US09359682B2	Erosion resistant machine component, method for forming surface layer of machine component, and method for manufacturing steam turbine A method for forming a surface layer, the purpose thereof is to form a high erosion resistant film. The method for forming a surface layer includes: arranging a member (2) in a machining fluid (3); and forming the surface layer including silicon by spacing a silicon electrode (1) from the member (2) at a predetermined distance, and by supplying silicon component from the silicon electrode (1) to the member side by applying a predetermined voltage and generating electric discharge, and an iron-based metal texture including silicon of 3 to 11 wt % is formed at a thickness of 5 to 10 μm at a portion to be treated by repetitively generating a electric discharge pulse in which a time integration value of a current value of the electric discharge pulse is in a range of 30 A·μs to 80 A·μs.
US09359655B2	Metallurgical composition for the manufacture of ferrochrome The invention relates to a pelletizing feed containing chromite ore, at least one nickel salt, and silicon carbide as the only carbonaceous material and the only reducing agent. The invention also relates to process for manufacturing the pelletizing feed comprising the steps providing chromite, at least one nickel salt and silicon carbide, and mixing chromite, at least one nickel salt and silicon carbide. The invention also relates to use of the pelletizing feed as a starting material for the manufacture of sintering feed. The invention also relates to a sintering feed in the form of pellets containing the pelletizing feed. The invention also relates to sintered pellets containing the sintering feed. The invention also relates to process for manufacturing the sintered pellets. The invention also relates to use of the sintered pellets as a component of smelting feed. The invention also relates to smelting feed comprising sintered pellets. The invention also relates to process for manufacturing ferrochrome alloy. The invention also relates to ferrochrome alloy obtainable by the method.
US09359654B2	Mist cooling apparatus and heat treatment apparatus The mist cooling apparatus (3) includes: a cooling system (30) which includes a nozzle (35, 35A) that sprays cooling liquid in a form of a mist onto a treatment object which has been heated and provided in a cooling furnace (10), and a pump (33) that is driven by a drive source and thereby makes the cooling liquid flow toward the nozzle (35, 35A); and a second cooling system (40) which operates in response to a stoppage of the drive source, and thereby cools the treatment object.
US09359646B2	Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene The present invention relates to a kit and nucleic acid chip for diagnosing bladder cancer using a bladder cancer-specific marker gene. More particularly, the invention relates to a kit and nucleic acid chip for diagnosing bladder cancer, which can detect the promoter methylation of a bladder cancer-specific gene, the promoter or exon region of which is methylated specifically in transformed cells of bladder cancer. The use of the diagnostic kit or nucleic acid chip of the invention enables diagnosis of bladder cancer at an early stage of transformation, thus enabling early diagnosis of bladder cancer, and can diagnose bladder cancer in a more accurate and rapid manner compared to a conventional method.
US09359640B2	Methods for synthesizing pools of probes Compositions, methods and kits are disclosed for synthesizing and amplifying pools of probes using precursor oligonucleotides. In some aspects the precursor is amplified and nicking enzymes are used to separate the full length probes from the amplification products. The methods enable the preparation of single stranded DNA probes of defined sequence and length that are suitable for use in target detection assays.
US09359635B2	Permuted and nonpermuted luciferase biosensors A modified luciferase protein which is a sensor for molecules including cAMP, cGMP, calcium, chelators thereof, kinases, or phosphatases is provided. Also provided is a circularly permuted anthozoan luciferase protein and a decapod crustacean luciferase protein, optionally containing one or more heterologous amino acid sequences, at least one of which directly or indirectly interacts with a molecule of interest. Further provided is a modified anthozoan luciferase protein and a decapod crustacean luciferase protein containing an insertion of one or more heterologous amino acid sequences, at least one of which directly or indirectly interacts with a molecule of interest.
US09359632B2	Devices, systems and methods for sample preparation Devices, systems and methods including a sonicator for sample preparation are provided. A sonicator may be used to mix, resuspend, aerosolize, disperse, disintegrate, or de-gas a solution. A sonicator may be used to disrupt a cell, such as a pathogen cell in a sample. Sample preparation may include exposing pathogen-identifying material by sonication to detect, identify, or measure pathogens. A sonicator may transfer ultrasonic energy to the sample solution by contacting its tip to an exterior wall of a vessel containing the sample. Multipurpose devices including a sonicator also include further components for additional actions and assays. Devices, and systems comprising such devices, may communicate with a laboratory or other devices in a system for sample assay and analysis. Methods utilizing such devices and systems are provided. The improved sample preparation devices, systems and methods are useful for analyzing samples, e.g. for diagnosing patients suffering from infection by pathogens.
US09359610B2	Method for purifying GLA-domain coagulation proteins A method for purifying GLA-domain coagulation proteins, includes the following steps: a) bringing a sample containing one or more GLA-domain coagulation proteins into contact with an affinity substrate on which nucleic aptamers which bind specifically to the GLA-domain coagulation proteins are immobilized, in order to form complexes between (i) the nucleic aptamers and (ii) the GLA-domain coagulation protein(s), b) releasing the GLA-domain coagulation protein(s) from the complexes formed in step a), and c) recovering the GLA-domain coagulation protein(s) in a purified form.
US09359608B2	Modulation of signal transducer and activator of transcription 3 (STAT3) expression Disclosed herein are antisense compounds and methods for decreasing STAT3 mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate hyperproliferative diseases.
US09359606B2	Anti-clusterin monotherapy for cancer treatment The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
US09359588B2	Multilayered structure including cyclic olefin polymer or copolymer, and photobioreactor including the same The present invention relates to multilayered structures. In various embodiments, the present invention provides an at least partially transparent multilayered structure that includes at least one first layer including at least one polyolefin, and at least one second layer including at least one of a cyclic olefin copolymer and a cyclic olefin polymer. In various embodiments, the present invention provides methods of making such multilayered structures, and photobioreactors having compartments including such multilayered structures.
US09359580B2	Method for extraction and purification of oils from microalgal biomass using high-pressure CO2 as a solute The present invention provides methods for the isolation of oils from intact or lysed microorganisms in aqueous media with pressurized carbon dioxide as a solute. Such oils may be used for the production of biofuels. Also provided for are methods for harvesting and rupturing whole cell microorganisms in aqueous media with pressurized carbon dioxide as a solute.
US09359566B2	Selective single-stage hydroprocessing system and method Aromatic extraction and hydrocracking processes are integrated to optimize the hydrocracking units design and/or performance. By processing aromatic-rich and aromatic-lean fractions separately, the hydrocracking operating severity and/or catalyst reactor volume requirement decreases.
US09359564B2	Process and apparatus for producing diesel with high cetane A process and apparatus is provided to produce desulfurized diesel at low pressure with high cetane rating. A hydrotreated stream is stripped and fed to a saturation reactor. The saturated stream is stripped again and fractionated to provide diesel product. Unconverted oil may be hydrocracked and stripped with the saturated product.
US09359558B2	Carbon to liquids system and method of operation A method of operating a carbon to liquids system is provided. The method includes receiving a flow of syngas and reacting, in a reactor, the syngas and a catalyst in a Fischer-Tropsch reaction to produce a product including steam, wherein the reactor includes a polymeric material that is configured to permit the permeation of the steam therethrough. The method also includes recycling the permeated steam to a vessel positioned upstream from the reactor.
US09359547B2	Wellbore servicing compositions and methods of making and using same A method of servicing a wellbore in a subterranean formation comprising placing a wellbore servicing fluid comprising a coupling agent, a hardenable resin and a hardening agent into the wellbore wherein the coupling agent comprises a multihydroxy phenyl, a dihydroxy phenyl, a trihydroxy phenyl, ascorbic acid, a hydroxymethylnaphthol, an oxidation product thereof, a derivative thereof, or combinations thereof. A wellbore servicing fluid comprising a coupling agent, a hardenable resin, a hardening agent and a proppant wherein the coupling agent comprises a multihydroxy phenyl, a dihydroxy phenyl, a trihydroxy phenyl, ascorbic acid, a hydroxymethylphenol, a hydroxymethylnaphthol, an oxidation product thereof, a derivative thereof, or combinations thereof.
US09359538B2	Sealant for use in ink jet recording heads and ink jet recording head Provided is a sealant for use in ink jet recording heads, comprising a cationically polymerizable resin; a fluorine-containing compound that is liquid at a temperature in a range of 20° C.±15° C.; and a cationic polymerization initiator.
US09359536B2	Aqueous adhesive agent composition Disclosed is an aqueous adhesive agent composition which has no concern about environmental safety and can be used as an adhesive agent composition for automobile interior materials. The aqueous adhesive agent composition comprises (A) an acid-modified polyolefin resin and (B) a core-shell-type curing agent.
US09359534B2	Hot-melt adhesives with improved adhesion on low-energy surfaces A hot-melt adhesive composition, the use thereof, and a composite body including the hot-melt adhesive composition. The hot-melt adhesive composition includes a polyolefin P, which is solid at 25° C., a soft resin WH with a softening point between −10° C. and 40° C., and a polar modified polyolefin wax PW.
