Ungulates with Genetically Modified Immune Systems

FIELD OF THE INVENTION

The present invention provides ungulate animals, tissue and organs as well as cells and cell lines derived from such animals, tissue and organs, which lack expression of functional endogenous immunoglobulin loci. The present invention also provides ungulate animals, tissue and organs as well as cells and cell lines derived from such animals, tissue and organs, which express xenogenous, such as human, immunoglobulin loci. The present invention further provides ungulate, such as porcine genomic DNA sequence of porcine heavy and light chain immunogobulins. Such animals, tissues, organs and cells can be used in research and medical therapy. In addition, methods are provided to prepare such animals, organs, tissues, and cells.

BACKGROUND OF THE INVENTION

An antigen is an agent or substance that can be recognized by the body as ‘foreign’. Often it is only one relatively small chemical group of a larger foreign substance which acts as the antigen, for example a component of the cell wall of a bacterium. Most antigens are proteins, though carbohydrates can act as weak antigens. Bacteria, viruses and other microorganisms commonly contain many antigens, as do pollens, dust mites, molds, foods, and other substances. The body reacts to antigens by making antibodies. Antibodies (also called immunoglobulins (Igs)) are proteins that are manufactured by cells of the immune system that bind to an antigen or foreign protein. Antibodies circulate in the serum of blood to detect foreign antigens and constitute the gamma globulin part of the blood proteins. These antibodies interact chemically with the antigen in a highly specific manner, like two pieces of a jigsaw puzzle, forming an antigen/antibody complex, or immune complex. This binding neutralizes or brings about the destruction of the antigen.

When a vertebrate first encounters an antigen, it exhibits a primary humoral immune response. If the animal encounters the same antigen after a few days the immune response is more rapid and has a greater magnitude. The initial encounter causes specific immune cell (B-cell) clones to proliferate and differentiate. The progeny lymphocytes include not only effector cells (antibody producing cells) but also clones of memory cells, which retain the capacity to produce both effector and memory cells upon subsequent stimulation by the original antigen. The effector cells live for only a few days. The memory cells live for a lifetime and can be reactivated by a second stimulation with the same antigen. Thus, when an antigen is encountered a second time, its memory cells quickly produce effector cells which rapidly produce massive quantities of antibodies.

By exploiting the unique ability of antibodies to interact with antigens in a highly specific manner, antibodies have been developed as molecules that can be manufactured and used for both diagnostic and therapeutic applications. Because of their unique ability to bind to antigenic epitopes, polyclonal and monoclonal antibodies can be used to identify molecules carrying that epitope or can be directed, by themselves or in conjunction with another moiety, to a specific site for diagnosis or therapy. Polyclonal and monoclonal antibodies can be generated against practically any pathogen or biological target. The term polyclonal antibody refers to immune sera that usually contain pathogen-specific antibodies of various isotypes and specificities. In contrast, monoclonal antibodies consist of a single immunoglobulin type, representing one isotype with one specificity.

In 1890, Shibasaburo Kitazato and Emil Behring conducted the fundamental experiment that demonstrated immunity can be transmitted from one animal to another by transferring the serum from an immune animal to a non-immune animal. This landmark experiment laid the foundation for the introduction of passive immunization into clinical practice. However, wide scale serum therapy was largely abandoned in the 1940s because of the toxicity associated with the administration of heterologous sera and the introduction of effective antimicrobial chemotherapy. Currently, such polyclonal antibody therapy is indicated to treat infectious diseases in relatively few situations, such as replacement therapy in immunoglobulin-deficient patients, post-exposure prophylaxis against several viruses (e.g., rabies, measles, hepatitis A and B, varicella), and toxin neutralization (diphtheria, tetanus, and botulism). Despite the limited use of serum therapy, in the United States, more than 16 metric tons of human antibodies are required each year for intravenous antibody therapy. Comparable levels of use exist in the economies of most highly industrialized countries, and the demand can be expected to grow rapidly in developing countries. Currently, human antibody for passive immunization is obtained from the pooled serum of donors. Thus, there is an inherent limitation in the amount of human antibody available for therapeutic and prophylactic therapies.

The use of antibodies for passive immunization against biological warfare agents represents a very promising defense strategy. The final line of defense against such agents is the immune system of the exposed individual. Current defense strategies against biological weapons include such measures as enhanced epidemiologic surveillance, vaccination, and use of antimicrobial agents. Since the potential threat of biological warfare and bioterrorism is inversely proportional to the number of immune persons in the targeted population, biological agents are potential weapons only against populations with a substantial proportion of susceptible persons.

Vaccination can reduce the susceptibility of a population against specific threats; provided that a safe vaccine exists that can induce a protective response. Unfortunately, inducing a protective response by vaccination may take longer than the time between exposure and onset of disease. Moreover, many vaccines require multiple doses to achieve a protective immune response, which would limit their usefulness in an emergency to provide rapid prophylaxis after an attack. In addition, not all vaccine recipients mount a protective response, even after receiving the recommended immunization schedule.

Drugs can provide protection when administered after exposure to certain agents, but none are available against many potential agents of biological warfare. Currently, no small-molecule drugs are available that prevent disease following exposure to preformed toxins. The only currently available intervention that could provide a state of immediate immunity is passive immunization with protective antibody (Arturo Casadevall “Passive Antibody Administration (Immediate Immunity) as a Specific Defense Against Biological Weapons” from Emerging Infectious Diseases, Posted Sep. 12, 2002).

In addition to providing protective immunity, modern antibody-based therapies constitute a potentially useful option against newly emergent pathogenic bacteria, fungi, virus and parasites (A. Casadevall and M. D. Scharff, Clinical Infectious Diseases 1995; 150). Therapies of patients with malignancies and cancer (C. Botti et al, Leukemia 1997; Suppl 2:S55-59; B. Bodey, S. E. Siegel, and H. E. Kaiser, Anticancer Res 1996; 16(2):661), therapy of steroid resistant rejection of transplanted organs as well as autoimmune diseases can also be achieved through the use of monoclonal or polyclonal antibody preparations (N. Bonnefoy-Berard and J. P. Revillard, J Heart Lung Transplant 1996; 15(5):435-442; C. Colby, et al Ann Pharmacother 1996; 30(10):1164-1174; M. J. Dugan, et al, Ann Hematol 1997; 75(1-2):41 2; W. Cendrowski, Boll Ist Sieroter Milan 1997; 58(4):339-343; L. K. Kastrukoff, et al Can J Neurol Sci 1978; 5(2):175178; J. E. Walker et al J Neurol Sci 1976; 29(2-4):303309).

Recent advances in the technology of antibody production provide the means to generate human antibody reagents, while avoiding the toxicities associated with human serum therapy. The advantages of antibody-based therapies include versatility, low toxicity, pathogen specificity, enhancement of immune function, and favorable pharmacokinetics.

The clinical use of monoclonal antibody therapeutics has just recently emerged. Monoclonal antibodies have now been approved as therapies in transplantation, cancer, infectious disease, cardiovascular disease and inflammation. In many more monoclonal antibodies are in late stage clinical trials to treat a broad range of disease indications. As a result, monoclonal antibodies represent one of the largest classes of drugs currently in development.

Despite the recent popularity of monoclonal antibodies as therapeutics, there are some obstacles for their use. For example, many therapeutic applications for monoclonal antibodies require repeated administrations, especially for chronic diseases such as autoimmunity or cancer. Because mice are convenient for immunization and recognize most human antigens as foreign, monoclonal antibodies against human targets with therapeutic potential have typically been of murine origin. However, murine monoclonal antibodies have inherent disadvantages as human therapeutics. For example, they require more frequent dosing to maintain a therapeutic level of monoclonal antibodies because of a shorter circulating half-life in humans than human antibodies. More critically, repeated administration of murine immunoglobulin creates the likelihood that the human immune system will recognize the mouse protein as foreign, generating a human anti-mouse antibody response, which can cause a severe allergic reaction. This possibility of reduced efficacy and safety has lead to the development of a number of technologies for reducing the immunogenicity of murine monoclonal antibodies.

Polyclonal antibodies are highly potent against multiple antigenic targets. They have the unique ability to target and kill a plurality of “evolving targets” linked with complex diseases. Also, of all drug classes, polyclonals have the highest probability of retaining activity in the event of antigen mutation. In addition, while monoclonals have limited therapeutic activity against infectious agents, polyclonals can both neutralize toxins and direct immune responses to eliminate pathogens, as well as biological warfare agents.

The development of polyclonal and monoclonal antibody production platforms to meet future demand for production capacity represents a promising area that is currently the subject of much research. One especially promising strategy is the introduction of human immunoglobulin genes into mice or large domestic animals. An extension of this technology would include inactivation of their endogenous immunoglobulin genes. Large animals, such as sheep, pigs and cattle, are all currently used in the production of plasma derived products, such as hyperimmune serum and clotting factors, for human use. This would support the use of human polyclonal antibodies from such species on the grounds of safety and ethics. Each of these species naturally produces considerable quantities of antibody in both serum and milk.

Arrangement of Genes Encoding Immunoglobulins

Antibody molecules are assembled from combinations of variable gene elements, and the possibilities resulting from combining the many variable gene elements in the germline enable the host to synthesize antibodies to an extraordinarily large number of antigens. Each antibody molecule consists of two classes of polypeptide chains, light (L) chains (that can be either kappa (κ) L-chain or lambda (λ) L-chain) and heavy (H) chains. The heavy and light chains join together to define a binding region for the epitope. A single antibody molecule has two identical copies of the L chain and two of the H chain. Each of the chains is comprised of a variable region (V) and a constant region (C). The variable region constitutes the antigen-binding site of the molecule. To achieve diverse antigen recognition, the DNA that encodes the variable region undergoes gene rearrangement. The constant region amino acid sequence is specific for a particular isotype of the antibody, as well as the host which produces the antibody, and thus does not undergo rearrangement.

The mechanism of DNA rearrangement is similar for the variable region of both the heavy- and light-chain loci, although only one joining event is needed to generate a light-chain gene whereas two are needed to generate a complete heavy-chain gene. The most common mode of rearrangement involves the looping-out and deletion of the DNA between two gene segments. This occurs when the coding sequences of the two gene segments are in the same orientation in the DNA. A second mode of recombination can occur between two gene segments that have opposite transcriptional orientations. This mode of recombination is less common, although such rearrangements can account for up to half of all V_κ to J_κ joins; the transcriptional orientation of half of the human V_κ gene segments is opposite to that of the J_κ gene segments.

The DNA sequence encoding a complete V region is generated by the somatic recombination of separate gene segments. The V region, or V domain, of an immunoglobulin heavy or light chain is encoded by more than one gene segment. For the light chain, the V domain is encoded by two separate DNA segments. The first segment encodes the first 95-101 amino acids of the light chain and is termed a V gene segment because it encodes most of the V domain. The second segment encodes the remainder of the V domain (up to 13 amino acids) and is termed a joining or J gene segment. The joining of a V and a J gene segment creates a continuous exon that encodes the whole of the light-chain V region. To make a complete immunoglobulin light-chain messenger RNA, the V-region exon is joined to the C-region sequence by RNA splicing after transcription.

A heavy-chain V region is encoded in three gene segments. In addition to the V and J gene segments (denoted V_H and J_H to distinguish them from the light-chain V_L and J_L), there is a third gene segment called the diversity or D_H gene segment, which lies between the V_H and J_H gene segments. The process of recombination that generates a complete heavy-chain V region occurs in two separate stages. In the first, a D_H gene segment is joined to a J_H gene segment; then a V_H gene segment rearranges to DJ_H to make a complete V_H-region exon. As with the light-chain genes, RNA splicing joins the assembled V-region sequence to the neighboring C-region gene.

Diversification of the antibody repertoire occurs in two stages: primarily by rearrangement (“V(D)J recombination”) of Ig V, D and J gene segments in precursor B cells resident in the bone marrow, and then by somatic mutation and class switch recombination of these rearranged Ig genes when mature B cells are activated. Immunoglobulin somatic mutation and class switching are central to the maturation of the immune response and the generation of a “memory” response.

The genomic loci of antibodies are very large and they are located on different chromosomes. The immunoglobulin gene segments are organized into three clusters or genetic loci: the κ, λ, and heavy-chain loci. Each is organized slightly differently. For example, in humans, immunoglobulin genes are organized as follows. The λ light-chain locus is located on chromosome 22 and a cluster of V_λ gene segments is followed by four sets of J_λ gene segments each linked to a single C_λ gene. The κ light-chain locus is on chromosome 2 and the cluster of V_κ, gene segments is followed by a cluster of J_κ gene segments, and then by a single C_κ gene. The organization of the heavy-chain locus, on chromosome 14, resembles that of the κ locus, with separate clusters of V_H, D_H, and J_H gene segments and of C_H genes. The heavy-chain locus differs in one important way: instead of a single C-region, it contains a series of C regions arrayed one after the other, each of which corresponds to a different isotype. There are five immunoglobulin heavy chain isotypes: IgM, IgG, IgA, IgE and IgD. Generally, a cell expresses only one at a time, beginning with IgM. The expression of other isotypes, such as IgG, can occur through isotype switching.