US09359523B2	High flow, hydrogenated styrene-butadiene-styrene block copolymers and applications The invention relates to unique applications for the novel high melt flow, low viscosity, selectively hydrogenated styrene-butadiene-styrene (hSBS) or selectively hydrogenated controlled distribution styrene-butadiene/styrene-styrene (hSBSS) block copolymers, wherein the melt flow rate of said block copolymer is at least 100 g/10 min at 230° C. under 2.16 kg mass according to ASTM D1238. These block copolymers are novel and have the highest melt flow rate of any styrenic block copolymer also possessing high strength and elasticity. It has applications that prior to the present invention were not normally possible due to the normal low melt flow rate of styrenic block copolymers. The present invention also encompasses various fields of use such as a fiberglass hSBS or hSBSS reinforced mat, low viscosity hSBS or hSBSS coatings for industrial uses, hot melt adhesives prepared from hSBS or hSBSS blended with polyalpha-olefins, and elastic film, fiber, and nonwoven constructions using hSBS or hSBSS.
US09359519B2	Surfactants for aqueous based coatings Disclosed are aqueous coating compositions comprising a branched alkyl alcohol ethoxylate oligomer of formula where m is 1 to 3 and where n is an average number such that Mn is from about 1030 to about 2400, at least one latex polymer and water. The compositions also preferably comprise at least one pigment such as titanium dioxide. The compositions are for instance architectural latex paints. The compositions are for instance free of alkyl phenol ethoxylate (APE) surfactants and are low or zero VOC (volatile organic compounds). The compositions are provided effectively long open film times with excellent leveling properties.
US09359513B1	Dopant inks, methods of making dopant inks, and methods of using dopant inks Printable dopant formulations, methods of making such dopant formulations, and methods of using such dopant formulations are disclosed. The dopant formulations provide a printable dopant ink with a viscosity sufficient to prevent ink spreading when deposited in a pattern on a substrate. Furthermore, an ion exchange purification process provides the dopant formulation with a reduced metal ion concentration, and thus a relatively high purity level. Consequently, the dopant residue remaining on the substrate after curing and/or dopant activation process is relatively uniform, and therefore can be easily removed.
US09359509B2	Aqueous carbon filler dispersion coating liquid, conductivity-imparting material, electrode plate for an electrical storage device, manufacturing method therefore, and electrical storage device A water-based, carbon filler-dispersed coating formulation for forming a conductive coating film contains (1) a hydroxyalkyl chitosan as a resin binder, (2) a conductive carbon filler, and (3) a polybasic acid or its derivative in a water-based medium containing at least water as a polar solvent. In 100 parts by mass of the coating formulation, the hydroxyalkyl chitosan (1) is contained in a range of from 0.1 to 20 parts by mass, and the conductive carbon filler (2) is contained in a range of from 1 to 30 parts by mass. An electricity-imparting material, an electrode plate for an electricity storage device, a process for producing the electrode plate, and the electricity storage device are also disclosed.
US09359497B2	Method for polymerisation of (meth)acrylic acid in solution, polymer solutions obtained and their uses The present invention relates to a new solvent-free preparation method of a (meth)acrylic acid polymer in solution, where said polymer has a molecular weight less than 8,000 g/mol and a polydispersity IP index between 2 and 3 by radical polymerization, the polymers obtained by this means, and their applications in industry.
US09359495B2	Rubber composition for heat resistant conveyor belts, and heat-resistant conveyor belt A rubber composition for heat-resistant conveyor belts according to the present technology contains an ethylene-butene copolymer and an ethylene-propylene-diene copolymer. The mass ratio of the ethylene-butene copolymer to the ethylene-propylene-diene copolymer [(ethylene-butene copolymer)/(ethylene-propylene-diene copolymer)] is from 5/95 to 95/5; and the amount of diene units in the ethylene-propylene-diene copolymer is 2.0% by mass or less per 100 parts by mass of the total of the ethylene-butene copolymer and the ethylene-propylene-diene copolymer.
US09359490B2	Nano-sized diene-based polymer latex particles comprising particles having average particle size of less than 30 nm The present invention refers to diene-based unsaturated polymer latex particles having a particle size measured as d90-value of less than 60 nm and a method for their production. Methods for using the diene-based polymer latex as rubber and for conversion to hydrogenated polymers, with reduced gel formation, are also disclosed.
US09359483B2	Hybrid carbon black, coating composition and shielding material employing the same A hybrid carbon black, a coating composition, and a shielding material employing the same are provided. The hybrid carbon black includes a core of carbon black, and a cross-linked network polymer film covering the whole surface of the carbon black overall. In particular, the carbon black core has a mass fractal dimension between 2 and 3 and a surface fractal dimension between 2 and 2.5, and the cross linking network polymer film includes a product obtained by crosslinking a composition including a styrene monomer and a divinylbenzene monomer.
US09359479B2	Methods of using boron-containing additives as silicon carbide crosslinking agents The present disclosure generally relates to methods of using boron-containing additives for crosslinking polysilazane green fibers, which are precursors to silicon carbide fibers. These methods provide a controllable process for crosslinking silicon carbide fibers while providing a simple way for the introduction of boron as a sintering aid into the polymer structure.
US09359478B2	Curable compositions for LED encapsulants comprising a polycarbosilane and a hydrosilicone The present invention provides a curable composition, comprising: (A) at least one polycarbosilane A represented by the following formula (1): [R1R2R3SiX1/2]M[R4R5SiX2/2]D[R6SiX3/2]T[SiX4/2]Q (1), (B) at least one organopolysiloxane B represented by the following formula (2): [R7R8R9SiO1/2]M′[R10R11SiO2/2]D′[R12SiO3/2]T′[SiO4/2]Q′, (2), and (C) at least a catalyst, as well as a cured product obtainable by heating such composition, and the use of the composition as semiconductor encapsulating material and/or electronic elements packaging material.
US09359476B2	Polyamide resin, preparation method therefor, and molded product including same The polyamide resin of the present invention is a polyamide resin containing an amine group and a carboxyl group, wherein the amine group concentration is about 200 to 300 μeq/g and two to six times as high as the carboxyl group concentration. The polyamide resin has excellent long-thermal stability.
US09359474B2	Catalysts and methods for polymer synthesis The present invention provides unimolecular metal complexes having increased activity in the copolymerization of carbon dioxide and epoxides. Also provided are methods of using such metal complexes in the synthesis of polymers. According to one aspect, the present invention provides metal complexes comprising an activating species with co-catalytic activity tethered to a multidentate ligand that is coordinated to the active metal center of the complex.
US09359467B2	Thermoset/supramolecular hybrid composites and resins that can be hot-formed and recycled Thermoset/supramolecular hybrid composites and resins, resulting from bringing at least one thermosetting resin precursor, this thermosetting resin precursor including hydroxyl functions and/or epoxy groups, and optionally ester functions, into contact with at least one hardener chosen from carboxylic acids and acid anhydrides, and with at least one compound including, on the one hand, at least one associative group, and on the other hand at least one function enabling the grafting thereof to the thermosetting resin precursor, to the hardener or to the product resulting from the reaction of the thermosetting resin precursor and the hardener, in the presence of at least one transesterification catalyst. Process for manufacturing these materials, process for transforming and process for recycling these materials. Novel solid forms of hybrid composites and resins which can be used in the implementation of these processes.
US09359463B2	Amphiphilic and non-water soluble (meth)acrylic comb polymers Non water-soluble polymers with a comb structure and a (meth)acrylic skeleton on which are grafted side chains containing at least one hydrophobic monomer of the styrene or (meth)acrylic ester type on C1 to C4, and at least one hydroxy or methoxy polylakylene glycol monomer. The levels of monomers are such that the polymer is amphiphilic because it is both rich in hydrophobic monomer and polylakylene glycol monomer. These products, used in paper coating dispersions, enable an increase in their Brookfield™ viscosity, a reduction in their ACAV viscosity, and an improvement in their water retention, which makes them particularly well suited for dry extract and/or high deposit speed coatings.
US09359454B2	Method for making solid electrolyte A method for making a solid electrolyte includes the following steps. A first monomer, a second monomer, an initiator and a lithium salt are provided. Wherein the first monomer is R1—OCH2—CH2—OnR2, the second monomer is R3—OCH2—CH2—OmR4, each “R1”, “R2” and “R3” includes —C═C— group or —C≡C— group, “R4” is an alkyl group or a hydrogen (H), and “m” and “n” represents an integer number, molecular weights of the first and second monomers are greater than or equal to 100, and less than or equal to 800. The first and second monomers, the initiator and the lithium salt are mixed to form a mixture, and a weight ratio of the first monomer to the second monomer is less than or equal to 50%. The first and second monomers are polymerized to form an interpenetrating polymer network, and the lithium salt is transformed into a solid solution and dispersing in the interpenetrating polymer network.
US09359450B2	Process for reducing the amount of water-insoluble fibers in a water-soluble cellulose derivative The amount of water-insoluble fibers in a water-soluble cellulose derivative is reduced in a process comprising the steps of a) providing a water-soluble cellulose derivative having a residual amount of at least 20 ppm by weight of water-insoluble fibers in a 2 weight percent aqueous solution of the water-soluble cellulose derivative; b) mixing the water-soluble cellulose derivative of step a) with a liquid in a compounder to provide a moist water-soluble cellulose derivative having a temperature of at least 50 C and a moisture content of from 35 to 90 percent, based on the total weight of the moist cellulose derivative; and c) drying-grinding the mixture of step b) in a gas-swept impact mill to obtain a dried and ground cellulose derivative.
US09359449B2	Light-sensitive ion-passing molecules The invention provides polynucleotides and methods for expressing light-activated proteins in animal cells and altering an action potential of the cells by optical stimulation. The invention also provides animal cells and non-human animals comprising cells expressing the light-activated proteins.
US09359448B2	Anti-BAFF-anti-IL-17 bispecific antibodies Bispecific antibodies are provided that specifically bind B-cell Activating Factor of the TNF Family (BAFF) and Interleukin-17A (IL-17) and are characterized as having high affinity and strong neutralizing properties to both BAFF and IL-17. The bispecific antibodies of the invention are expected to be useful in treating Lupus Nephritis (LN), Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), Psoriasis (Ps), Ankylosing Spondylitis (AS), Psoriatic Arthritis (PA), primary Sjögren's Syndrome (pSS), or Multiple Myeloma (MM).
US09359436B2	Generation of a cancer-specific immune response toward MUC1 and cancer specific MUC1 antibodies The present invention provides a method for inducing a cancer specific immune response against MUC1 using an immunogenic glycopeptide. Other aspects of the invention are a pharmaceutical composition comprising the immunogenic glycopeptide and a cancer vaccine comprising the immunogenic glycopeptide. Another aspect is an antibody generated using the immunogenic glycopeptide and the use of said antibody in therapy and diagnosis.
US09359429B2	Anti-cyanobacteria recombinant antibody polypeptide, gene thereof, and preparation method thereof Provided are a hybridoma cell CGMCC No. 4783 that secretes a monoclonal antibody of an anti-cyanobacteria cell surface antigen, and the secreted monoclonal antibody thereof. Also provided are an anti-cyanobacteria recombinant antibody polypeptide, encoding gene, preparation method and use thereof. The anti-cyanobacteria recombinant antibody polypeptide is composed of an anti-cyanobacteria antibody mimetic polypeptide operably linearly connecting to the carboxyl terminal of an Escherichia coli polypeptide. The anti-cyanobacteria antibody mimetic polypeptide is a polypeptide with cyanobacteria identifying and binding capability designed based on an antigen binding fragment of the monoclonal antibody secreted by the CGMCC No. 4783 hybridoma cell. The anti-cyanobacteria recombinant antibody polypeptide directly form an ion channel on the cell membrane of a cyanobacteria to kill the cyanobacteria, targeted killing the cyanobacteria (prokaryote) without killing other beneficial eukaryotic cell algae.
US09359428B2	High affinity antibodies that neutralize Staphylococcus enterotoxin B Provided herein are antibodies that specifically bind and neutralize Staphylococcus enterotoxin B. In addition, nucleic acids encoding such antibodies, and cells that express such antibodies are provided. Also provided are methods for treating diseases mediated by, and for neutralizing Staphylococcus enterotoxin B.
US09359427B2	Methods for culturing human myeloid leukaemia cells and cells derived therefrom The present invention pertains to a method for culturing a suspension of immortalized human blood cells, preferably cells of myeloid leukaemia origin or cells derived therefrom, wherein said method provides a high productivity, a high cell viability and growth rate and a high batch-to-batch consistency, and can be scaled up without altering these parameters.
US09359426B2	Method of preparing low-iron lactoferrin The present invention relates to methods for producing low-iron Lf having improved antimicrobial activity and to a low-iron Lf having improved antimicrobial activity.
US09359424B2	Multimeric polypeptides of HLA-G including alpha1-alpha3 monomers and pharmaceutical uses thereof Multimeric polypeptides and pharmaceutical uses thereof; multimers comprising alpha3 and alpha1 peptides of an HLA-G antigen and methods of producing such multimers, pharmaceutical compositions comprising the same, as well as their uses for treating various diseases including organ/tissue rejection. Said multimers comprise at least two monomers, each of said monomers being selected in the group consisting of a peptide P2 of formula P1-X3 or X2-X3, wherein P1 is of formula X1-X2, wherein X1 represents a peptidic linker including a cysteine amino acid and X2 represents an alpha1 domain (or alpha1 peptide) of HLA-G and X3 represents an alpha3 domain of HLA-G.
US09359422B2	Single chain relaxin polypeptides The present invention relates to biologically active single chain relaxin polypeptides comprising a relaxin B chain derived from relaxin-3, the polypeptides being truncated by one or more amino acids at the C-terminus of the relaxin-3 B chain. Typically the single chain relaxin polypeptides are antagonists of the RXFP3 receptor, and in some embodiments are selective antagonists of the RXFP3 receptor.
US09359420B2	Single chain trail fusion polypeptides and encoding nucleic acids The present invention refers to single-chain fusion proteins comprising three soluble TNF superfamily (TNFSF) cytokine domains and nucleic acid molecules encoding these fusion proteins. The fusion proteins are substantially non-aggregating and suitable for therapeutic, diagnostic and/or research applications.
US09359419B2	Treatment of vascular complications of diabetes A peptide consisting of 7-17 amino acids and including the adjacent hexamer TX1EX2X3E, where X1, X2 and X3 can be any natural or non natural amino acid, wherein the peptide does not exhibit TNF-receptor-binding activity and is cyclic, for the treatment or prevention of vascular complications in diabetes patients.
US09359418B2	Inhibitors of the T cell-specific alternative p38 activation pathway and methods of use In T lymphocytes, p38 mitogen activated protein kinase (MAPK) can be activated through an alternative pathway that involves phosphorylation at tyrosine 323. Disclosed herein is the identification of a minimal region of the growth arrest and DNA damage-inducible alpha (Gadd45α) protein that is required for binding to and inhibition of tyrosine 323-phosphorylated p38 in T cells. The disclosed Gadd45α polypeptides inhibit proliferation of T cells in response to T cell receptor stimulation, inhibit differentiation of T cells into Th1 or Th17 cells, inhibit the production of proinflammatory cytokines, and reduce tumor formation and growth of inflammatory cancers, such as pancreatic cancer.
US09359415B2	Ligands modified by circular permutation as agonists and antagonists The present invention provides fusion polypeptides comprising polypeptide ligands that are modified by circular permutation and fused to at least one polypeptide fusion partner wherein such fusion polypeptides have new, improved or enhanced biological functions or activities. Such improvements include, but are not limited to, increased binding affinity, increased activity, increased agonist activity (super agonist), antagonist activity, increased accessibility, increased flexibility of the active site, increased stability, broader and/or changed substrate specificity, and combinations thereof.
US09359414B2	Antigenic polypeptides of Trichinella and uses thereof The invention relates to novel polypeptides which are recognized by anti-Trichinella antibodies. Said polypeptides can be used particularly for detecting anti-Trichinella antibodies and in trichinosis prevention.
US09359406B2	Vaccine for a therapeutic or a prophylactic treatment of myasthenia gravis A therapeutic composition comprising (1) a complementary peptide comprising a sequence complementary to a major immunogenic region of an acetylcholine receptor (AChR) involved in myasthenia gravis (MG), the sequence being SEQ ID NO:1 (with modified tryptophan in position 8 carrying at least one 2,4,6-trimethoxybenzyl group as hydrocarbonation), (2) a complementary peptide having at least a sequence SEQ ID NO:2, which is complementary to a T-cell recognition site of the acetylcholine receptor, and (3) at least one carrier, may be used in the therapeutic or prophylactic treatment of myasthenia gravis in mammals.
US09359394B2	Stereoselective glycosylation reactions Disclosed is a method for selective synthesis of 1,2-cis-α-linked glycosides which does not require the use of the specialized protecting group patterns normally employed to control diastereoselectivity. Thioglycoside acceptors can be used, permitting iterative oligosaccharide synthesis. The approach eliminates the need for lengthy syntheses of monosaccharides possessing highly specialized and unconventional protecting group patterns.
US09359393B2	Photoresponsive nucleic acid manufacturing method The present invention provides a manufacturing method that can easily manufacture a compound known as photoresponsive (photocoupling) nucleic acids at high yield in a shorter period of time than that of the conventional technology. The present invention relates to a method of manufacturing a photoresponsive nucleic acid which includes a step of reacting a nucleic acid having groups represented by the Formula I, the Formula III, the Formula IV, or the Formula V and a compound represented by the Formula II, or reacting a nucleic acid having groups represented by the Formula VI, the Formula VIII, the Formula IX, or the Formula X and a compound represented by the Formula VII by heating them by microwaves in the presence of a metal catalyst, a basic substance, and a solvent.
US09359388B2	Transition metal compound having heteroatom, catalystic composition including the same, and method for preparing polymers using the same The present invention discloses a transition metal compound having a novel structure and including a heteroatom, a catalyst composition including the same, and a method for preparing polymers using the same. The transition metal compound according to an embodiment of the present invention has good copolymerization properties, and a polymer having a low density may be prepared using thereof. Thus, a copolymer having various uses may be prepared.
US09359381B2	Tricyclic compounds for inhibiting the CFTR channel The present invention provides a compound of formula I or a pharmaceutically acceptable salt thereof; and its therapeutic uses. The present invention further provides a combination of pharmacologically active agents and a pharmaceutical composition.