The joining of various V, D and J genes is an entirely random event that results in approximately 50,000 different possible combinations for VDJ(H) and approximately 1,000 for VJ(L). Subsequent random pairing of H and L chains brings the total number of antibody specificities to about 10⁷ possibilities. Diversity is further increased by the imprecise joining of different genetic segments. Rearrangements occur on both DNA strands, but only one strand is transcribed (due to allelic exclusion). Only one rearrangement occurs in the life of a B cell because of irreversible deletions in DNA. Consequently, each mature B cell maintains one immunologic specificity and is maintained in the progeny or clone. This constitutes the molecular basis of the clonal selection; i.e., each antigenic determinant triggers the response of the pre-existing clone of B lymphocytes bearing the specific receptor molecule. The primary repertoire of B cells, which is established by V(D)J recombination, is primarily controlled by two closely linked genes, recombination activating gene (RAG)-1 and RAG-2.

Over the last decade, considerable diversity among vertebrates in both Ig gene diversity and antibody repertoire development has been revealed. Rodents and humans have five heavy chain classes, IgM, IgD, IgG, IgE and IgA, and each have four subclasses of IgG and one or two subclasses of IgA, while rabbits have a single IgG heavy chain gene but 13 genes for different IgA subclasses (Burnett, R. C et al. EMBO J. 8:4047; Honjo, In Honjo, T, Alt. F. W. T. H. eds, Immunoglobulin Genes p. 123 Academic Press, New York). Swine have at least six IgG subclasses (Kacskovics, I et al. 1994 J Immunol 153:3565), but no IgD (Butler et al. 1996 Inter. Immunol 8:1897-1904). A gene encoding IgD has only been described in rodents and primates. Diversity in the mechanism of repertoire development is exemplified by contrasting the pattern seen in rodents and primates with that reported for chickens, rabbits, swine and the domesticated Bovidae. Whereas the former group have a large number of V_H genes belonging to seven to 10 families (Rathbun, G. In Hongo, T. Alt. F. W. and Rabbitts, T. H., eds, Immunoglobulin Genes, p. 63, Academic press New York), the V_H genes of each member of the latter group belong to a single V_H gene family (Sun, J. et al. 1994 J. Immunol. 1553:56118; Dufour, V et al. 1996, J Immunol. 156:2163). With the exception of the rabbit, this family is composed of less than 25 genes. Whereas rodents and primates can utilize four to six J_H segments, only a single J_H is available for repertoire development in the chicken (Reynaud et al. 1989 Adv. Immunol. 57:353). Similarly, Butler et al. (1996 Inter. Immunol 8:1897-1904) hypothesized that swine may resemble the chicken in having only a single J_H gene. These species generally have fewer V, D and J genes; in the pig and cow a single VH gene family exists, consisting of less than 20 gene segments (Butler et al, Advances in Swine in Biomedical Research, eds: Tumbleson and Schook, 1996; Sinclair et al, J. Immunol. 159: 3883, 1997). Together with lower numbers of J and D gene segments, this results in significantly less diversity being generated by gene rearrangement. However, there does appear to be greater numbers of light chain genes in these species. Similar to humans and mice, these species express a single κ light chain but multiple λ light chain genes. However, these do not seem to affect the restricted diversity that is achieved by rearrangement.

Since combinatorial joining of more than 100 V_H, 20-30 D_H and four to six J_H gene segments is a major mechanism of generating the antibody repertoire in humans, species with fewer V_H, D_H or J_H segments must either generate a smaller repertoire or use alternative mechanisms for repertoire development. Ruminants, pigs, rabbits and chickens, utilize several mechanisms to generate antibody diversity. In these species there appears to be an important secondary repertoire development, which occurs in highly specialized lymphoid tissue such as ileal Peyer's patches (Binns and Licence, Adv. Exp. Med. Biol. 186: 661, 1985). Secondary repertoire development occurs in these species by a process of somatic mutation which is a random and not fully understood process. The mechanism for this repertoire diversification appears to be templated mutation, or gene conversion (Sun et al, J. Immunol. 153: 5618, 1994) and somatic hypermutation.

Gene conversion is important for antibody diversification in some higher vertebrates, such as chickens, rabbits and cows. In mice, however, conversion events appear to be infrequent among endogenous antibody genes. Gene conversion is a distinct diversifying mechanism characterized by transfers of homologous sequences from a donor antibody V gene segment to an acceptor V gene segment. If donor and acceptor segments have numerous sequence differences then gene conversion can introduce a set of sequence changes into a V region by a single event. Depending on the species, gene conversion events can occur before and/or after antigen exposure during B cell differentiation (Tsai et al. International Immunology, Vol. 14, No. 1, 55-64, January 2002).

Somatic hypermutation achieves diversification of antibody genes in all higher vertebrate species. It is typified by the introduction of single point mutations into antibody V(D)J segments. Generally, hypermutation appears to be activated in B cells by antigenic stimulation.

Production of Animals with Humanized Immune Systems

In order to reduce the immunogenicity of antibodies generated in mice for human therapeutics, various attempts have been made to replace murine protein sequences with human protein sequences in a process now known as humanization. Transgenic mice have been constructed which have had their own immunoglobulin genes functionally replaced with human immunoglobulin genes so that they produce human antibodies upon immunization. Elimination of mouse antibody production was achieved by inactivation of mouse Ig genes in embryonic stem (ES) cells by using gene-targeting technology to delete crucial cis-acting sequences involved in the process of mouse Ig gene rearrangement and expression. B cell development in these mutant mice could be restored by the introduction of megabase-sized YACs containing a human germline-configuration H- and κ L-chain minilocus transgene. The expression of fully human antibody in these transgenic mice was predominant, at a level of several 100 μg/l of blood. This level of expression is several hundred-fold higher than that detected in wild-type mice expressing the human Ig gene, indicating the importance of inactivating the endogenous mouse Ig genes in order to enhance human antibody production by mice.

The first humanization attempts utilized molecular biology techniques to construct recombinant antibodies. For example, the complementarity determining regions (CDR) from a mouse antibody specific for a hapten were grafted onto a human antibody framework, effecting a CDR replacement. The new antibody retained the binding specificity conveyed by the CDR sequences (P. T. Jones et al. Nature 321: 522-525 (1986)). The next level of humanization involved combining an entire mouse VH region with a human constant region such as gamma₁ (S. L. Morrison et al., Proc. Natl. Acad. Sci., 81, pp. 6851-6855 (1984)). However, these chimeric antibodies, which still contain greater than 30% xenogeneic sequences, are sometimes only marginally less immunogenic than totally xenogeneic antibodies (M. Bruggemann et al., J. Exp. Med., 170, pp. 2153-2157 (1989)).

Subsequently, attempts were carried out to introduce human immunoglobulin genes into the mouse, thus creating transgenic mice capable of responding to antigens with antibodies having human sequences (Bruggemann et al. Proc. Nat'l. Acad. Sci. USA 86:6709-6713 (1989)). Due to the large size of human immunoglobulin genomic loci, these attempts were thought to be limited by the amount of DNA, which could be stably maintained by available cloning vehicles. As a result, many investigators concentrated on producing mini-loci containing limited numbers of V region genes and having altered spatial distances between genes as compared to the natural or germline configuration (See, for example, U.S. Pat. No. 5,569,825). These studies indicated that producing human sequence antibodies in mice was possible, but serious obstacles remained regarding obtaining sufficient diversity of binding specificities and effector functions (isotypes) from these transgenic animals to meet the growing demand for antibody therapeutics.

In order to provide additional diversity, work has been conducted to add large germline fragments of the human Ig locus into transgenic mammals. For example, a majority of the human V, D, and J region genes arranged with the same spacing found in the unrearranged germline of the human genome and the human Cμ and Cδ constant regions was introduced into mice using yeast artificial chromosome (YAC) cloning vectors (See, for example, WO 94/02602). A 22 kb DNA fragment comprising sequences encoding a human gamma-2 constant region and the upstream sequences required for class-switch recombination was latter appended to the foregoing transgene. In addition, a portion of a human kappa locus comprising Vκ, Jκ and Cκ region genes, also arranged with substantially the same spacing found in the unrearranged germline of the human genome, was introduced into mice using YACS. Gene targeting was used to inactivate the murine IgH & kappa light chain immunoglobulin gene loci and such knockout strains were bred with the above transgenic strains to generate a line of mice having the human V, D, J, Cμ, Cδ and Cγ₂ constant regions as well as the human Vκ, Jκ and Cκ region genes all on an inactivated murine immunoglobulin background (See, for example, PCT patent application WO 94/02602 to Kucherlapati et al.; see also Mendez et al., Nature Genetics 15:146-156 (1997)).

Yeast artificial chromosomes as cloning vectors in combination with gene targeting of endogenous loci and breeding of transgenic mouse strains provided one solution to the problem of antibody diversity. Several advantages were obtained by this approach. One advantage was that YACs can be used to transfer hundreds of kilobases of DNA into a host cell. Therefore, use of YAC cloning vehicles allows inclusion of substantial portions of the entire human Ig heavy and light chain regions into a transgenic mouse thus approaching the level of potential diversity available in the human. Another advantage of this approach is that the large number of V genes has been shown to restore full B cell development in mice deficient in murine immunoglobulin production. This ensures that these reconstituted mice are provided with the requisite cells for mounting a robust human antibody response to any given immunogen. (See, for example, WO 94/02602; L. Green and A. Jakobovits, J. Exp. Med. 188:483-495 (1998)). A further advantage is that sequences can be deleted or inserted onto the YAC by utilizing high frequency homologous recombination in yeast. This provides for facile engineering of the YAC transgenes.

In addition, Green et al. Nature Genetics 7:13-21 (1994) describe the generation of YACs containing 245 kb and 190 kb-sized germline configuration fragments of the human heavy chain locus and kappa light chain locus, respectively, which contained core variable and constant region sequences. The work of Green et al. was recently extended to the introduction of greater than approximately 80% of the human antibody repertoire through introduction of megabase sized, germline configuration YAC fragments of the human heavy chain loci and kappa light chain loci, respectively, to produce XenoMouse™ mice. See, for example, Mendez et al. Nature Genetics 15:146-156 (1997), Green and Jakobovits J. Exp. Med. 188:483-495 (1998), European Patent No. EP 0 463 151 B1, PCT Publication Nos. WO 94/02602, WO 96/34096 and WO 98/24893.

Several strategies exist for the generation of mammals that produce human antibodies. In particular, there is the “minilocus” approach that is typified by work of GenPharm International, Inc. and the Medical Research Council, YAC introduction of large and substantially germline fragments of the Ig loci that is typified by work of Abgenix, Inc. (formerly Cell Genesys). The introduction of entire or substantially entire loci through the use microcell fusion as typified by work of Kirin Beer Kabushiki Kaisha.

In the minilocus approach, an exogenous Ig locus is mimicked through the inclusion of pieces (individual genes) from the Ig locus. Thus, one or more V_H genes, one or more D_H genes, one or more J_H genes, a mu constant region, and a second constant region (such as a gamma constant region) are formed into a construct for insertion into an animal. See, for example, U.S. Pat. Nos. 5,545,807, 5,545,806, 5,625,825, 5,625,126, 5,633,425, 5,661,016, 5,770,429, 5,789,650, 5,814,318, 5,591,669, 5,612,205, 5,721,367, 5,789,215, 5,643,763; European Patent No. 0 546 073; PCT Publication Nos. WO 92/03918, WO 92/22645, WO 92/22647, WO 92/22670, WO 93/12227, WO 94/00569, WO 94/25585, WO 96/14436, WO 97/13852, and WO 98/24884; Taylor et al. Nucleic Acids Research 20:6287-6295 (1992), Chen et al. International Immunology 5:647-656 (1993), Tuaillon et al. J. Immunol. 154:6453-6465 (1995), Choi et al. Nature Genetics 4:117-123 (1993), Lonberg et al. Nature 368:856-859 (1994), Taylor et al. International Immunology 6:579-591 (1994), Tuaillon et al. J. Immunol. 154:6453-6465 (1995), and Fishwild et al. Nature Biotech. 14:845-851 (1996).

In the microcell fusion approach, portions or whole human chromosomes can be introduced into mice (see, for example, European Patent Application No. EP 0 843 961 A1). Mice generated using this approach and containing the human Ig heavy chain locus will generally possess more than one, and potentially all, of the human constant region genes. Such mice will produce, therefore, antibodies that bind to particular antigens having a number of different constant regions.

While mice remain the most developed animal for the expression of human immunoglobulins in humans, recent technological advances have allowed for progress to begin in applying these techniques to other animals, such as cows. The general approach in mice has been to genetically modify embryonic stem cells of mice to knock-out murine immunoglobulins and then insert YACs containing human immunoglobulins into the ES cells. However, ES cells are not available for cows or other large animals such as sheep and pigs. Thus, several fundamental developments had to occur before even the possibility existed to generate large animals with immunoglobulin genes knocked-out and that express human antibody. The alternative to ES cell manipulation to create genetically modified animals is cloning using somatic cells that have been genetically modified. Cloning using genetically modified somatic cells for nuclear transfer has only recently been accomplished.