US09359380B2	DNA-PK inhibitors The present invention relates to compounds useful as inhibitors of DNA-PK. The invention also provides pharmaceutically acceptable compositions comprising said compounds and methods of using the compositions in the treatment of various disease, conditions, or disorders.
US09359371B2	Bicyclic substituted pyrimidine compounds Disclosed are bicyclic group substituted pyrimidine compounds, pharmaceutical acceptable salts thereof or stereoisomers thereof. Also disclosed are preparation methods, pharmaceutical formulations, and pharmaceutical compositions of the compounds, and use of the compounds, pharmaceutical formulations, and pharmaceutical compositions for preparing a medicament for treating and/or preventing sexual dysfunction diseases and diseases with lower urinary tract symptoms.
US09359367B2	Tetrahydroquinazolinone derivatives as PARP inhibitors Disclosed are compounds of formula (I), their tautomeric forms, stereoisomers, and pharmaceutically acceptable salts thereof, wherein R1-R6, R7a-d, R8a-d, A, M, n, and p are as defined in the specification, pharmaceutical compositions including a compound, tautomer, stereoisomer, or salt thereof, and methods of treating or preventing diseases or disorders, for example, cancer, that are amenable to treatment or prevention by inhibiting the PARP enzyme of a subject.
US09359356B2	Azaadamantane formate ester and process for preparing azaadamantane derivatives A compound, (4s)-1-azaadamantane-4yl formate ester, is described. In addition, a process is described for preparing (4s)-1-azaadamantane-4yl formate ester, aminothiadiazole-phenyl phosphate salt, bromothiadizole-phenyl or (4s)-4-(5-phenyl-1,3,4-thiadiazol-2-yloxy)-1-azatricyclo[3.3.1.13,7]-decane dihydrogen citrate. Furthermore, a process is described, comprising step of hydrolyzing (4s)-1-azaadamantane-4yl formate ester to form (4s)-1-azaadamantan-4-ol HBr salt.
US09359355B2	Fused tricyclic dual inhibitors of CDK 4/6 and FLT3 Compounds of Formula I are useful inhibitors of CDK 4, CDK6, and FLT3. Such compounds are useful in treating cancer and various other disease conditions. Compounds of Formula I have the following structure: where R1 is a group of Formula IA, Formula IB, Formula IC, or Formula ID and the definitions of the other variables are provided herein.
US09359352B2	Substituted benzimidazoles as PI3 kinase inhibitors The present invention provides substituted benzimidazole compounds of Formula I: wherein the variables R1, R2, W1, W2, W3, W4, W5, W6, Wa, Wb, Wc and Wd are defined herein. The compounds are useful as phosphoinositide 3-kinase (PI3 kinase) inhibitors.
US09359347B2	Inhibitors of Akt/PKB with anti-tumor activity The subject invention concerns materials and methods for inhibiting the Akt/PKB pathway. In one embodiment, a compound of the invention inhibits kinase activity and/or phosphorylation levels of Akt proteins. The subject invention also concerns methods for inhibiting or killing a cancer cell or other cell in which expression of an Akt protein is elevated or constitutively active, comprising contacting the cell with an effective amount of a compound of formula I. The subject invention also concerns methods for treating cancer or a tumor in a person or animal comprising administering an effective amount of a compound of formula I to the person or animal.
US09359335B2	Triazole derivative, and light-emitting element, light-emitting device, electronic device and lighting device using the triazole derivative Objects are to provide the following: a substance that facilitates hole injection and has high triplet excitation energy; a light-emitting element having high emission efficiency using the substance that facilitates hole injection and has high triplet excitation energy; a light-emitting element having low driving voltage; and a light-emitting device, an electronic device, and a lighting device having low power consumption. Provided is a triazole derivative in which a dibenzothiophen-4-yl or dibenzofuran-4-yl group represented by General Formula (G2) is bonded to any one of Ar1 to Ar3 of a triazole derivative represented by General Formula (G1). In the formulas, A represents oxygen or sulfur, Ar1 to Ar3 separately represent a substituted or unsubstituted aryl group having 6 to 13 carbon atoms, and R1 to R7 separately represent hydrogen, an alkyl group having 1 to 4 carbon atoms, or a substituted or unsubstituted aryl group having 6 to 13 carbon atoms.
US09359333B2	Efficient process for the preparation of Lapatinib and salts thereof by means of new intermediates The present invention refers to a new efficient process for the synthesis of the active pharmaceutical ingredient Lapatinib and salts thereof.In particular, the present synthesis is carried out employing new intermediates in which the amine function is protected by a group cleavable in basic milieu that provides a higher overall yield of the synthesis process.
US09359326B2	Manufacturing process for pyrimidine derivatives The invention relates to processes for manufacturing a compound of formula 5, or a stereoisomer, tautomer or a salt thereof, wherein the substituents are as defined in the specification. The invention further relates to new manufacturing processes for specific solid forms of Compound A and its salts, to such solid forms and to use of such solid forms for the therapeutic treatment of warm-blooded animals.
US09359321B2	Hydroxymethylfurfural derivative The hydroxymethylfurfural derivative is represented by the general formula (A) (wherein, R is selected from the group consisting of the following formula (I), (II) HOOCCH2COCO—, (III) HOOCCH2CH2COCO—, and (IV) a hydrogen atom).
US09359320B2	Acid-functionalized polyolefin materials and their use in acid-promoted chemical reactions An acid-functionalized polyolefin material that can be used as an acid catalyst in a wide range of acid-promoted chemical reactions, wherein the acid-functionalized polyolefin material includes a polyolefin backbone on which acid groups are appended. Also described is a method for the preparation of the acid catalyst in which a precursor polyolefin is subjected to ionizing radiation (e.g., electron beam irradiation) of sufficient power and the irradiated precursor polyolefin reacted with at least one vinyl monomer having an acid group thereon. Further described is a method for conducting an acid-promoted chemical reaction, wherein an acid-reactive organic precursor is contacted in liquid form with a solid heterogeneous acid catalyst comprising a polyolefin backbone of at least 1 micron in one dimension and having carboxylic acid groups and either sulfonic acid or phosphonic acid groups appended thereto.
US09359305B2	Parasiticidal compositions comprising benzimidazole derivatives, methods and uses thereof The invention relates to oral, topical or injectable compositions for combating liver fluke parasites in mammals, comprising at least one benzimidazole derivative active agent. The invention also provides for an improved method for eradicating and controlling liver fluke parasite infections and infestations in a mammal comprising administering the compositions of the invention to the mammal in need thereof.
US09359290B2	Treatment of cataplexy The present invention relates to a method of treating cataplexy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of certain carbamate compounds.
US09359289B2	Bioavailable diacylhydrazine ligands for modulating the expression of exogenous genes via an ecdysone receptor complex The present invention relates to non-steroidal ligands for use in nuclear receptor-based inducible gene expression system, and a method to modulate exogenous gene expression in which an ecdysone receptor complex comprising: a DNA binding domain; a ligand binding domain; a transactivation domain; and a ligand is contacted with a DNA construct comprising; the exogenous gene and a response element; wherein the exogenous gene is under the control of the response element and binding of the DNA binding domain to the response element in the presence of the ligand results in activation or suppression of the gene.
US09359286B2	Bicyclic compounds Disclosed are compounds of Formula (I) and/or a salt thereof; wherein R is —OH or —OP(O)(OH)2. Also disclosed are methods of using such compounds as selective agonists for G protein-coupled receptor S1P1, and pharmaceutical compositions comprising such compounds. These compounds are useful in treating, preventing, or slowing the progression of diseases or disorders in a variety of therapeutic areas, such as autoimmune diseases and vascular disease.
US09359281B2	Enantiomers of 2-hydroxy derivatives of fatty acids This invention refers to the synthesis and purification of 2 hydroxide derivatives of fatty acids, as well as to the separation method of its enantiomers (or optic isomers) [−] y [+], to the enantiomers themselves, to pharmaceutical compositions which include them, and to their use as medicines, as well as to an in vitro method of diagnosis/prognosis and evaluation of the potential use of the molecules of the invention in different pathologies, as well as their use for the regulation of certain enzymes and the study of their activity and effects.
US09359265B2	Plant nutrient coated nanoparticles and methods for their preparation and use Embodiments described herein provide for nanofertilizers having at least one plant nutrient coated onto a metal nanoparticle. Some embodiments provide for a method of making a nanofertilizer including providing a metal nanoparticle and coating the metal nanoparticle with at least one plant nutrient or precursor thereof. In some embodiments, a method of making a nanofertilizer may include mixing a metal salt and a plant nutrient in an aqueous medium to form a solution and adding a reducing agent to the solution to form a coated metal nanoparticle. Some embodiments provide for a boron nanofertilizer and methods of making the same. Some embodiments provide for a method of treating a plant nutrient deficiency, such as, for example, a boron deficiency. Some embodiments also provide for a kit for making a plant nutrient coated nanoparticle.
US09359260B2	Luminescent ceramic for a light emitting device A semiconductor light emitting device comprising a light emitting layer disposed between an n-type region and a p-type region is combined with a ceramic layer which is disposed in a path of light emitted by the light emitting layer. The ceramic layer is composed of or includes a wavelength converting material such as a phosphor. Luminescent ceramic layers according to embodiments of the invention may be more robust and less sensitive to temperature than prior art phosphor layers. In addition, luminescent ceramics may exhibit less scattering and may therefore increase the conversion efficiency over prior art phosphor layers.
US09359257B2	Particulate flow enhancing additives and associated methods A dry, free-flowing cement composition that comprises dry cement particles and flow inducing particulates that comprise solid adsorbent particulates having adsorbed thereon a flow inducing chemical, ethylene glycol, and water. The water is present in an amount from 5% to 30.3% by weight of the solid adsorbent particulates, the ethylene glycol is present in an amount from 3.25 to 20% by weight of the solid adsorbent particulates, and the flow inducing particulate is present in an amount from 0.005% to 5% by weight of the cement. The dry, free-flowing cement composition is free-flowing at temperatures at least as low as 10° F.
US09359254B2	Wellbore cement compositions and wellbore cementing methods A wellbore cement composition includes substantially unhydrated cement powder and additive powder for cement. The additive powder is formulated from ingredients including a liquid additive for cement and solid carrier particles. The liquid additive is absorbed by the solid carrier particles. A wellbore cementing method includes using a dry cement composition, adding water to the dry cement composition, forming a cement slurry, placing the slurry in a wellbore, and setting the placed slurry. The dry cement composition contains substantially unhydrated cement powder and retarder powder for cement. The retarder powder contains a retarder absorbed by solid carrier particles.
US09359253B2	Coated-fine-aggregate, concrete composition and method A concrete composition and method include a portion of fine aggregate bearing a coating of a polymer, which may be a continuous coating layer or a layer of powdered, discrete particles embedded in a binder. The polymeric coating may be a super absorbent polymer (insoluble in water, but absorbing water), or another polymer such as the acrylamides, co-polymers thereof, polyacrylamides, or the like (soluble in water). The coating absorbs water, but particles are too small to form significant voids. Water is absorbed into the concrete mix in far greater proportions (e.g. w/c ratio over 0.5) improving workability, doubling workability time, and improving ultimate compressive stress (strength).
US09359251B2	Ion exchanged glasses via non-error function compressive stress profiles Glasses with compressive stress profiles that allow higher surface compression and deeper depth of layer (DOL) than is allowable in glasses with stress profiles that follow the complementary error function at a given level of stored tension. In some instances, a buried layer or local maximum of increased compression, which can alter the direction of cracking systems, is present within the depth of layer. Theses compressive stress profiles are achieved by a three step process that includes a first ion exchange step to create compressive stress and depth of layer that follows the complimentary error function, a heat treatment at a temperature below the strain point of the glass to partially relax the stresses in the glass and diffuse larger alkali ions to a greater depth, and a re-ion-exchange at short times to re-establish high compressive stress at the surface.
US09359250B2	Substrate ion exchange systems with single- and multi-component ion exchange baths and methods for maintaining such systems A substrate ion exchange system, along with methods of maintain such a system, is provided that includes a substrate having an outer region containing a plurality of substrate metal ions, an ion exchange bath that includes a plurality of first metal ions at a first metal ion concentration and a plurality of second metal ions at a second metal ion concentration, and a vessel for containing the ion exchange bath and the substrate. The ion exchange system also includes a temperature sensor coupled to the vessel, and a processor configured to receive a vessel temperature from the sensor and to evaluate the first metal ion concentration based at least in part on a first metal ion consumption rate relationship and the vessel temperature. Further, the first metal ion consumption rate relationship is predetermined.
US09359249B2	Anti-corrosion anti-reflection glass and related methods Certain example embodiments relate to methods of making anti-corrosion anti-reflection (ACAR) films, and/or associated coated articles. The methods may involve forming the reaction product of a hydrolysis and/or a condensation reaction of at least one hybrid alkoxide selected from the group consisting of Si(OR)4—Al(s-OBu)3, Si(OR)4—B(OBu)3 and Si(OR)4 and Zr(OBu)4, where R is a CH2CH3 group, s-OBu is sec-butoxide and OBu is n-butoxide. The solution optionally may be blended and/or mixed with silicon nanoparticles and/or siloxanes. A Tqe % gain of about 3.2% and/or refractive index of 1.5 or less is/are possible in certain example embodiments.
US09359242B2	Glass-plate manufacturing method A glass-plate manufacturing method employing a down-draw process includes: a forming step of forming a sheet glass by making a molten glass flow downward along opposite side surfaces of a forming member and merge at a lower section of the forming member; and a cooling step of cooling the sheet glass while drawing the sheet glass downward with rollers. In the cooling step, an above-glass-strain-point temperature control step is performed which is a step of performing a temperature control in the width direction of the sheet glass in a temperature region ranging from the lower section of the forming member to where the temperature of the sheet glass falls below a temperature region near the glass strain point, and includes: first, second and third temperature control steps as defined herein.
US09359241B2	Method for recycling material when making a mineral melt The present invention concerns a method of making a mineral melt by burning combustible material in the presence of inorganic particulate material and thereby forming a melt, comprising injecting fuel, particulate mineral material and combustion gas into a circulating combustion chamber (1) through an inlet conduit (4) and combusting the fuel in the circulating combustion chamber (1) thereby melting the mineral material to form a mineral melt and generating exhaust gases; separating the exhaust gases from the mineral melt, collecting the mineral melt (9) and passing the exhaust gases upwards through an exhaust pipe (10) to a conduit (11) of a heat exchange system; and supplying particulate mineral material and a first portion of waste mineral wool into the conduit (11) and pre-heating the supplied material in the heat exchange system, and supplying a second portion of waste mineral wool with a water content between 5 and 25% by weight directly to the inlet conduit (4).
US09359237B2	Digester for degradation of human waste A digester for degradation of human waste comprising a main tank having biochemical treatment compartment and chemical treatment compartment connected by connecting pipe as a passage for bio-chemically treated waste to chemical treatment compartment; the biochemical treatment compartment has at least one loosely fitted partitioned wall and at least one inlet to receive waste, at least one gas outlet and at least one waste drain pipe to remove sludge; the chemical treatment compartment has discharge means to discharge treated waste and excess of liquid, and float ball assembly to release chemical for chemical treatment.
US09359227B2	Porous formed article, and method for manufacturing the same There is provided a porous formed article which can remove hazardous substances at a high speed, has a high adsorption capacity and has high durability to cleaning chemicals and further which is scarcely broken even if being repeatedly used, and which contains an organic polymeric resin and an inorganic ion-adsorbing material, wherein the organic polymeric resin is a polyether sulfone resin and/or a polysulfone resin, and is an organic polymeric resin having a hydroxyl group.
US09359219B1	Surface-modified cyanide-based transition metal compounds A system, method, and articles of manufacture for a surface-modified transition metal cyanide coordination compound (TMCCC) composition, an improved electrode including the composition, and a manufacturing method for the composition. The composition, compound, device, and uses thereof according to AxMn(y-k)Mjk[Mnm(CN)(6-p-q)(NC)p(Che)rq]z. (Che)rw(Vac)(1-z).nH2O (wherein Vac is a Mn(CN)(6-p-q)(NC)p(Che)rq vacancy); wherein Che is an acid chelating agent; wherein: A=Na, K, Li; and M=Mg, Al, Ca, Sc, Ti, V, Cr, Fe, Co, Ni, Cu, Zn, Ga, Pd, Ag, Cd, In, Sn, Pb; and wherein 0
US09359218B2	Chemical production system Systems and methods of producing chemical compounds are disclosed. An example chemical production system includes an intake chamber having intake ports for entry of a gas mixture. An igniter ignites the gas mixture in the intake chamber. A nozzle restricts exit of the ignited gas mixture from the intake chamber. An expansion chamber cools the ignited gas with a cooling agent. The expansion chamber has an exhaust where the cooled gas exits the expansion chamber. A chemical compound product is formed in the expansion chamber.
US09359211B2	Methods of fabricating graphene using alloy catalyst Methods of fabricating graphene using an alloy catalyst may include forming an alloy catalyst layer including nickel on a substrate and forming a graphene layer by supplying hydrocarbon gas onto the alloy catalyst layer. The alloy catalyst layer may include nickel and at least one selected from the group consisting of copper, platinum, iron and gold. When the graphene is fabricated, a catalyst metal that reduces solubility of carbon in Ni may be used together with Ni in the alloy catalyst layer. An amount of carbon that is dissolved may be adjusted and a uniform graphene monolayer may be fabricated.
US09359205B2	Production of trisilylamine from monochlorosilane and ammonia by use of inert solvent The present invention relates to a specific process for producing trisilylamine from monochlorosilane and ammonia in the liquid phase. The invention further relates to a plant wherein such a process can be carried out with advantage.
US09359204B2	Mesoporous metal nitride materials and methods A plurality of mesoporous metal nitride materials may be formed by a method that includes treating with ammonia (or a related bonded nitrogen and hydrogen containing reducing material) a mixed metal oxide material that comprises at least one first metal that forms an unstable product with ammonia and at least one second metal that forms a stable product with ammonia to form the metal nitride materials that include the second metal but not the first metal. The method contemplates forming metal nitride materials, as well as metal oxynitride materials. A related method that uses a non-bonded nitrogen and hydrogen containing reducing material may yield a mesoporous metal oxide. In particular the at least one metal that forms an unstable product with ammonia comprises zinc metal.