Since the announcement of Dolly's (a cloned sheep) birth from an adult somatic cell in 1997 (Wilmut, I., et al (1997) Nature 385: 810-813), ungulates, including cattle (Cibelli, J et al 1998 Science 280: 1266-1258; Kubota, C. et al. 2000 Proc. Nat'l. Acad. Sci. 97: 990-995), goats (Baguisi, A. et al., (1999) Nat. Biotechnology 17: 456-461), and pigs (Polejaeva, I. A., et al. 2000 Nature 407: 86-90; Betthauser, J. et al. 2000 Nat. Biotechnology 18: 1055-1059) have been cloned.

The next technological advance was the development of the technique to genetically modify the cells prior to nuclear transfer to produce genetically modified animals. PCT publication No. WO 00/51424 to PPL Therapeutics describes the targeted genetic modification of somatic cells for nuclear transfer.

Subsequent to these fundamental developments, single and double allele knockouts of genes and the birth of live animals with these modifications have been reported. Between 2002 and 2004, three independent groups, Immerge Biotherapeutics, Inc. in collaboration with the University of Missouri (Lai et al. (Science (2002) 295: 1089-1092) & Kolber-Simonds et al. (PNAS. (2004) 101(19):7335-40)), Alexion Pharmaceuticals (Ramsoondar et al. (Biol Reprod (2003)69: 437-445) and Revivicor, Inc. (Dai et al. (Nature Biotechnology (2002) 20: 251-255) & Phelps et al. (Science (2003) January 17; 299(5605):411-4)) produced pigs that lacked one allele or both alleles of the alpha-1,3-GT gene via nuclear transfer from somatic cells with targeted genetic deletions. In 2003, Sedai et al. (Transplantation (2003) 76:900-902) reported the targeted disruption of one allele of the alpha-1,3-GT gene in cattle, followed by the successful nuclear transfer of the nucleus of the genetically modified cell and production of transgenic fetuses.

Thus, the feasibility of knocking-out immunoglobulin genes in large animals and inserting human immunoglobulin loci into their cells is just now beginning to be explored. However, due to the complexity and species differences of immunoglobulin genes, the genomic sequences and arrangement of Ig kappa, lambda and heavy chains remain poorly understood in most species. For example, in pigs, partial genomic sequence and organization has only been described for heavy chain constant alpha, heavy chain constant mu and heavy chain constant delta (Brown and Butler Mol Immunol. 1994 June; 31(8):633-42, Butler et al Vet Immunol Immunopathol. 1994 October; 43(1-3):5-12, and Zhao et al J Immunol. 2003 Aug. 1; 171(3):1312-8).

In cows, the immunoglobulin heavy chain locus has been mapped (Zhao et al. 2003 J. Biol. Chem. 278:35024-32) and the cDNA sequence for the bovine kappa gene is known (See, for example, U.S. Patent Publication No. 2003/0037347). Further, approximately 4.6 kb of the bovine mu heavy chain locus has been sequenced and transgenic calves with decreased expression of heavy chain immunoglobulins have been created by disrupting one or both alleles of the bovine mu heavy chain. In addition, a mammalian artificial chromosome (MAC) vector containing the entire unarranged sequences of the human Ig H-chain and κ L-chain has been introduced into cows (TC cows) with the technology of microcell-mediated chromosome transfer and nuclear transfer of bovine fetal fibroblast cells (see, for example, Kuroiwa et al. 2002 Nature Biotechnology 20:889, Kuroiwa et al. 2004 Nat Genet. June 6 Epub, U.S. Patent Publication Nos. 2003/0037347, 2003/0056237, 2004/0068760 and PCT Publication No. WO 02/07648).

While significant progress has been made in the production of bovine that express human immunoglobulin, little has been accomplished in other large animals, such as sheep, goats and pigs. Although cDNA sequence information for immunoglobulin genes of sheeps, goats and pigs is readily available in Genbank, the unique nature of immunoglobulin loci, which undergo massive rearrangements, creates the need to characterize beyond sequences known to be present in mRNAs (or cDNAs). Since immunoglobulin loci are modular and the coding regions are redundant, deletion of a known coding region does not ensure altered function of the locus. For example, if one were to delete the coding region of a heavy-chain variable region, the function of the locus would not be significantly altered because hundreds of other function variable genes remain in the locus. Therefore, one must first characterize the locus to identify a potential “Achilles heel”.

Despite some advancements in expressing human antibodies in cattle, greater challenges remain for inactivation of the endogenous bovine Ig genes, increasing expression levels of the human antibodies and creating human antibody expression in other large animals, such as porcine, for which the sequence and arrangement of immunoglobulin genes are largely unknown.

It is therefore an object of the present invention to provide the arrangement of ungulate immunoglobin germline gene sequence.

It is another object of the present invention to provide novel ungulate immunoglobulin genomic sequences.

It is a further object of the present invention to provide cells, tissues and animals lacking at least one allele of a heavy and/or light chain immunoglobulin gene.

It is another object of the present invention to provide ungulates that express human immunoglobulins.

It is a still further object of the present invention to provide methods to generate cells, tissues and animals lacking at least one allele of novel ungulate immunoglobulin gene sequences and/or express human immunoglobulins.

SUMMARY OF THE INVENTION

The present invention provides for the first time ungulate immunoglobin germline gene sequence arrangement as well as novel genomic sequences thereof. In addition, novel ungulate cells, tissues and animals that lack at least one allele of a heavy or light chain immunoglobulin gene are provided. Based on this discovery, ungulates can be produced that completely lack at least one allele of a heavy and/or light chain immunoglobulin gene. In addition, these ungulates can be further modified to express xenoogenous, such as human, immunoglobulin loci or fragments thereof.

In one aspect of the present invention, a transgenic ungulate that lacks any expression of functional endogenous immunoglobulins is provided. In one embodiment, the ungulate can lack any expression of endogenous heavy and/or light chain immunoglobulins. The light chain immunoglobulin can be a kappa and/or lambda immunoglobulin. In additional embodiments, transgenic ungulates are provided that lack expression of at least one allele of an endogenous immunoglobulin wherein the immunoglobulin is selected from the group consisting of heavy chain, kappa light chain and lambda light chain or any combination thereof. In one embodiment, the expression of functional endogenous immunoglobulins can be accomplished by genetic targeting of the endogenous immunoglobulin loci to prevent expression of the endogenous immunoglobulin. In one embodiment, the genetic targeting can be accomplished via homologous recombination. In another embodiment, the transgenic ungulate can be produced via nuclear transfer.

In other embodiments, the transgenic ungulate that lacks any expression of functional endogenous immunoglobulins can be further genetically modified to express an xenogenous immunoglobulin loci. In an alternative embodiment, porcine animals are provided that contain an xenogeous immunoglobulin locus. In one embodiment, the xenogeous immunoglobulin loci can be a heavy and/or light chain immunoglobulin or fragment thereof. In another embodiment, the xenogenous immunoglobulin loci can be a kappa chain locus or fragment thereof and/or a lambda chain locus or fragment thereof. In still further embodiments, an artificial chromosome (AC) can contain the xenogenous immunoglobulin. In one embodiment, the AC can be a yeast AC or a mammalian AC. In a further embodiment, the xenogenous locus can be a human immunoglobulin locus or fragment thereof. In one embodiment, the human immunoglobulin locus can be human chromosome 14, human chromosome 2, and human chromosome 22 or fragments thereof. In another embodiment, the human immunoglobulin locus can include any fragment of a human immunoglobulin that can undergo rearrangement. In a further embodiment, the human immunoglobulin loci can include any fragment of a human immunoglobulin heavy chain and a human immunoglobulin light chain that can undergo rearrangement. In still further embodiment, the human immunoglobulin loci can include any human immunoglobulin locus or fragment thereof that can produce an antibody upon exposure to an antigen. In a particular embodiment, the exogenous human immunoglobulin can be expressed in B cells to produce xenogenous immunoglobulin in response to exposure to one or more antigens.

In another aspect of the present invention, transgenic ungulates are provided that expresses a xenogenous immunoglobulin loci or fragment thereof, wherein the immunoglobulin can be expressed from an immunoglobulin locus that is integrated within an endogenous ungulate chromosome. In one embodiment, ungulate cells derived from the transgenic animals are provided. In one embodiment, the xenogenous immunoglobulin locus can be inherited by offspring. In another embodiment, the xenogenous immunoglobulin locus can be inherited through the male germ line by offspring. In still further embodiments, an artificial chromosome (AC) can contain the xenogenous immunoglobulin. In one embodiment, the AC can be a yeast AC or a mammalian AC. In a further embodiment, the xenogenous locus can be a human immunoglobulin locus or fragment thereof. In one embodiment, the human immunoglobulin locus can be human chromosome 14, human chromosome 2, and human chromosome 22 or fragments thereof. In another embodiment, the human immunoglobulin locus can include any fragment of a human immunoglobulin that can undergo rearrangement. In a further embodiment, the human immunoglobulin loci can include any fragment of a human immunoglobulin heavy chain and a human immunoglobulin light chain that can undergo rearrangement. In still further embodiment, the human immunoglobulin loci can include any human immunoglobulin locus or fragment thereof that can produce an antibody upon exposure to an antigen. In a particular embodiment, the exogenous human immunoglobulin can be expressed in B cells to produce xenogenous immunoglobulin in response to exposure to one or more antigens.

In another aspect of the present invention, novel genomic sequences encoding the heavy chain locus of ungulate immunoglobulin are provided. In one embodiment, an isolated nucleotide sequence encoding porcine heavy chain is provided that includes at least one variable region, two diversity regions, at least four joining regions and at least one constant region, such as the mu constant region, for example, as represented in Seq ID No. 29. In another embodiment, an isolated nucleotide sequence is provided that includes at least four joining regions and at least one constant region, such as the mu constant region, of the porcine heavy chain genomic sequence, for example, as represented in Seq ID No. 4. In a further embodiment, nucleotide sequence is provided that includes 5′ flanking sequence to the first joining region of the porcine heavy chain genomic sequence, for example, as represented in Seq ID No 1. Still further, nucleotide sequence is provided that includes 3′ flanking sequence to the first joining region of the porcine heavy chain genomic sequence, for example, as represented in the 3′ region of Seq ID No 4. In further embodiments, isolated nucleotide sequences as depicted in Seq ID Nos 1, 4 or 29 are provided. Nucleic acid sequences at least 80, 85, 90, 95, 98 or 99% homologous to Seq ID Nos 1, 4 or 29 are also provided. In addition, nucleotide sequences that contain at least 10, 15, 17, 20, 25 or 30 contiguous nucleotides of Seq ID Nos 1, 4 or 29 are provided. In one embodiment, the nucleotide sequence contains at least 17, 20, 25 or 30 contiguous nucleotides of Seq ID No 4 or residues 1-9,070 of Seq ID No 29. In another embodiment, the nucleotide sequence contains residues 9,070-11039 of Seq ID No 29. Further provided are nucleotide sequences that hybridize, optionally under stringent conditions, to Seq ID Nos 1, 4 or 29, as well as, nucleotides homologous thereto.

In another embodiment, novel genomic sequences encoding the kappa light chain locus of ungulate immunoglobulin are provided. The present invention provides the first reported genomic sequence of ungulate kappa light chain regions. In one embodiment, nucleic acid sequence is provided that encodes the porcine kappa light chain locus. In another embodiment, the nucleic acid sequence can contain at least one joining region, one constant region and/or one enhancer region of kappa light chain. In a further embodiment, the nucleotide sequence can include at least five joining regions, one constant region and one enhancer region, for example, as represented in Seq ID No. 30. In a further embodiment, an isolated nucleotide sequence is provided that contains at least one, at least two, at least three, at least four or five joining regions and 3′ flanking sequence to the joining region of porcine genomic kappa light chain, for example, as represented in Seq ID No 12. In another embodiment, an isolated nucleotide sequence of porcine genomic kappa light chain is provided that contains 5′ flanking sequence to the first joining region, for example, as represented in Seq ID No 25. In a further embodiment, an isolated nucleotide sequence is provided that contains 3′ flanking sequence to the constant region and, optionally, the 5′ portion of the enhancer region, of porcine genomic kappa light chain, for example, as represented in Seq ID Nos. 15, 16 and/or 19.

In further embodiments, isolated nucleotide sequences as depicted in Seq ID Nos 30, 12, 25, 15, 16 or 19 are provided. Nucleic acid sequences at least 80, 85, 90, 95, 98 or 99% homologous to Seq ID Nos 30, 12, 25, 15, 16 or 19 are also provided. In addition, nucleotide sequences that contain at least 10, 15, 17, 20, 25 or 30 contiguous nucleotides of Seq ID Nos 30, 12, 25, 15, 16 or 19 are provided. Further provided are nucleotide sequences that hybridizes, optionally under stringent conditions, to Seq ID Nos 30, 12, 25, 15, 16 or 19, as well as, nucleotides homologous thereto.