US09359199B2	Apparatus for generating hydrogen gas using composition for generating hydrogen gas and composition for generating hydrogen gas The present invention relates to an apparatus for generating hydrogen gas using a composition for generating hydrogen gas, which generates hydrogen gas (H2) from water (H2O) through spontaneous thermochemical reaction without supplying electricity using a composition for generating hydrogen gas which generates the hydrogen gas by spontaneous oxidation with water at room temperature.
US09359193B2	Method for manufacturing an integrated MEMS device An integrated MEMS device and its manufacturing method are provided. In the manufacturing method, the sacrificial layer is used to integrate the MEMS wafer and the circuit wafer. The advantage of the present invention comprises preventing films on the circuit wafer from being damaged during process. By the manufacturing method, a mechanically and thermally stable structure material, for example: monocrystalline silicon and polysilicon, can be used. The integrated MEMS device manufactured can also possess the merit of planar top-surface topography with high fill factor. The manufacturing method is especially suitable for manufacturing MEMS array device.
US09359184B2	Fluid dispenser and method for dispensing fluids A fluid dispenser comprising a fluid container and a metering unit is disclosed. The container comprises a fluid level sensor and the dispenser comprises a control unit configured to determine a parameter value representative for an amount of fluid in the container after refill on basis of a signal from the sensor. The sensor can for example be configured to generate a signal at a predefined fluid level (B, C), while the control unit is configured to calculate a fluid level on basis of an input value indicative of the fluid level (A) after refill, and a dispense value indicative of amounts of fluid dispensed since the latest refill. The control unit can be configured to compare the signalled predefined fluid level (B, C) with the calculated fluid level to generate a correction factor.
US09359181B2	Filling method and device A method and device for filling containers with a liquid product. The product is fed to the container by a filling valve and a filling nozzle. The product emerging from the filling nozzle is fed to a directing element. The directing element has a geometrical configuration such that an edge of the directing element runs along at a small distance from the inside walls of the container.
US09359174B2	Composite lifting beam A composite lifting beam and methods are provided. Such a lifting beam includes at least one beam element. A plurality of plate elements are mounted to the at least one beam element and are spaced apart along a length of the at least one beam element. The plurality of plate elements provide a first connection arrangement for connecting the beam to a lifting apparatus, and a second connection arrangement for connecting the beam to a load.
US09359172B2	Elevator rope sway detection and damping An exemplary elevator system includes a first mass that is moveable within a hoistway. A second mass is moveable within the hoistway. A plurality of elongated members couple the first mass to the second mass. At least one damper is positioned to selectively contact at least one of the elongated members if sway occurs. A sensor is associated with the damper. The sensor detects contact between the damper and the at least one of the elongated members. A controller adjusts at least one aspect of elevator system operation responsive to the detected contact.
US09359161B2	Interleaving element for a roll of glass substrate An interleaving element is adapted to interleave a roll of glass substrate. The glass substrate includes at least one active area, a plurality of spacing zones and two edge zones. The plurality of spacing zones and the edge zones define the active area. The interleaving element includes two elongated side elements and a plurality of bridging elements. The elongated side elements correspond to the two edge zones. Each of the plurality of bridging elements is connected with the elongated side elements. The plurality of bridging elements corresponds to the spacing zones.
US09359159B2	Sheet feeding apparatus and image forming apparatus A sheet feeding apparatus includes a stacking portion, a feed portion, a moving amount detecting portion provided downstream of the feed portion and configured to detect a moving amount of the sheet, and a control portion. The control portion is configured to change a timing for starting a sheet feed operation by the feed portion in feeding a n+1th sheet by the feed portion based on a detection result of the moving amount detecting portion detected when a nth sheet has been fed by the feed portion in feeding the sheets consecutively by the feed portion.
US09359150B2	Singulator The problem of singulating products that are provided in a pallet layer is solved by breaking up the pallet layer so that each product can be handled separately by a robot tool and outputted in at least one line according to a predetermined orientation. The singulator includes a layer drop zone that receives a pallet layer of products, a break-up system that separates the products by creating gaps therebetween, yielding separated products, a vision system that determines characteristics and position of each separated product; and a robot equipped with a tool that receives information indicative of the characteristics and position of said each separated product to grip and position each separated product onto an output station within at least one line.
US09359145B2	Roller driven device for roller conveyors A roller driven device for roller conveyors includes a cylindrical and tubular roller configured to rotate around its geometric axis, and having at each end a respective first lateral wheel and a second lateral wheel. At least the first lateral wheel has a tubular cylindrical element having at its end facing the second lateral wheel a first flange and at the opposite end a second flange. The device further includes a ring whose axial length ranges from two thirds to one twentieth of the axial distance between the first flange and the second flange of the first lateral wheel. An end of the ring is positioned between the first flange and the second flange and the end is fixed to the outer surface of the roller, where the end portion of the roller is fixed at the central hole of the second flange.
US09359144B2	Multi-piece shaft A method of manufacturing a multi-piece shaft for an idler roller. The method includes providing a tube having a first end and a second end, mechanically crimping the first end of the tube to a first stub to secure the first stub to the first end of the tube with a mechanical interlock, and mechanically crimping the second end of the tube to a second stub to secure the second stub to the second end of the tube with a mechanical interlock. The first stub extends from the first end of the tube and the second stub extends from the second end of the tube.
US09359143B2	Conveyance device A conveyance device has a carriage drive for driving and propelling a pair of left and right carriage units which individually support left and right sides of an object to be conveyed. A pair of left and right screw shafts is pivotally supported in a rotatable manner along the movement path of the carriage units. Driven rollers are pivotally supported in a rotatable manner by the carriage units and engage with the screw shafts. A transmission connects the pair of left and right screw shafts through the outside of a conveyance path such that the left and right screw shafts are linked and coupled; and a single motor drives the pair of left and right screw shafts through the transmission means.
US09359141B2	Positively-driven, low tension transfer conveyor Components of a conveyor system designed to facilitate tight transfer of products onto and off a positively-driven, low tension conveyor belt. The conveyor system includes a tension amplifier in a returnway of a conveyor belt circuit for selectively increasing tension in the conveyor belt prior to infeed without increasing the low tension in the returnway prior to the tension amplifier.
US09359139B1	Chute system A chute system includes a pair of support rails, each having a bent reinforcement member secured to it. The chute is made up of multiple chute panels, which nest within one another for ease of storage and transportation. A spacer bar sets the system width and provides overall support. The system also includes a pair of hinged anchors for adjustably securing the system to the edge of a roof. There is also a roof eave debris stop for preventing debris from sliding off the roof onto landscaping, humans and animals below.
US09359137B2	Tunneled gas storage A system for high-pressure natural gas storage includes at least one underground bored tunnel, suitable for holding natural gas under pressure and a process for storing natural gas under pressure.
US09359135B2	Storage shelf A storage shelf reduces vibration while maintaining load-carrying capacity and includes placement units on which a FOUP is placed, and a frame unit that supports the placement units. The placement units include frames that are arranged on the frame unit with first elastic bodies interposed therebetween, and a shelf plate that is arranged on the frames with second elastic bodies interposed therebetween and is configured to place thereon the FOUP.
US09359128B2	Portion capsule for production of a beverage A portion capsule for producing a beverage is proposed, having a capsule body with a capsule base and a filling side, with a cavity for accommodating a pulverulent or liquid beverage base being formed between the capsule base and the filling side, with a filter element being arranged between the beverage base and the capsule base, and with the filter element having a non-woven which is arranged in the region of the capsule base.
US09359125B2	Pop-up bouquet box A gift box is described for housing a plurality of pop-up elements that are automatically presented to a user when a lid of the box is removed. The box includes an interior portion enclosed by a base and sidewalls around its outer periphery. The interior portion of the gift box contains a central tower coupled to four levers that each pivot on a respective sidewall. The central tower and/or the four levers additionally have one or more paper pop-up elements attached thereto that are presented to a user when the box is opened. A band passing through the interior portion of the box stores the mechanical energy necessary to cause the four levers to pivot on the sidewalls, thereby generating the force to move the central tower out of the box when the lid is removed.
US09359118B2	Packaging material comprising magnetisable portions A packaging material comprising a plurality of magnetisable portions thereon comprising at least one spot per package to be formed from the packaging material is disclosed. At least one of the magnetisable portions provides a first magnetic mark carrying a magnetic field pattern providing position information related to finishing of respective package to be formed.
US09359117B2	Container closure A canister includes a container and a closure. The container is formed to include a product-storage region to receive products and the closure is configured to seal off a brim of the container to block access to the product-receiving container when the closure is rotated in a clockwise direction. The closure includes a lid-retainer ring and a floating lid that covers a mouth of the container.
US09359107B2	Card reader accessible multiple transaction card holder A card holder assembly for holding multiple transaction cards, such as gift cards, to a common backer panel for presentation and sale. Cards mounted on the backer panel may be lifted for scanning by a card reader without necessitating removal of the cards from the assembly.