In another embodiment, novel genomic sequences encoding the lambda light chain locus of ungulate immunoglobulin are provided. The present invention provides the first reported genomic sequence of ungulate lambda light chain regions. In one embodiment, the porcine lambda light chain nucleotides include a concatamer of J to C units. In a specific embodiment, an isolated porcine lambda nucleotide sequence is provided, such as that depicted in Seq ID No. 28. In one embodiment, a nucleotide sequence is provided that includes 5′ flanking sequence to the first lambda J/C unit of the porcine lambda light chain genomic sequence, for example, as represented by Seq ID No 32. Still further, nucleotide sequence is provided that includes 3′ flanking sequence to the J/C cluster region of the porcine lambda light chain genomic sequence, for example, approximately 200 base pairs downstream of lambda J/C, such as that represented by Seq ID No 33. Alternatively, nucleotide sequence is provided that includes 3′ flanking sequence to the J/C cluster region of the porcine lambda light chain genomic sequence, for example, as represented by Seq ID No 34, 35, 36, 37, 38, and/or 39.

In a further embodiment, nucleic acid sequences are provided that encode bovine lambda light chain locus, which can include at least one joining region-constant region pair and/or at least one variable region, for example, as represented by Seq ID No. 31. In further embodiments, isolated nucleotide sequences as depicted in Seq ID Nos 28, 31, 32, 33, 34, 35, 36, 37, 38, or 39 are provided. Nucleic acid sequences at least 80, 85, 90, 95, 98 or 99% homologous to Seq ID Nos 28, 31, 32, 33, 34, 35, 36, 37, 38, or 39 are also provided. In addition, nucleotide sequences that contain at least 10, 15, 17, 20, 25 or 30 contiguous nucleotides of Seq ID Nos 28, 31, 32, 33, 34, 35, 36, 37, 38, or 39 are provided. Further provided are nucleotide sequences that hybridizes, optionally under stringent conditions, to Seq ID Nos 28, 31, 32, 33, 34, 35, 36, 37, 38, or 39, as well as, nucleotides homologous thereto.

In another embodiment, nucleic acid targeting vector constructs are also provided. The targeting vectors can be designed to accomplish homologous recombination in cells. These targeting vectors can be transformed into mammalian cells to target the ungulate heavy chain, kappa light chain or lambda light chain genes via homologous recombination. In one embodiment, the targeting vectors can contain a 3′ recombination arm and a 5′ recombination arm (i.e. flanking sequence) that is homologous to the genomic sequence of ungulate heavy chain, kappa light chain or lambda light chain genomic sequence, for example, sequence represented by Seq ID Nos. 1, 4, 29, 30, 12, 25, 15, 16, 19, 28 or 31, as described above. The homologous DNA sequence can include at least 15 bp, 20 bp, 25 bp, 50 bp, 100 bp, 500 bp, 1 kbp, 2 kbp, 4 kbp, 5 kbp, 10 kbp, 15 kbp, 20 kbp, or 50 kbp of sequence homologous to the genomic sequence.

In one embodiment, the 5′ and 3′ recombination arms of the targeting vector can be designed such that they flank the 5′ and 3′ ends of at least one functional variable, joining, diversity, and/or constant region of the genomic sequence. The targeting of a functional region can render it inactive, which results in the inability of the cell to produce functional immunoglobulin molecules. In another embodiment, the homologous DNA sequence can include one or more intron and/or exon sequences. In addition to the nucleic acid sequences, the expression vector can contain selectable marker sequences, such as, for example, enhanced Green Fluorescent Protein (eGFP) gene sequences, initiation and/or enhancer sequences, poly A-tail sequences, and/or nucleic acid sequences that provide for the expression of the construct in prokaryotic and/or eukaryotic host cells. The selectable marker can be located between the 5′ and 3′ recombination arm sequence.

In one particular embodiment, the targeting vector can contain 5′ and 3′ recombination arms that contain homologous sequence to the 3′ and 5′ flanking sequence of the J6 region of the porcine immunoglobulin heavy chain locus. Since the J6 region is the only functional joining region of the porcine immunoglobulin heavy chain locus, this will prevent the expression of a functional porcine heavy chain immunoglobulin. In a specific embodiment, the targeting vector can contain a 5′ recombination arm that contains sequence homologous to genomic sequence 5′ of the J6 region, including J1-4, and a 3′ recombination arm that contains sequence homologous to genomic sequence 3′ of the J6 region, including the mu constant region (a “J6 targeting construct”), see for example, FIG. 1. Further, this J6 targeting construct can also contain a selectable marker gene that is located between the 5′ and 3′ recombination arms, see for example, Seq ID No 5 and FIG. 1. In other embodiments, the targeting vector can contain a 5′ recombination arm that contains sequence homologous to genomic sequence 5′ of the diversity region, and a 3′ recombination arm that contains sequence homologous to genomic sequence 3′ of the diversity region of the porcine heavy chain locus. In a further embodiment, the targeting vector can contain a 5′ recombination arm that contains sequence homologous to genomic sequence 5′ of the mu constant region and a 3′ recombination arm that contains sequence homologous to genomic sequence 3′ of the mu constant region of the porcine heavy chain locus.

In another particular embodiment, the targeting vector can contain 5′ and 3′ recombination arms that contain homologous sequence to the 3′ and 5′ flanking sequence of the constant region of the porcine immunoglobulin kappa light chain locus. Since the present invention discovered that there is only one constant region of the porcine immunoglobulin kappa light chain locus, this will prevent the expression of a functional porcine kappa light chain immunoglobulin. In a specific embodiment, the targeting vector can contain a 5′ recombination arm that contains sequence homologous to genomic sequence 5′ of the constant region, optionally including the joining region, and a 3′ recombination arm that contains sequence homologous to genomic sequence 3′ of the constant region, optionally including at least part of the enhancer region (a “Kappa constant targeting construct”), see for example, FIG. 2. Further, this kappa constant targeting construct can also contain a selectable marker gene that is located between the 5′ and 3′ recombination arms, see for example, Seq ID No 20 and FIG. 2. In other embodiments, the targeting vector can contain a 5′ recombination arm that contains sequence homologous to genomic sequence 5′ of the joining region, and a 3′ recombination arm that contains sequence homologous to genomic sequence 3′ of the joining region of the porcine kappa light chain locus.

In another particular embodiment, the targeting vector can contain 5′ and 3′ recombination arms that contain homologous sequence to the 3′ and 5′ flanking sequence of the J/C region of the porcine lambda light chain. See FIG. 3. Disruption of the J/C region will prevent the expression of a functional porcine kappa light chain immunoglobulin. In one embodiment, the targeting vector can contain a 5′ recombination arm that contains sequence homologous to genomic sequence 5′ of the first J/C unit and a 3′ recombination arm that contains sequence homologous to genomic sequence 3′ of the last J/C unit. Further, this lambda light chain targeting construct can also contain a selectable marker gene that is located between the 5′ and 3′ recombination arms, see for example FIG. 4.

In a further embodiment, more than one targeting vector can be used to target the ungulate heavy chain, kappa light chain or lambda light chain genes via homologous recombination. For example, two targeting vectors can be used to target the gene of interest. A first targeting vector can contain 5′ and 3′ recombination arms that contain homologous sequence to the 5′ flanking sequence of at least one functional variable, joining, diversity, and/or constant region of the genomic sequence. A second targeting vector can contain 5′ and 3′ recombination arms that contain homologous sequence to the 3′ flanking sequence at least one functional variable, joining, diversity, and/or constant region of the genomic sequence.

In a particular embodiment, the first targeting vector can contain 5′ and 3′ recombination arms that contain homologous sequence to the 5′ flanking sequence of the first J/C unit in the J/C cluster region. See FIG. 5. According to this embodiment, a second targeting vector can contain 5′ and 3′ recombination arms that contain homologous sequence to the 3′ flanking sequence of the last J/C unit in the J/C cluster region. See FIG. 6.

In another embodiment, primers are provided to generate 3′ and 5′ sequences of a targeting vector. The oligonucleotide primers can be capable of hybridizing to porcine immunoglobulin genomic sequence, such as Seq ID Nos. 1, 4, 29, 30, 12, 25, 15, 16, 19, 28 or 31, as described above. In a particular embodiment, the primers hybridize under stringent conditions to Seq ID Nos. 1, 4, 29, 30, 12, 25, 15, 16, 19, 28 or 31, as described above. Another embodiment provides oligonucleotide probes capable of hybridizing to porcine heavy chain, kappa light chain or lambda light chain nucleic acid sequences, such as Seq ID Nos. 1, 4, 29, 30, 12, 25, 15, 16, 19, 28 or 31, as described above. The polynucleotide primers or probes can have at least 14 bases, 20 bases, 30 bases, or 50 bases which hybridize to a polynucleotide of the present invention. The probe or primer can be at least 14 nucleotides in length, and in a particular embodiment, are at least 15, 20, 25, 28, or 30 nucleotides in length.

In one embodiment, primers are provided to amplify a fragment of porcine Ig heavy-chain that includes the functional joining region (the J6 region). In one non-limiting embodiment, the amplified fragment of heavy chain can be represented by Seq ID No 4 and the primers used to amplify this fragment can be complementary to a portion of the J-region, such as, but not limited to Seq ID No 2, to produce the 5′ recombination arm and complementary to a portion of Ig heavy-chain mu constant region, such as, but not limited to Seq ID No 3, to produce the 3′ recombination arm. In another embodiment, regions of the porcine Ig heavy chain (such as, but not limited to Seq ID No 4) can be subcloned and assembled into a targeting vector.

In other embodiments, primers are provided to amplify a fragment of porcine Ig kappa light-chain that includes the constant region. In another embodiment, primers are provided to amplify a fragment of porcine Ig kappa light-chain that includes the J region. In one non-limiting embodiment, the primers used to amplify this fragment can be complementary to a portion of the J-region, such as, but not limited to Seq ID No 21 or 10, to produce the 5′ recombination arm and complementary to genomic sequence 3′ of the constant region, such as, but not limited to Seq ID No 14, 24 or 18, to produce the 3′ recombination arm. In another embodiment, regions of the porcine Ig heavy chain (such as, but not limited to Seq ID No 20) can be subcloned and assembled into a targeting vector.

In another aspect of the present invention, ungulate cells lacking at least one allele of a functional region of an ungulate heavy chain, kappa light chain and/or lambda light chain locus produced according to the process, sequences and/or constructs described herein are provided. These cells can be obtained as a result of homologous recombination. Particularly, by inactivating at least one allele of an ungulate heavy chain, kappa light chain or lambda light chain gene, cells can be produced which have reduced capability for expression of ungulate antibodies. In other embodiments, mammalian cells lacking both alleles of an ungulate heavy chain, kappa light chain and/or lambda light chain gene can be produced according to the process, sequences and/or constructs described herein. In a further embodiment, porcine animals are provided in which at least one allele of an ungulate heavy chain, kappa light chain and/or lambda light chain gene is inactivated via a genetic targeting event produced according to the process, sequences and/or constructs described herein. In another aspect of the present invention, porcine animals are provided in which both alleles of an ungulate heavy chain, kappa light chain and/or lambda light chain gene are inactivated via a genetic targeting event. The gene can be targeted via homologous recombination.

In other embodiments, the gene can be disrupted, i.e. a portion of the genetic code can be altered, thereby affecting transcription and/or translation of that segment of the gene. For example, disruption of a gene can occur through substitution, deletion (“knock-out”) or insertion (“knock-in”) techniques. Additional genes for a desired protein or regulatory sequence that modulate transcription of an existing sequence can be inserted. To achieve multiple genetic modifications of ungulate immunoglobulin genes, in one embodiment, cells can be modified sequentially to contain multiple genetic modifications. In other embodiments, animals can be bred together to produce animals that contain multiple genetic modifications of immunoglobulin genes. As an illustrative example, animals that lack expression of at least one allele of an ungulate heavy chain gene can be further genetically modified or bred with animals lacking at least one allele of a kappa light chain gene.

In embodiments of the present invention, alleles of ungulate heavy chain, kappa light chain or lambda light chain gene are rendered inactive according to the process, sequences and/or constructs described herein, such that functional ungulate immunoglobulins can no longer be produced. In one embodiment, the targeted immunoglobulin gene can be transcribed into RNA, but not translated into protein. In another embodiment, the targeted immunoglobulin gene can be transcribed in an inactive truncated form. Such a truncated RNA may either not be translated or can be translated into a nonfunctional protein. In an alternative embodiment, the targeted immunoglobulin gene can be inactivated in such a way that no transcription of the gene occurs. In a further embodiment, the targeted immunoglobulin gene can be transcribed and then translated into a nonfunctional protein.

In a further aspect of the present invention, ungulate, such as porcine or bovine, cells lacking one allele, optionally both alleles of an ungulate heavy chain, kappa light chain and/or lambda light chain gene can be used as donor cells for nuclear transfer into recipient cells to produce cloned, transgenic animals. Alternatively, ungulate heavy chain, kappa light chain and/or lambda light chain gene knockouts can be created in embryonic stem cells, which are then used to produce offspring. Offspring lacking a single allele of a functional ungulate heavy chain, kappa light chain and/or lambda light chain gene produced according to the process, sequences and/or constructs described herein can be breed to further produce offspring lacking functionality in both alleles through mendelian type inheritance.

In one aspect of the present invention, a method is provided to disrupt the expression of an ungulate immunoglobulin gene by (i) analyzing the germline configuration of the ungulate heavy chain, kappa light chain or lambda light chain genomic locus; (ii) determining the location of nucleotide sequences that flank the 5′ end and the 3′ end of at least one functional region of the locus; and (iii) transfecting a targeting construct containing the flanking sequence into a cell wherein, upon successful homologous recombination, at least one functional region of the immunoglobulin locus is disrupted thereby reducing or preventing the expression of the immunoglobulin gene. In one embodiment, the germline configuration of the porcine heavy chain locus is provided. The porcine heavy chain locus contains at least four variable regions, two diversity regions, six joining regions and five constant regions, for example, as illustrated in FIG. 1. In a specific embodiment, only one of the six joining regions, J6, is functional. In another embodiment, the germline configuration of the porcine kappa light chain locus is provided. The porcine kappa light chain locus contains at least six variable regions, six joining regions, one constant region and one enhancer region, for example, as illustrated in FIG. 2. In a further embodiment, the germline configuration of the porcine lambda light chain locus is provided. The porcine lambda light chain locus contains a variable region and the J/C region. See FIG. 3.

In a further aspect of the present invention, a method is provided to disrupt the expression of an ungulate lambda light chain locus by (i) analyzing the germline configuration of the ungulate lambda light chain genomic locus; (ii) determining the location of nucleotide sequences that flank the 5′ end of at least one functional region of the locus; (ii) constructing a 5′ targeting construct; (iv) determining the location of nucleotide sequences that flank the 3′ end of at least one functional region of the locus; (v) constructing a 3′ targeting construct; (vi) transfecting both the 5′ and the 3′ targeting constructs into a cell wherein, upon successful homologous recombination of each targeting construct, at least one functional region of the immunoglobulin locus is disrupted thereby reducing or preventing the expression of the immunoglobulin gene. See FIGS. 5 and 6.

In one embodiment, the germline configuration of the porcine lambda light chain locus is provided. The porcine lambda light chain locus contains a variable region and a J/C region. See FIG. 3.

In further aspects of the present invention provides ungulates and ungulate cells that lack at least one allele of a functional region of an ungulate heavy chain, kappa light chain and/or lambda light chain locus produced according to the processes, sequences and/or constructs described herein, which are further modified to express at least part of a human antibody (i.e. immunoglobulin (Ig)) locus. In additional embodiments, porcine animals are provided that express xenogenous immunoglobulin. This human locus can undergo rearrangement and express a diverse population of human antibody molecules in the ungulate. These cloned, transgenic ungulates provide a replenishable, theoretically infinite supply of human antibodies (such as polyclonal antibodies), which can be used for therapeutic, diagnostic, purification, and other clinically relevant purposes. In one particular embodiment, artificial chromosomes (ACs), such as yeast or mammalian artificial chromosomes (YACS or MACS) can be used to allow expression of human immunoglobulin genes into ungulate cells and animals. All or part of human immunoglobulin genes, such as the Ig heavy chain gene (human chromosome 414), Ig kappa chain gene (human chromosome #2) and/or the Ig lambda chain gene (chromosome #22) can be inserted into the artificial chromosomes, which can then be inserted into ungulate cells. In further embodiments, ungulates and ungulate cells are provided that contain either part or all of at least one human antibody gene locus, which undergoes rearrangement and expresses a diverse population of human antibody molecules.

In additional embodiments, methods of producing xenogenous antibodies are provided, wherein the method can include: (a) administering one or more antigens of interest to an ungulate whose cells comprise one or more artificial chromosomes and lack any expression of functional endogenous immunoglobulin, each artificial chromosome comprising one or more xenogenous immunoglobulin loci that undergo rearrangement, resulting in production of xenogenous antibodies against the one or more antigens; and/or (b) recovering the xenogenous antibodies from the ungulate. In one embodiment, the immunoglobulin loci can undergo rearrangement in a B cell.

In one aspect of the present invention, an ungulate, such as a pig or a cow, can be prepared by a method in accordance with any aspect of the present invention. These cloned, transgenic ungulates (e.g., porcine and bovine animals) provide a replenishable, theoretically infinite supply of human polyclonal antibodies, which can be used as therapeutics, diagnostics and for purification purposes. For example, transgenic animals produced according to the process, sequences and/or constructs described herein that produce polyclonal human antibodies in the bloodstream can be used to produce an array of different antibodies which are specific to a desired antigen. The availability of large quantities of polyclonal antibodies can also be used for treatment and prophylaxis of infectious disease, vaccination against biological warfare agents, modulation of the immune system, removal of undesired human cells such as cancer cells, and modulation of specific human molecules.

In other embodiments, animals or cells lacking expression of functional immunoglobulin, produced according to the process, sequences and/or constructs described herein, can contain additional genetic modifications to eliminate the expression of xenoantigens. Such animals can be modified to eliminate the expression of at least one allele of the alpha-1,3-galactosyltransferase gene, the CMP-Neu5Ac hydroxylase gene (see, for example, U.S. Ser. No. 10/863,116), the iGb3 synthase gene (see, for example, U.S. Patent Application 60/517,524), and/or the Forssman synthase gene (see, for example, U.S. Patent Application 60/568,922). In additional embodiments, the animals discloses herein can also contain genetic modifications to express fucosyltransferase and/or sialyltransferase. To achieve these additional genetic modifications, in one embodiment, cells can be modified to contain multiple genetic modifications. In other embodiments, animals can be bred together to achieve multiple genetic modifications. In one specific embodiment, animals, such as pigs, lacking expression of functional immunoglobulin, produced according to the process, sequences and/or constructs described herein, can be bred with animals, such as pigs, lacking expression of alpha-1,3-galactosyl transferase (for example, as described in WO 04/028243).

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 illustrates the design of a targeting vector that disrupts the expression of the joining region of the porcine heavy chain immunoglobulin gene.

FIG. 2 illustrates the design of a targeting vector that disrupts the expression of the constant region of the porcine kappa light chain immunoglobulin gene.

FIG. 3 illustrates the genomic organization of the porcine lambda immunoglobulin locus, including a concatamer of J-C sequences or units as well as flanking regions that include the variable region 5′ to the JC cluster region. Bacterial artificial chromosomes (BAC1 and BAC2) represent fragments of the porcine immunoglobulin genome that can be obtained from BAC libraries.

FIG. 4 represents the design of a targeting vector that disrupts the expression of the JC cluster region of the porcine lambda light chain immunoglobulin gene. “SM” stands for a selectable marker gene, which can be used in the targeting vector.

FIG. 5 illustrates a targeting strategy to insert a site specific recombinase target or recognition site into the region 5′ of the JC cluster region of the porcine lambda immunoglobulin locus. “SM” stands for a selectable marker gene, which can be used in the targeting vector. “SSRRS” stands for a specific recombinase target or recognition site.

FIG. 6 illustrates a targeting strategy to insert a site specific recombinase target or recognition site into the region 3′ of the JC cluster region of the porcine lambda immunoglobulin locus. “SM” stands for a selectable marker gene, which can be used in the targeting vector. “SSRRS” stands for a specific recombinase target or recognition site.

FIG. 7 illustrates the site specific recombinase mediated transfer of a YAC into a host genome. “SSRRS” stands for a specific recombinase target or recognition site.

DETAILED DESCRIPTION

The present invention provides for the first time ungulate immunoglobin germline gene sequence arrangement as well as novel genomic sequences thereof. In addition, novel ungulate cells, tissues and animals that lack at least one allele of a heavy or light chain immunoglobulin gene are provided. Based on this discovery, ungulates can be produced that completely lack at least one allele of a heavy and/or light chain immunoglobulin gene. In addition, these ungulates can be further modified to express xenoogenous, such as human, immunoglobulin loci or fragments thereof.

In one aspect of the present invention, a transgenic ungulate that lacks any expression of functional endogenous immunoglobulins is provided. In one embodiment, the ungulate can lack any expression of endogenous heavy and/or light chain immunoglobulins. The light chain immunoglobulin can be a kappa and/or lambda immunoglobulin. In additional embodiments, transgenic ungulates are provided that lack expression of at least one allele of an endogenous immunoglobulin wherein the immunoglobulin is selected from the group consisting of heavy chain, kappa light chain and lambda light chain or any combination thereof. In one embodiment, the expression of functional endogenous immunoglobulins can be accomplished by genetic targeting of the endogenous immunoglobulin loci to prevent expression of the endogenous immunoglobulin. In one embodiment, the genetic targeting can be accomplished via homologous recombination. In another embodiment, the transgenic ungulate can be produced via nuclear transfer.

In other embodiments, the transgenic ungulate that lacks any expression of functional endogenous immunoglobulins can be further genetically modified to express an xenogenous immunoglobulin loci. In an alternative embodiment, porcine animals are provided that contain an xenogeous immunoglobulin locus. In one embodiment, the xenogeous immunoglobulin loci can be a heavy and/or light chain immunoglobulin or fragment thereof. In another embodiment, the xenogenous immunoglobulin loci can be a kappa chain locus or fragment thereof and/or a lambda chain locus or fragment thereof. In still further embodiments, an artificial chromosome (AC) can contain the xenogenous immunoglobulin. In one embodiment, the AC can be a yeast AC or a mammalian AC. In a further embodiment, the xenogenous locus can be a human immunoglobulin locus or fragment thereof. In one embodiment, the human immunoglobulin locus can be human chromosome 14, human chromosome 2, and human chromosome 22 or fragments thereof. In another embodiment, the human immunoglobulin locus can include any fragment of a human immunoglobulin that can undergo rearrangement. In a further embodiment, the human immunoglobulin loci can include any fragment of a human immunoglobulin heavy chain and a human immunoglobulin light chain that can undergo rearrangement. In still further embodiment, the human immunoglobulin loci can include any human immunoglobulin locus or fragment thereof that can produce an antibody upon exposure to an antigen. In a particular embodiment, the exogenous human immunoglobulin can be expressed in B cells to produce xenogenous immunoglobulin in response to exposure to one or more antigens.

In another aspect of the present invention, transgenic ungulates are provided that expresses a xenogenous immunoglobulin loci or fragment thereof, wherein the immunoglobulin can be expressed from an immunoglobulin locus that is integrated within an endogenous ungulate chromosome. In one embodiment, ungulate cells derived from the transgenic animals are provided. In one embodiment, the xenogenous immunoglobulin locus can be inherited by offspring. In another embodiment, the xenogenous immunoglobulin locus can be inherited through the male germ line by offspring. In still further embodiments, an artificial chromosome (AC) can contain the xenogenous immunoglobulin. In one embodiment, the AC can be a yeast AC or a mammalian AC. In a further embodiment, the xenogenous locus can be a human immunoglobulin locus or fragment thereof. In one embodiment, the human immunoglobulin locus can be human chromosome 14, human chromosome 2, and human chromosome 22 or fragments thereof. In another embodiment, the human immunoglobulin locus can include any fragment of a human immunoglobulin that can undergo rearrangement. In a further embodiment, the human immunoglobulin loci can include any fragment of a human immunoglobulin heavy chain and a human immunoglobulin light chain that can undergo rearrangement. In still further embodiment, the human immunoglobulin loci can include any human immunoglobulin locus or fragment thereof that can produce an antibody upon exposure to an antigen. In a particular embodiment, the exogenous human immunoglobulin can be expressed in B cells to produce xenogenous immunoglobulin in response to exposure to one or more antigens.

Definitions

The terms “recombinant DNA technology,” “DNA cloning,” “molecular cloning,” or “gene cloning” refer to the process of transferring a DNA sequence into a cell or organism. The transfer of a DNA fragment can be from one organism to a self-replicating genetic element (e.g., bacterial plasmid) that permits a copy of any specific part of a DNA (or RNA) sequence to be selected among many others and produced in an unlimited amount. Plasmids and other types of cloning vectors such as artificial chromosomes can be used to copy genes and other pieces of chromosomes to generate enough identical material for further study. In addition to bacterial plasmids, which can carry up to 20 kb of foreign DNA, other cloning vectors include viruses, cosmids, and artificial chromosomes (e.g., bacteria artificial chromosomes (BACs) or yeast artificial chromosomes (YACs)). When the fragment of chromosomal DNA is ultimately joined with its cloning vector in the lab, it is called a “recombinant DNA molecule.” Shortly after the recombinant plasmid is introduced into suitable host cells, the newly inserted segment will be reproduced along with the host cell DNA.