US09359101B2	Leak resistant food sleeve A leak resistant food sleeve for holding single-serving food items is provided. The sleeve may be constructed from a blank that is folded into the sleeve when ready to use. The sleeve consists of two major and two minor sidewall panels, and first and second ends. The major and minor sidewall panels are folded to form a box-like structure. The first end consists of two major end flaps, two minor end flaps, and gusset panels extending between and foldably connected to one of the major end flaps and one of the minor end flaps. The gusset panels become layered between the minor end flaps and major end flaps when each is folded inward to close the first end, such that the minor end flaps, gusset panels, and major end flaps form a web of material that prevents fluidal and viscous substances from leaking out of the first end.
US09359096B2	Method for sterilizing cuboid-shaped cardboard/plastic combipacks in an autoclave and pack suitable for this A method for sterilizing cuboid-shaped cardboard/plastic combipacks in an autoclave, with the packs including product and packing are subjected to heat treatment at a certain temperature over a certain period of time, the product including a liquid and chunky portions, and mechanisms are provided inside the autoclave to drive the packs rotationally about a rotational spindle, and a cuboid-shaped cardboard/plastic combipack for use in such a device.A plurality of packs are arranged closely adjacent to one another in parallel rows, to be arranged on support floors and for a plurality of support floors loaded with packs to be arranged one above the other and fixed in their mutual positions. The cardboard for the pack used therewith is made water-repellent by means of glue to reduce the intake of water.
US09359092B2	Device and method for packaging products A device for packaging preferably two-dimensional products is designed for forming a bag-like tube by way of a longitudinal connection device, from a web of packaging material. The bag-like tube, with respect to a conveying direction of the packaging material, is open in a region in front of the longitudinal connection device and is closed in the region after the longitudinal connection device. The device includes a suction device which leads into the still open bag-like tube, and in the closed region includes a suction opening, through which gas can be sucked out of the region after the longitudinal connection device, out of the bag-like tube and through the suction device.
US09359086B2	Profiled strip as a fire indication device in an aircraft A door for a storage compartment of an aircraft includes a door leaf and a profiled strip connected to an edge of the door leaf. The profiled strip includes openings that provide a path for gas exchange such that smoke from the storage compartment is detectable outside of the storage compartment by passing the profiled strip.
US09359085B2	Aircraft with fuselage-mounted engines and an internal shield Internal shield in the rear fuselage of an aircraft having a propulsion system formed by two engines mounted on each side of it; the rear fuselage having at least a vertical symmetry plane; the rear fuselage being made of a composite material; the internal shield being located in said vertical symmetry plane and extended in an area that covers the possible trajectories of a set of pre-defined fragments detached from one of said engines in a failure event that would impact on critical elements of the opposite engine; the internal shield having a flat shape and an energy absorption capability that allows stopping said fragments. The invention also refers to a method for determining the area of an internal shield and to an aircraft having said internal shield.
US09359079B2	Slider seat for aircraft An aircraft seat set is provided that allows for providing extra room for passengers and/or allow for selectively increasing the width of an aircraft aisle during enplaning and deplaning and/or increasing the width of some seats during flight. In one embodiment, the aisle seat of the seat set is movably connected to the seat frame of the seat set to allow the aisle seat to be disposed above and in front of the middle seat of the seat set for enplaning and deplaning.
US09359069B2	Apparatus and system for aircraft park brake systems An electro-mechanical actuator including an aircraft parking brake may include a motor shaft, a park brake disk, and a voice coil assembly. The voice coil assembly may include a bobbin configured to translate between an engaged position and a disengaged position. An engagement feature may be coupled to the bobbin. The engagement feature may contact the park brake disk in the engaged position. The engagement feature may be magnetically coupled to a voice coil magnet and washer in the disengaged position.
US09359061B2	Compliant stiffener for aircraft fuselage In accordance with the present invention an aircraft stringerless fuselage structure is provided comprising an impact compliant outer skin having a plurality of resin impregnated skin fibers forming an outer skin surface, an inner stringerless skin surface, and a skin thickness. A plurality of stiffeners is included, each comprising a plurality of resin impregnated stiffener fibers integrated into the inner stringerless skin structure. The plurality of resin impregnated skin fibers are not aligned with the plurality of resin impregnated stiffener fibers.
US09359058B1	Outboard marine propulsion devices and methods of making outboard marine propulsion devices having exhaust runner cooling passages An outboard marine propulsion device comprises an internal combustion engine. At least one engine cooling passage conveys cooling water through the internal combustion engine. An exhaust manifold comprises a plurality of exhaust runners and an exhaust log. The plurality of exhaust runners axially conveys exhaust gases from the internal combustion engine to the exhaust log. A cooling jacket on the exhaust manifold comprises an exhaust log cooling jacket that conveys the cooling water along an outer surface of the exhaust log and a plurality of exhaust runner cooling passages that each axially convey the cooling water along an outer surface of a respective one of the plurality of exhaust runners from the exhaust log cooling jacket to the engine cooling passage.
US09359052B2	Reversing propulsion device for watercraft A human propelled watercraft having a pair of flexible fins extending into the water each adapted to oscillate through an arcuate path in a generally transverse direction with respect to the central longitudinal dimension of said watercraft. Pedals are provided for applying input force whereby as input force is applied, the flexible fins can twist to form an angle of attack for providing forward thrust with respect to the longitudinal dimension of the watercraft while moving in both directions along the arcuate path. The user can pull a lever and cause the fins to rotate 180° and produce thrust in the reverse direction. The fins are able to pivot and swing aft to avoid damage if there is a collision with a submerged object. The fins are more efficient, durable, and adjustable. Simple plastic roller bearings have been adapted to reduce mechanical friction without the need for oil seals.
US09359049B1	Flotation-hydration system A flotation-hydration system to be worn by a user, particularly in a water borne environment, includes a vest assembly dimensioned to at least partially surround the user's upper torso while donned by the user in an operative manner. The vest assembly comprises a plurality of panels securely attached to one another, and a flotation assembly comprising at least one flotation member having a buoyant material of construction disposed in one of the panels of the vest assembly. A hydration support assembly is disposed substantially within the vest assembly and includes a chamber support unit, wherein the chamber support unit is dimensioned and configured to receive a hydration chamber in a supported relation therein. A dispensing tube is routed from the hydration chamber to the front of the vest assembly, for ready access by the user, through a dispensing tube retention channel.
US09359038B2	Rear-wheel suspension system for two-wheeled vehicle A rear-wheel suspension system for a two-wheeled vehicle includes a pair of right- and left-side center frames; a swing arm; and a shock absorber, wherein the shock absorber includes a tubular buffer and a spring, wherein the intake system part is a curved tubular member, wherein a position of the spring is shifted downwardly so that the intake system part are moved toward an interior of the vehicle body by a dimension corresponding to the spring, wherein a lower end of the intake system part is above the upper end of the spring, wherein a part of the intake system part is closer than an outer end of the spring to the center of the tubular buffer, and wherein the shock absorber and the intake system part are disposed between a pair of right- and left-side center frames.
US09359034B2	Cycle and associated components A recumbent cycle includes a toothed belt drive system and rear suspension. It also includes a double A-arm suspension assembly and at least one transmission having a planetary gear arrangement.
US09359022B2	Limiter strap adjustment system for a snowmobile suspension A snowmobile rear suspension assembly has a pair of slide rails and at least one suspension arm pivotally connected thereto and adapted to be pivotally connected to a tunnel. A shock absorber is adapted to be pivotally connected between the tunnel and the slide rails. A limiter strap, adapted to extend between the tunnel and the slide rails, is substantially inextensible to limit separation therebetween. A strap holder, connected between an end of the limiter strap and the slide rails or the tunnel when the at least one suspension arm is connected to the tunnel, is moveable between a first and a second strap holder position. A position of the end of the limiter strap, relative to the slide rails or the tunnel, is different in the first strap holder position compared to the second strap holder position. A method of adjusting the limiter strap is also disclosed.
US09359006B2	Electric power steering system There is provided an reliable electric power steering system. The electric power steering system includes a torque sensor that outputs a detection signal corresponding to a steering torque, and a controller. The controller computes a detected steering torque value based on the detection signal, and a torque differential value, which is a first-order time differential value of the detected steering torque value. The controller computes a current command value by providing compensation to a basic current command value based on the detected steering torque value with the use of a compensation value based on the torque differential value. When the detected steering torque value is held for a predetermined period, the controller holds the torque differential value at a value computed before the detected steering torque value is held, during the period in which the detected steering torque value is held.
US09359005B2	Drive mechanism for automated guided vehicle A drive mechanism for an AGV that includes a drive unit for propelling the AGV and a steering unit for steering the AGV. The drive unit has a drive motor, drive transmission, and a drive wheel. The steering unit has a steering motor. Both motors are fixedly mounted on the AGV and remain stationary relative to each other while the drive motor rotates the drive wheel and the steering motor steers the drive wheel. The drive transmission couples the drive motor to the drive wheel and can be at least partially mounted within a gear housing that is rotatably mounted via a bearing so that the drive motor can be operated to move the AGV via power transferred to the drive wheel via the drive transmission, and the steering motor can be operated to steer the drive wheel by rotation of the gear housing and drive wheel via the bearing.