“Cosmids” are artificially constructed cloning vectors that carry up to 45 kb of foreign DNA. They can be packaged in lambda phage particles for infection into E. coli cells.

As used herein, the term “mammal” (as in “genetically modified (or altered) mammal”) is meant to include any non-human mammal, including but not limited to pigs, sheep, goats, cattle (bovine), deer, mules, horses, monkeys, dogs, cats, rats, mice, birds, chickens, reptiles, fish, and insects. In one embodiment of the invention, genetically altered pigs and methods of production thereof are provided.

The term “ungulate” refers to hoofed mammals. Artiodactyls are even-toed (cloven-hooved) ungulates, including antelopes, camels, cows, deer, goats, pigs, and sheep. Perissodactyls are odd toes ungulates, which include horses, zebras, rhinoceroses, and tapirs. The term ungulate as used herein refers to an adult, embryonic or fetal ungulate animal.

As used herein, the terms “porcine”, “porcine animal”, “pig” and “swine” are generic terms referring to the same type of animal without regard to gender, size, or breed.

A “homologous DNA sequence or homologous DNA” is a DNA sequence that is at least about 80%, 85%, 90%, 95%, 98% or 99% identical with a reference DNA sequence. A homologous sequence hybridizes under stringent conditions to the target sequence, stringent hybridization conditions include those that will allow hybridization occur if there is at least 85, at least 95% or 98% identity between the sequences.

An “isogenic or substantially isogenic DNA sequence” is a DNA sequence that is identical to or nearly identical to a reference DNA sequence. The term “substantially isogenic” refers to DNA that is at least about 97-99% identical with the reference DNA sequence, or at least about 99.5-99.9% identical with the reference DNA sequence, and in certain uses 100% identical with the reference DNA sequence.

“Homologous recombination” refers to the process of DNA recombination based on sequence homology.

“Gene targeting” refers to homologous recombination between two DNA sequences, one of which is located on a chromosome and the other of which is not.

“Non-homologous or random integration” refers to any process by which DNA is integrated into the genome that does not involve homologous recombination.

A “selectable marker gene” is a gene, the expression of which allows cells containing the gene to be identified. A selectable marker can be one that allows a cell to proliferate on a medium that prevents or slows the growth of cells without the gene. Examples include antibiotic resistance genes and genes which allow an organism to grow on a selected metabolite. Alternatively, the gene can facilitate visual screening of transformants by conferring on cells a phenotype that is easily identified. Such an identifiable phenotype can be, for example, the production of luminescence or the production of a colored compound, or the production of a detectable change in the medium surrounding the cell.

The term “contiguous” is used herein in its standard meaning, i.e., without interruption, or uninterrupted.

“Stringent conditions” refers to conditions that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% SDS at 50° C., or (2) employ during hybridization a denaturing agent such as, for example, formamide. One skilled in the art can determine and vary the stringency conditions appropriately to obtain a clear and detectable hybridization signal. For example, stringency can generally be reduced by increasing the salt content present during hybridization and washing, reducing the temperature, or a combination thereof. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, N.Y., (1989).

I. Immunoglobulin Genes

In one aspect of the present invention, a transgenic ungulate that lacks any expression of functional endogenous immunoglobulins is provided. In one embodiment, the ungulate can lack any expression of endogenous heavy and/or light chain immunoglobulins. The light chain immunoglobulin can be a kappa and/or lambda immunoglobulin. In additional embodiments, transgenic ungulates are provided that lack expression of at least one allele of an endogenous immunoglobulin wherein the immunoglobulin is selected from the group consisting of heavy chain, kappa light chain and lambda light chain or any combination thereof. In one embodiment, the expression of functional endogenous immunoglobulins can be accomplished by genetic targeting of the endogenous immunoglobulin loci to prevent expression of the endogenous immunoglobulin. In one embodiment, the genetic targeting can be accomplished via homologous recombination. In another embodiment, the transgenic ungulate can be produced via nuclear transfer.

In another aspect of the present invention, a method is provided to disrupt the expression of an ungulate immunoglobulin gene by (i) analyzing the germline configuration of the ungulate heavy chain, kappa light chain or lambda light chain genomic locus; (ii) determining the location of nucleotide sequences that flank the 5′ end and the 3′ end of at least one functional region of the locus; and (iii) transfecting a targeting construct containing the flanking sequence into a cell wherein, upon successful homologous recombination, at least one functional region of the immunoglobulin locus is disrupted thereby reducing or preventing the expression of the immunoglobulin gene.

In one embodiment, the germline configuration of the porcine heavy chain locus is provided. The porcine heavy chain locus contains at least four variable regions, two diversity regions, six joining regions and five constant regions, for example, as illustrated in FIG. 1. In a specific embodiment, only one of the six joining regions, J6, is functional.

In another embodiment, the germline configuration of the porcine kappa light chain locus is provided. The porcine kappa light chain locus contains at least six variable regions, six joining regions, one constant region and one enhancer region, for example, as illustrated in FIG. 2.

In a further embodiment, the germline configuration of the porcine lambda light chain locus is provided.

Isolated nucleotide sequences as depicted in Seq ID Nos 1-39 are provided. Nucleic acid sequences at least 80, 85, 90, 95, 98 or 99% homologous to any one of Seq ID Nos 1-39 are also provided. In addition, nucleotide sequences that contain at least 10, 15, 17, 20, 25 or 30 contiguous nucleotides of any one of Seq ID Nos 1-39 are provided. Further provided are nucleotide sequences that hybridize, optionally under stringent conditions, to Seq ID Nos 1-39, as well as, nucleotides homologous thereto.

Homology or identity at the nucleotide or amino acid sequence level can be determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (see, for example, Altschul, S. F. et al (1997) Nucleic Acids Res 25:3389-3402 and Karlin et al, (1900) Proc. Natl. Acad. Sci. USA 87, 2264-2268) which are tailored for sequence similarity searching. The approach used by the BLAST program is to first consider similar segments, with and without gaps, between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance. See, for example, Altschul et al., (1994) (Nature Genetics 6, 119-129). The search parameters for histogram, descriptions, alignments, expect (i.e., the statistical significance threshold for reporting matches against database sequences), cutoff, matrix and filter (low co M'plexity) are at the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff et al., (1992) Proc. Natl. Acad. Sci. USA 89, 10915-10919), which is recommended for query sequences over 85 in length (nucleotide bases or amino acids).

Porcine Heavy Chain

In another aspect of the present invention, novel genomic sequences encoding the heavy chain locus of ungulate immunoglobulin are provided. In one embodiment, an isolated nucleotide sequence encoding porcine heavy chain is provided that includes at least one variable region, two diversity regions, at least four joining regions and at least one constant region, such as the mu constant region, for example, as represented in Seq ID No. 29. In another embodiment, an isolated nucleotide sequence is provided that includes at least four joining regions and at least one constant region, such as the mu constant region, of the porcine heavy chain genomic sequence, for example, as represented in Seq ID No. 4. In a further embodiment, nucleotide sequence is provided that includes 5′ flanking sequence to the first joining region of the porcine heavy chain genomic sequence, for example, as represented in Seq ID No 1. Still further, nucleotide sequence is provided that includes 3′ flanking sequence to the first joining region of the porcine heavy chain genomic sequence, for example, as represented in the 3′ region of Seq ID No 4. In further embodiments, isolated nucleotide sequences as depicted in Seq ID Nos 1, 4 or 29 are provided. Nucleic acid sequences at least 80, 85, 90, 95, 98 or 99% homologous to Seq ID Nos 1, 4 or 29 are also provided. Further provided are nucleotide sequences that hybridize, optionally under stringent conditions, to Seq ID Nos 1, 4 or 29, as well as, nucleotides homologous thereto.

In addition, nucleotide sequences that contain at least 10, 15, 17, 20, 25 or 30 contiguous nucleotides of Seq ID Nos 1, 4 or 29 are provided. In one embodiment, the nucleotide sequence contains at least 17, 20, 25 or 30 contiguous nucleotides of Seq ID No 4 or residues 1-9,070 of Seq ID No 29. In other embodiments, nucleotide sequences that contain at least 50, 100, 1,000, 2,500, 4,000, 4,500, 5,000, 7,000, 8,000, 8,500, 9,000, 10,000 or 15,000 contiguous nucleotides of Seq ID No. 29 are provided. In another embodiment, the nucleotide sequence contains residues 9,070-11039 of Seq ID No 29.

In further embodiments, isolated nucleotide sequences as depicted in Seq ID Nos 1, 4 or 29 are provided. Nucleic acid sequences at least 80, 85, 90, 95, 98 or 99% homologous to Seq ID Nos 1, 4 or 29 are also provided. In addition, nucleotide sequences that contain at least 10, 15, 17, 20, 25 or 30 contiguous nucleotides of Seq ID Nos 1, 4 or 29 are provided. Further provided are nucleotide sequences that hybridize, optionally under stringent conditions, to Seq ID Nos 1, 4 or 29, as well as, nucleotides homologous thereto.

In one embodiment, an isolated nucleotide sequence encoding porcine heavy chain is provided that includes at least one variable region, two diversity regions, at least four joining regions and at least one constant region, such as the mu constant region, for example, as represented in Seq ID No. 29. In Seq ID No. 29, the Diversity region of heavy chain is represented, for example, by residues 1089-1099 (D(pseudo)), the Joining region of heavy chain is represented, for example, by residues 1887-3352 (for example: J(psuedo): 1887-1931, J(psuedo): 2364-2411, J(psuedo): 2756-2804, J (functional J): 3296-3352), the recombination signals are represented, for example, by residues 3001-3261 (Nonamer), 3292-3298 (Heptamer), the Constant Region is represented by the following residues: 3353-9070 (J to C mu intron), 5522-8700 (Switch region), 9071-9388 (Mu Exon 1), 9389-9469 (Mu Intron A), 9470-9802 (Mu Exon 2), 9830-10069 (Mu Intron B), 10070-10387 (Mu Exon 3), 10388-10517 (Mu Intron C), 10815-11052 (Mu Exon 4), 11034-11039 (Poly(A) signal).

Seq ID No. 29

tctagaagacgctggagagaggccagacttcctcgga

acagctcaaagagctctgtcaaagccagatcccatca

cacgtgggcaccaataggccatgccagcctccaaggg

ccgaactgggttctccacggcgcacatgaagcctgca

gcctggcttatcctcttccgtggtgaagaggcaggcc

cgggactggacgaggggctagcagggtgtggtaggca

ccttgcgccccccaccccggcaggaaccagagaccct

ggggctgagagtgagcctccaaacaggatgccccacc

cttcaggccacctttcaatccagctacactccacctg

ccattctcctctgggcacagggcccagcccctggatc

ttggccttggctcgacttgcacccacgcgcacacaca

cacttcctaacgtgctgtccgctcacccctccccagc

gtggtccatgggcagcacggcagtgcgcgtccggcgg

tagtgagtgcagaggtcccttcccctcccccaggagc

cccaggggtgtgtgcagatctgggggctcctgtccct

tacaccttcatgcccctcccctcatacccaccctcca

ggcgggaggcagcgagacctttgcccagggactcagc

caacgggcacacgggaggccagccctcagcagctggc

tcccaaagaggaggtgggaggtaggtccacagctgcc

acagagagaaaccctgacggaccccacaggggccacg

ccagccggaaccagctccctcgtgggtgagcaatggc

cagggccccgccggccaccacggctggccttgcgcca

gctgagaactcacgtccagtgcagggagactcaagac

agcctgtgcacacagcctcggatctgctcccatttca

agcagaaaaaggaaaccgtgcaggcagccctcagcat

ttcaaggattgtagcagcggccaactattcgtcggca

gtggccgattagaatgaccgtggagaagggcggaagg

gtctctcgtgggctctgcggccaacaggccctggctc

cacctgcccgctgccagcccgaggggcttgggccgag

ccaggaaccacagtgctcaccgggaccacagtgactg

accaaactcccggccagagcagccccaggccagccgg

gctctcgccctggaggactcaccatcagatgcacaag

ggggcgagtgtggaagagacgtgtcgcccgggccatt

tgggaaggcgaagggaccttccaggtggacaggaggt

gggacgcactccaggcaagggactgggtccccaaggc

ctggggaaggggtactggcttgggggttagcctggcc

agggaacggggagcggggcggggggctgagcagggag

gacctgacctcgtgggagcgaggcaagtcaggcttca

ggcagcagccgcacatcccagaccaggaggctgaggc

aggaggggcttgcagcggggcgggggcctgcctggct

ccgggggctcctgggggacgctggctcttgtttccgt

gtcccgcagcacagggccagctcgctgggcctatgct

taccttgatgtctggggccggggcgtcagggtcgtcg

tctcctcaggggagagtcccctgaggctacgctgggg

*ggggactatggcagctccaccaggggcctggggacc

aggggcctggaccaggctgcagcccggaggacgggca

gggctctggctctccagcatctggccctcggaaatgg

cagaacccctggcgggtgagcgagctgagagcgggtc

agacagacaggggccggccggaaaggagaagttgggg

gcagagcccgccaggggccaggcccaaggttctgtgt

gccagggcctgggtgggcacattggtgtggccatggc

tacttagattcgtggggccagggcatcctggtcaccg

tctcctcaggtgagcctggtgtctgatgtccagctag

gcgctggtgggccgcgggtgggcctgtctcaggctag

ggcaggggctgggatgtgtatttgtcaaggaggggca

acagggtgcagactgtgcccctggaaacttgaccact

ggggcaggggcgtcctggtcacgtctcctcaggtaag

acggccctgtgcccctctctcgcgggactggaaaagg

aattttccaagattccttggtctgtgtggggccctct

ggggcccccgggggtggctcccctcctgcccagatgg

ggcctcggcctgtggagcacgggctgggcacacagct

cgagtctagggccacagaggcccgggctcagggctct

gtgtggcccggcgactggcagggggctcgggtttttg

gacaccccctaatgggggccacagcactgtgaccatc

ttcacagctggggccgaggagtcgaggtcaccgtctc

ctcaggtgagtcctcgtcagccctctctcactctctg

gggggttttgctgcattttgtgggggaaagaggatgc

ctgggtctcaggtctaaaggtctagggccagcgccgg

ggcccaggaaggggccgaggggccaggctcggctcgg

ccaggagcagagcttccagacatctcgcctcctggcg

gctgcagtcaggcctttggccgggggggtctcagcac

caccaggcctcttggctcccgaggtccccggccccgg

ctgcctcaccaggcaccgtgcgcggtgggcccgggct

cttggtcggccaccctttcttaactgggatccgggct

tagttgtcgcaatgtgacaacgggctcgaaagctggg

gccaggggaccctagtctacgacgcctcgggtgggtg

tcccgcacccctccccactttcacggcactcggcgag

acctggggagtcaggtgttggggacactttggaggtc

aggaacgggagctggggagagggctctgtcagcgggg

tccagagatgggccgccctccaaggacgccctgcgcg

gggacaagggcttcttggcctggcctggccgcttcac

ttgggcgtcagggggggcttcccggggcaggcggtca

gtcgaggcgggttggaattctgagtctgggttcgggg

ttcggggttcggccttcatgaacagacagcccaggcg

ggccgttgtttggcccctgggggcctggttggaatgc

gaggtctcgggaagtcaggagggagcctggccagcag

agggttcccagccctgcggccgagggacctggagacg

ggcagggcattggccgtcgcagggccaggccacaccc

cccaGGTTTTTGTggggcgagcctggagattgcacCA

CTGTGATTACTATGCTATGGATCTCTGGGGCCCAGGC

GTTGAAGTCGTCGTGTCCTCAGgtaagaacggccctc

cagggcctttaatttctgctctcgtctgtgggctttt

ctgactctgatcctcgggaggcgtctgtgcccccccc

ggggatgaggccggcttgccaggaggggtcagggacc

aggagcctgtgggaagttctgacgggggctgcaggcg

ggaagggccccaccggggggcgagccccaggccgctg

ggcggcaggagacccgtgagagtgcgccttgaggagg

gtgtctgcggaaccacgaacgcccgccgggaagggct

tgctgcaatgcggtcttcagacgggaggcgtcttctg

ccctcaccgtctttcaagcccttgtgggtctgaaaga

gccatgtcggagagagaagggacaggcctgtcccgac

ctggccgagagcgggcagccccgggggagagcggggc

gatcggcctgggctctgtgaggccaggtccaagggag

gacgtgtggtcctcgtgacaggtgcacttgcgaaacc

ttagaagacggggtatgttggaagcggctcctgatgt

ttaagaaaagggagactgtaaagtgagcagagtcctc

aagtgtgttaaggttttaaaggtcaaagtgttttaaa

cctttgtgactgcagttagcaagcgtgcggggagtga

atggggtgccagggtggccgagaggcagtacgagggc

cgtgccgtcctctaattcagggcttagttttgcagaa

taaagtcggcctgttttctaaaagcattggtggtgct

gagctggtggaggaggccgcgggcagccctggccacc

tgcagcaggtggcaggaagcaggtcggccaagaggct

attttaggaagccagaaaacacggtcgatgaatttat

agcttctggtttccaggaggtggttgggcatggcttt

gcgcagcgccacagaaccgaaagtgcccactgagaaa

aaacaactcctgcttaatttgcatttttctaaaagaa

gaaacagaggctgacggaaactggaaagttcctgttt

taactactcgaattgagttttcggtcttagcttatca

actgctcacttagattcattttcaaagtaaacgttta

agagccgaggcattcctatcctcttctaaggcgttat

tcctggaggctcattcaccgccagcacctccgctgcc

tgcaggcattgctgtcaccgtcaccgtgacggcgcgc

acgattttcagttggcccgcttcccctcgtgattagg

acagacgcgggcactctggcccagccgtcttggctca

gtatctgcaggcgtccgtctcgggacggagctcaggg

gaagagcgtgactccagttgaacgtgatagtcggtgc

gttgagaggagacccagtcgggtgtcgagtcagaagg

ggcccggggcccgaggccctgggcaggacggcccgtg

ccctgcatcacgggcccagcgtcctagaggcaggact

ctggtggagagtgtgagggtgcctggggcccctccgg

agctggggccgtgcggtgcaggttgggctctcggcgc

ggtgttggctgtttctgcgggatttggaggaattctt

ccagtgatgggagtcgccagtgaccgggcaccaggct

ggtaagagggaggccgccgtcgtggccagagcagctg

ggagggttcggtaaaaggctcgcccgtttcctttaat

gaggacttttcctggagggcatttagtctagtcggga

ccgttttcgactcgggaagagggatgcggaggagggc

atgtgcccaggagccgaaggcgccgcggggagaagcc

cagggctctcctgtccccacagaggcgacgccactgc

cgcagacagacagggcctttccctctgatgacggcaa

aggcgcctcggctcttgcggggtgctgggggggagtc

gccccgaagccgctcacccagaggcctgaggggtgag

actgaccgatgcctcttggccgggcctggggccggac

cgagggggactccgtggaggcagggcgatggtggctg

cgggagggaaccgaccctgggccgagcccggcttggc

gattcccgggcgagggccctcagccgaggcgagtggg

tccggcggaaccaccctttctggccagcgccacaggg

ctctcgggactgtccggggcgacgctgggctgcccgt

ggcaggccTGGGCTGACCTGGACTTCACGAGACAGAA

CAGGGCTTTCAGGGCTGAGCTGAGCCAGGTTTAGCGA

GGCCAAGTGGGGCTGAACCAGGCTCAACTGGCCTGAG

CTGGGTTGAGCTGGGCTGACCTGGGCTGAGCTGAGCT

GGGCTGGGCTGGGCTGGGCTGGGCTGGGCTGGGCTGG

ACTGGCTGAGCTGAGCTGGGTTGAGCTGAGCTGAGCT

GGCCTGGGTTGAGCTGGGCTGGGTTGAGCTGAGCTGG

GTTGAGCTGGGTTGAGCTGGGTTGATCTGAGCTGAGC

TGGGCTGAGCTGAGCTAGGCTGGGGTGAGCTGGGCTG

AGCTGGTTTGAGTTGGGTTGAGCTGAGCTGAGCTGGG

CTGTGCTGGCTGAGCTAGGCTGAGCTAGGCTAGGTTG

AGCTGGGCTGGGCTGAGCTGAGCTAGGCTGGGCTGAT

TTGGGCTGAGCTGAGCTGAGCTAGGCTGCGTTGAGCT

GGCTGGGCTGGATTGAGCTGGCTGAGCTGGCTGAGCT

GGGCTGAGCTGGCCTGGGTTGAGCTGAGCTGGACTGG

TTTGAGCTGGGTCGATCTGGGTTGAGCTGTCCTGGGT

TGAGCTGGGCTGGGTTGAGCTGAGCTGGGTTGAGCTG

GGCTCAGCAGAGCTGGGTTGGGCTGAGCTGGGTTGAG

CTGAGCTGGGCTGAGCTGGCCTGGGTTGAGCTGGGCT

GAGCTGAGCTGGGCTGAGCTGGCCTGTGTTGAGCTGG

GCTGGGTTGAGCTGGGCTGAGCTGGATTGAGCTGGGT

TGAGCTGAGCTGGGCTGGGCTGTGCTGACTGAGCTGG

GCTGAGCTAGGCTGGGGTGAGCTGGGCTGAGCTGATC

CGAGCTAGGCTGGGCTGGTTTGGGCTGAGCTGAGCTG

AGCTAGGCTGGATTGATCTGGCTGAGCTGGGTTGAGC

TGAGCTGGGCTGAGCTGGTCTGAGCTGGCCTGGGTCG

AGCTGAGCTGGACTGGTTTGAGCTGGGTCGATCTGGG

CTGAGCTGGCCTGGGTTGAGCTGGGCTGGGTTGAGCT

GAGCTGGGTTGAGCTGGGCTGAGCTGAGGGCTGGGGT

GAGCTGGGCTGAACTAGCCTAGCTAGGTTGGGCTGAG

CTGGGCTGGTTTGGGCTGAGCTGAGCTGAGCTAGGCT

GCATTGAGCAGGCTGAGCTGGGCTGAGCAGGCCTGGG

GTGAGCTGGGCTAGGTGGAGCTGAGCTGGGTCGAGCT

GAGTTGGGCTGAGCTGGCCTGGGTTGAGGTAGGCTGA

GCTGAGCTGAGCTAGGCTGGGTTGAGCTGGCTGGGCT

GGTTTGCGCTGGGTCAAGCTGGGCCGAGCTGGCCTGG

GTTGAGCTGGGCTCGGTTGAGCTGGGCTGAGCTGAGC

CGACCTAGGCTGGGATGAGCTGGGCTGATTTGGGCTG