US09359003B2	Clutch device and steering device A clutch apparatus is configured such that a first mode, a second mode and a third can be switched among these three modes. In the first mode, the rotating force is not transmitted between the steering-wheel-side housing and the tire-side housing. In the second mode, the steering-wheel-side housing and the tire-side housing are being mutually locked in place and, in this locked state, the rotating force can be transmitted to for the rotation in the both directions. In the third mode, the transmission of the rotating force can be canceled such that while the rotating force can be transmitted, between the steering-wheel-side housing and the tire-side housing, relative to the rotation in one direction, the rotation of either the steering-wheel-side housing or the tire-side housing in the other direction is allowed.
US09359002B2	Steering-column device A steering device includes a fixed bracket which includes a first plate, a movable jacket which rotatably supports a steering shaft, a movable bracket which includes a second plate, a suspension mechanism and a resin pin. The suspension mechanism includes a suspension shaft connecting the first plate and the second plate, and is configured to move in a column movement direction along with the second plate at the time of the secondary collision. The resin pin is inserted into a first hole provided in the first plate and a second hole provided in the second plate, and is configured to be broken at the time of the secondary collision. The resin pin has a predetermined amount of play in a direction orthogonal to the column movement direction with respect to at least one of the first hole and the second hole.
US09358996B2	Blade cart for a wind turbine blade A blade cart for a wind turbine blade for use during the manufacturing of such a blade is described. The cart presents an adjustable and adaptable support for the tip end of a blade after the blade is removed from the mold. The cart is rotatable, and comprises selectively actuatable and/or removable support surfaces to provided easy access to the surfaces of the molded blade for the performance of post-molding operations, e.g. blade surface grinding, coating, etc.
US09358992B2	Magnetic rail brake device A magnetic rail brake device includes a magnetic main part and pole shoes with friction surfaces. The friction surfaces of the pole shoes are made of the material of the main part in first regions and of a different material in second regions.
US09358991B2	Multi-car vehicle A multi-car vehicle with a first car of the multi-car vehicle and a second car of the vehicle and having a connection device having an elongated body for transmitting the pushing force required to push the first car in front of the second car, when the second car is moving, the elongated body having a longitudinal axis, a connection to connect the elongated body to the first car or the second car and suitable to transmit the pushing force from the second car to the elongated body or from the elongated body to the first car, the first car and/or the second car having an underframe that comprises at least one longitudinal beam and/or at least one cross beam, wherein the elongated body is arranged approximately at the same vertical level as the longitudinal beam and/or the cross beam and/or is arranged in such a manner that with regard to the vertical direction the elongated body at least partially overlaps with the beam.
US09358981B2	Methods and system for improving launching of a hybrid vehicle Systems and methods for improving launching of a stopped hybrid vehicle are presented. The systems and methods adjust speed of a motor to reduce lag between an increase in driver demand torque and torque being produced at vehicle wheels. In one example, motor torque is adjusted to a maximum motor torque to improve vehicle launch during select conditions where driver demand torque is not a maximum level.
US09358975B1	Virtual moving safety limits for vehicles transporting objects Example systems and methods are disclosed for implementing vehicle operation limits to prevent vehicle load failure during vehicle teleoperation. The method may include receiving sensor data from sensors on a vehicle that carries a load. The vehicle may be controlled by a remote control system. The load weight and dimensions may be determined based on the sensor data. In order to prevent a vehicle load failure, a forward velocity limit and an angular velocity limit may be calculated. Vehicle load failures may include the vehicle tipping over, the load tipping over, the load sliding off of the vehicle, or collisions. The vehicle carrying the load may be restricted from exceeding the forward velocity limit and/or the angular velocity limit during vehicle operation. The remote control system may display a user interface indicating to a remote operator the forward velocity limit and the angular velocity limit.
US09358970B2	Vehicle A vehicle comprises a rotary electric machine, an inverter and an electronic control unit. The inverter is configured to supply current to the rotary electric machine. The electronic control unit is configured to set a control mode of the inverter to a first mode on a condition that the electronic control unit determines that there is no possibility of occurrence of the electrolytic corrosion. The electronic control unit configured to set the control mode of the inverter to a second mode and maintain output of the rotary electric machine at user request output on a condition that the electronic control unit determines that there is a possibility of occurrence of the electrolytic corrosion. The second mode is a mode in which occurrence of the electrolytic corrosion is further suppressed compared to the first mode.
US09358957B2	Windscreen wiper device A windscreen wiper device includes an elastic, elongated carrier element, as well as an elongated wiper blade, which can be placed in abutment with a windscreen to be wiped. The wiper blade includes an upper holding part holding at least one longitudinal strip of the carrier element disposed in at least one longitudinal groove of the upper holding part, as well as a lower wiping part, which windscreen wiper device includes a connecting device for an oscillating arm. The oscillating arm is pivotally connected to a rod of the connecting device about a pivot axis near one end thereof, with the interposition of a joint part, wherein the connecting device includes limitation means for limiting the maximum rotation angle of the pivotal movement of the oscillating arm.
US09358954B2	System and method for finding vehicle A system for finding a vehicle includes a function controller, a key for matching with and controlling the function controller, and a portable device. The portable device can match with the key and transmit an instruction to the key. The key includes a first positioning module, and the function controller includes a second positioning module coupled to the first positioning module. The first positioning module and the second positioning module can receive data as to the distance between and respective locations of the chip key and the function controller. The present disclosure also discloses a method for finding vehicle.
US09358949B2	Belt tensioner for a safety belt system A belt tensioner for a seat belt system includes a belt shaft housing, a belt shaft pivoted about an axis in the belt shaft housing, a rope reel tightly connected to the belt shaft. A tensioner drive includes a tensioner tube, a deformable plastic element guided to be longitudinally movable in the tensioner tube, a drive pinion and a pull rope which is partly wound onto the rope reel. The plastic element is adapted to engage in the drive pinion and to drive the drive pinion in the tensioning direction. During rotation of the drive pinion the pull rope is wound onto a rope drum of the drive pinion, on the one hand, and is unwound from the rope reel, on the other hand, while the belt shaft rotates.
US09358948B2	Buckle device for seat belt of vehicle Provided is a buckle device that fixes a seat belt mounted on a 2nd-row seat or a 3rd-row seat to the vehicle body floor in a vehicle. The buckle device may include a buckle bracket having an upper end with a hole for connecting with a seat belt and a lower end connected to a rail on a vehicle body floor by a buckle connection bolt, and a wire fixing bracket connected between a side of the buckle bracket and a side of a seat frame and absorbing vibration of a seat.
US09358945B2	Airbag device for a front passenger seat An airbag housed in the housing and inflatable with an inflation gas for deployment rearward in order to protect a passenger in a front passenger seat. The airbag includes a main bag section that includes at its rear surface a front-collision arresting plane for catching the passenger upon a frontal collision, and an auxiliary bag section that includes an oblique-collision arresting section protruding rearward relative to the main bag section. The oblique-collision arresting section includes on its lateral an oblique-collision arresting plane for catching a head of the passenger upon an oblique collision. The oblique-collision arresting section is a high-pressure section which has a higher internal pressure than the main bag section when inflated. The airbag further includes in a front region of the auxiliary bag section a low-pressure section that is in gas communication with the main bag section and partitioned from the high-pressure section by a partition wall.
US09358943B2	Side airbag for installation into a motor vehicle, vehicle seat with such a side airbag and motor vehicle A side airbag for installation into a motor vehicle, a vehicle seat with such a side airbag and a motor vehicle with such a vehicle seat are described. The side airbag comprises at least one mounting device for mounting the side airbag on the backrest of the vehicle seat, an outer skin with a first side wall extending forwards, when viewed in the vehicle direction, and a second side wall connected to the first side wall. In order to be able, at as low a cost as possible, to protect the passengers to be protected better against a movement towards the middle of the vehicle, the second side wall extends essentially cross-ways to the vehicle direction when the outer skin is fully deployed and free from external forces, so that at least a third side wall connecting the first two side walls is present.
US09358937B2	Wire harness with sheathing member and path regulators A wire harness includes a wire bundle and a sheathing member covering the wire bundle and configured from a nonwoven member that has been hot-pressed. The sheathing member includes a plurality of path regulators along each of an extension direction and a circumference direction of the wire bundle, the path regulators being capable of regulating a path of a long member to be arranged along a surface of the sheathing member.
US09358932B1	Device and method for transporting elongate objects using a pick-up truck A device for securing ladders to a vehicle having telescoping cross bar having pivotal arms pivotally attached at each end of the telescoping cross bar, respectively, the telescoping crossbar having a receiving portion and an insertion portion, the insertion portion and receiving portion sized such that there is a close fit when inserting the insertion portion into the receiving portion, each pivotable arm has an arm body that includes a pivot arm aperture, at each distal end of the insertion portion and receiving portion are at least one pivot tang, also located at each distal end of the insertion portion and receiving portion is a ladder insertion tang, the ladder insertion tangs are attached to projecting tabs on the distal ends and are inwardly directed, and the receiving portion includes a movement limiting mechanism.
US09358931B2	Adapter for vehicle mount and method of use thereof An adapter for a vehicle mount having a base portion having a top surface and a bottom surface, the bottom surface having a high friction element, the high friction element reducing a lateral movement of the base portion when positioned on an exterior surface of vehicle, and a receiver disposed on the base portion, the receiver configured to receive a portion of a vehicle mount, wherein a load of the vehicle mount is distributed across the surface area of the base portion is provided. Furthermore, an associated method is also provided.

1 2 3 4 5 6 7 8 9 10