AGCTGAGCTGAGCTAGGCTGCATTGAGCAGGCTGAGC

TGGGCCTGGAGCCTGGCCTGGGGTGAGCTGGGCTGAG

CTGCGCTGAGCTAGGCTGGGTTGAGCTGGCTGGGCTG

GTTTGCGCTGGGTCAAGCTGGGCCGAGCTGGCCTGGG

ATGAGCTGGGCCGGTTTGGGCTGAGCTGAGCTGAGCT

AGGCTGCATTGAGCAGGCTGAGCTGGGCTGAGCTGGC

CTGGGGTGAGCTGGGCTGAGCTAAGCTGAGCTGGGCT

GGTTTGGGCTGAGCTGGCTGAGCTGGGTCCTGCTGAG

CTGGGCTGAGCTGACCAGGGGTGAGCTGGGCTGAGTT

AGGCTGGGCTCAGCTAGGCTGGGTTGATCTGGCAGGG

CTGGTTTGCGCTGGGTCAAGCTCCCGGGAGATGGCCT

GGGATGAGCTGGGCTGGTTTGGGCTGAGCTGAGCTGA

GCTGAGCTAGGCTGCATTGAGCAGGCTGAGCTGGGCT

GAGCTGGCCTGGGGTGAGCTGGGCTGGGTGGAGCTGA

GCTGGGCTGAACTGGGCTAAGCTGGCTGAGCTGGATC

GAGCTGAGCTGGGCTGAGCTGGCCTGGGGTTAGCTGG

GCTGAGCTGAGCTGAGCTAGGCTGGGTTGAGCTGGCT

GGGCTGGTTTGCGCTGGGTCAAGCTGGGCCGAGCTGG

CCTGGGTTGAGCTGGGCTGGGCTGAGCTGAGCTAGGC

TGGGTTGAGCTGGGCTGGGCTGAGCTGAGCTAGGCTG

CATTGAGCTGGCTGGGATGGATTGAGCTGGCTGAGCT

GGCTGAGCTGGCTGAGCTGGGCTGAGCTGGCCTGGGT

TGAGCTGGGCTGGGTTGAGCTGAGCTGGGCTGAGCTG

GGCTCAGCAGAGCTGGGTTGAGCTGAGCTGGGTTGAG

CTGGGGTGAGCTGGGCTGAGCAGAGCTGGGTTGAGCT

GAGCTGGGTTGAGCTGGGCTCGAGCAGAGCTGGGTTG

AGCTGAGCTGGGTTGAGCTGGGCTCAGCAGAGCTGGG

TTGAGCTGAGCTGGGTTGAGCTGGGCTGAGCTAGCTG

GGCTCAGCTAGGCTGGGTTGAGCTGAGCTGGGCTGAA

CTGGGCTGAGCTGGGCTGAACTGGGCTGAGCTGGGCT

GAGCTGGGCTGAGCAGAGCTGGGCTGAGCAGAGCTGG

GTTGGTCTGAGCTGGGTTGAGCTGGGCTGAGCTGGGC

TGAGCAGAGTTGGGTTGAGCTGAGCTGGGTTCAGCTG

GGCTGAGCTAGGCTGGGTTGAGCTGGGTTGAGTTGGG

CTGAGCTGGGCTGGGTTGAGCGGAGCTGGGCTGAACT

GGGCTGAGCTGGGCTGAGCGGAACTGGGTTGATCTGA

ATTGAGCTGGGCTGAGCCGGGCTGAGCCGGGCTGAGC

TGGGCTAGGTTGAGCTTGGGTGAGCTTGCCTCAGCTG

GTCTGAGCTAGGTTGGGTGGAGCTAGGCTGGATTGAG

CTGGGCTGAGCTGAGCTGATCTGGCCTCAGCTGGGCT

GAGGTAGGCTGAACTGGGCTGTGCTGGGCTGAGCTGA

GCTGAGCCAGTTTGAGCTGGGTTGAGCTGGGCTGAGC

TGGGCTGTGTTGATCTTTCCTGAACTGGGCTGAGCTG

GGCTGAGCTGGCCTAGCTGGATTGAACGGGGGTAAGC

TGGGCCAGGCTGGACTGGGCTGAGCTGAGCTAGGCTG

AGCTGAGTTGAATTGGGTTAAGCTGGGCTGAGATGGG

CTGAGCTGGGCTGAGCTGGGTTGAGCCAGGTCGGACT

GGGTTACCCTGGGCCACACTGGGCTGAGCTGGGCGGA

GCTCGattaacctggtcaggctgagtcgggtccagca

gacatgcgctggccaggctggcttgacctggacacgt

tcgatgagctgccttgggatggttcacctcagctgag

ccaggtggctccagctgggctgagctggtgaccctgg

gtgacctcggtgaccaggttgtcctgagtccgggcca

agccgaggctgcatcagactcgccagacccaaggcct

gggccccggctggcaagccaggggcggtgaaggctgg

gctggcaggactgtcccggaaggaggtgcacgtggag

ccgcccggaccccgaccggcaggacctggaaagacgc

ctctcactcccctttctcttctgtcccctctcgggtc

ctcagAGAGCCAGTCTGCCCCGAATCTCTACCCCCTC

GTCTCCTGCGTCAGCCCCCCGTCCGATGAGAGCCTGG

TGGCCCTGGGCTGCCTGGCCCGGGACTTCCTGCCCAG

CTCCGTCACCTTCTCCTGGAACTACAAGAACAGCAGC

AAGGTCAGCAGCCAGAACATCCAGGACTTCCCGTCCG

TCCTGAGAGGCGGCAAGTACTTGGCCTCCTCCCGGGT

GCTCCTACCCTCTGTGAGCATCCCCCAGGACCCAGAG

GCCTTCCTGGTGTGCGAGGTCCAGCACCCCAGTGGCA

CCAAGTCCGTGTCCATCTCTGGGCCAGgtgagctggg

ctccccctgtggctgtggcgggggcggggccgggtgc

cgccggcacagtgacgccccgttcctgcctgcagTCG

TAGAGGAGCAGCCCCCCGTCTTGAACATCTTCGTCCC

CACCCGGGAGTCCTTCTCCAGTACTCCCCAGCGCACG

TCCAAGCTCATCTGCCAGGCCTCAGACTTCAGCCCCA

AGCAGATCTCCATGGCCTGGTTCCGTGATGGGAAACG

GGTGGTGTCTGGCGTCAGCACAGGCCCCGTGGAGACC

CTACAGTCCAGTCCGGTGACCTACAGGCTCCACAGCA

TGCTGACCGTCACGGAGTCCGAGTGGCTCAGCCAGAG

CGTCTTCACCTGCCAGGTGGAGCACAAAGGGCTGAAC

TACGAGAAGAACGCGTCCTCTCTGTGCACCTCCAgtg

agtgcagcccctcgggccgggcggcggggcggcggga

gccacacacacaccagctgctccctgagccttggctt

ccgggagtggccaaggcggggaggggctgtgcagggc

agctggagggcactgtcagctggggcccagcaccccc

tcaccccggcagggcccgggctccgaggggccccgca

gtcgcaggccctgctcttgggggaagccctacttggc

cccttcagggcgctgacgctccccccacccacccccg

cctagATCCCAACTCTCCCATCACCGTCTTCGCCATC

GCCCCCTCCTTCGCTGGCATCTTCCTCACCAAGTCGG

CCAAGCTTTCCTGCGTGGTCACGGGCCTCGTCACCAG

GGAGAGCCTCAACATCTCCTGGACCCGCCAGGACGGC

GAGGTTCTGAAGACCAGTATCGTCTTCTCTGAGATCT

ACGCCAACGGCACCTTCGGCGCCAGGGGCGAAGCCTC

CGTCTGCGTGGAGGACTGGGAGTCGGGCGACAGGTTC

ACGTGCACGGTGACCCACACGGACCTGCCCTCGCCGC

TGAAGCAGAGCGTCTCCAAGCCCAGAGgtaggccctg

ccctgcccctgcctccgcccggcctgtgccttggccg

ccggggcgggagccgagcctggccgaggagcgccctc

ggccccccgcggtcccgacccacacccctcctgctct

cctccccagGGATCGCCAGGCACATGCCGTCCGTGTA

CGTGCTGCCGCCGGCCCCGGAGGAGCTGAGCCTGCAG

GAGTGGGCCTCGGTCACCTGCCTGGTGAAGGGCTTCT

CCCCGGCGGACGTGTTCGTGCAGTGGCTGCAGAAGGG

GGAGCCCGTGTCCGCCGACAAGTACGTGACCAGCGCG

CCGGTGCCCGAGCCCGAGCCCAAGGCCCCCGCCTCCT

ACTTCGTGCAGAGCGTCCTGACGGTGAGCGCCAAGGA

CTGGAGCGACGGGGAGACCTACACCTGCGTCGTGGGC

CACGAGGCCCTGCCCCACACGGTGACCGAGAGGACCG

TGGACAAGTCCACCGGTAAACCCACCCTGTACAACGT

CTCCCTGGTCCTGTCCGACACGGCCAGCACCTGCTAC

TGACCCCCTGGCTGCCCGCCGCGGCCGGGGCCAGAGC

CCCCGGGCGACCATCGCTCTGTGTGGGCCTGTGTGCA

ACCCGACCCTGTCGGGGTGAGCGGTCGCATTTCTGAA

AATTAGAaataaaAGATCTCGTGCCG

Seq ID No. 1

TCTAgAAGACGCTGGAGAGAGGCCagACTTCCTCGGA

ACAGCTCAAAGAGCTCTGTCAAAGCCAGATCCCATCA

CACGTGGGCACCAATAGGCCATGCCAGCCTCCAAGGG

CCGAACTGGGTTCTCCACGGCGCACATGAAGCCTGCA

GCCTGGCTTATCCTCTTCCGTGGTGAAGAGGCAGGCC

CGGGACTGGACGAGGGGCTAGCAGGGTGTGGTAGGCA

CCTTGCGCCCCCCACCCCGGCAGGAACCAGAGACCCT

GGGGCTGAGAGTGAGCCTCCAAACAGGATGCCCCACC

CTTCAGGCCACCTTTCAATCCAGCTACACTCCACCTG

CCATTCTCCTCTGGGCACAGGGCCCAGCCCCTGGATC

TTGGCCTTGGCTCGACTTGCACCGACGCGCACACACA

CACTTCCTAACGTGCTGTCCGCTCACCCCTCCCCAGC

GTGGTCCATGGGCAGCACGGCAGTGCGCGTCCGGCGG

TAGTGAGTGCAGAGGTCCCTTCCCCTCCCCCAGGAGC

CCCAGGGGTGTGTGCAGATCTGGGGGCTCCTGTCCCT

TACACCTTCATGCCCCTCCCCTCATACCCACCCTCCA

GGCGGGAGGCAGCGAGACCTTTGCCCAGGGACTCAGC

CAACGGGCACACGGGAGGCCA GCCCTCAGCAGCTGG

G

Seq ID No. 4

GGCCAGACTTCCTCGGAACAGCTCAAAGAGCTCTGTC

AAAGCCAGATCCCATCACACGTGGGCACCAATAGGCC

ATGCCAGCCTCCAAGGGCCGAACTGGGTTCTCCACGG

CGCACATGAAGCCTGCAGCCTGGCTTATCCTCTTCCG

TGGTGAAGAGGCAGGCCCGGGACTGGACGAGGGGCTA

GCAGGGTGTGGTAGGCACCTTGCGCCCCCCACCCCGG

CAGGAACCAGAGACCCTGGGGCTGAGAGTGAGCCTCC

AAACAGGATGCCCCACCCTTCAGGCCACCTTTCAATC

CAGCTACACTCCACCTGCCATTCTCCTCTGGGCACAG

GGCCCAGCCCCTGGATCTTGGCCTTGGCTCGACTTGC

ACCCACGCGCACACACACACTTCGTAACGTGCTGTCC

GCTCACCCCTCCCCAGCGTGGTCCATGGGCAGCACGG

CAGTGCGCGTCCGGCGGTAGTGAGTGCAGAGGTCCCT

TCCCCTCCCCCAGGAGCCCCAGGGGTGTGTGCAGATC

TGGGGGCTCCTGTCCCTTACACCTTCATGCCCCTCCC

CTCATACCCACCCTCCAGGCGGGAGGCAGCGAGACCT

TTGCCCAGGGACTCAGCCAACGGGCACACGGGAGGCC

AGCCCTCAGCAGCTGGCTCCCAAAGAGGAGGTGGGAG

GTAGGTCCACAGCTGCCACAGAGAGAAACCCTGACGG

ACCCCACAGGGGCCACGCCAGCCGGAACCAGCTCCCT

CGTGGGTGAGCAATGGCCAGGGCCCCGCCGGCCACCA

CGGCTGGCCTTGCGCCAGCTGAGAACTCACGTCCAGT

GCAGGGAGACTCAAGACAGCCTGTGCACACAGCCTCG

GATCTGCTCCCATTTCAAGCAGAAAAAGGAAACCGTG

CAGGCAGCCCTCAGCATTTCAAGGATTGTAGCAGCGG

CCAACTATTCGTCGGCAGTGGCCGATTAGAATGACCG

TGGAGAAGGGCGGAAGGGTCTCTCGTGGGCTCTGCGG

CCAACAGGCCCTGGCTCCACCTGCCCGCTGCCAGCCC

GAGGGGCTTGGGCCGAGCCAGGAACCACAGTGCTCAC

CGGGACCACAGTGACTGACCAAACTCCCGGCCAGAGC

AGCCCCAGGCCAGCCGGGCTCTCGCCCTGGAGGACTC

ACCATCAGATGCACAAGGGGGCGAGTGTGGAAGAGAC

GTGTCGCCCGGGCCATTTGGGAAGGCGAAGGGACCTT

CCAGGTGGACAGGAGGTGGGACGCACTCCAGGCAAGG

GACTGGGTCCCCAAGGCCTGGGGAAGGGGTACTGGCT

TGGGGGTTAGCCTGGCCAGGGAACGGGGAGCGGGGCG

GGGGGCTGAGCAGGGAGGACCTGACCTCGTGGGAGCG

AGGCAAGTCAGGCTTCAGGCAGCAGCCGCACATCCCA

GACCAGGAGGCTGAGGCAGGAGGGGCTTGCAGCGGGG

CGGGGGCCTGCCTGGCTCCGGGGGCTCCTGGGGGACG

CTGGCTCTTGTTTCCGTGTCCCGCAGCACAGGGCCAG

CTCGCTGGGCCTATGCTTACCTTGATGTCTGGGGCCG

GGGCGTCAGGGTCGTCGTCTCCTCAGGGGAGAGTCCC

CTGAGGCTACGCTGGGG*GGGGACTATGGCAGCTCCA

CCAGGGGCCTGGGGACCAGGGGCCTGGACCAGGCTGC

AGCCCGGAGGACGGGCAGGGCTCTGGCTCTCCAGCAT

CTGGCCCTCGGAAATGGCAGAACCCCTGGCGGGTGAG

CGAGCTGAGAGCGGGTCAGACAGACAGGGGCCGGCCG

GAAAGGAGAAGTTGGGGGCAGAGCCCGCCAGGGGCCA

GGCCCAAGGTTCTGTGTGCCAGGGCCTGGGTGGGCAC

ATTGGTGTGGCCATGGCTACTTAGATTCGTGGGGCCA

GGGCATCCTGGTCAGCGTCTCCTCAGGTGAGCCTGGT

GTCTGATGTCCAGCTAGGCGCTGGTGGGCCGCGGGTG

GGCCTGTCTCAGGCTAGGGCAGGGGCTGGGATGTGTA

TTTGTCAAGGAGGGGCAACAGGGTGCAGACTGTGCCC

CTGGAAACTTGACCACTGGGGCAGGGGCGTCCTGGTC

ACGTCTCCTCAGGTAAGACGGCCCTGTGCCCCTCTCT

CGCGGGACTGGAAAAGGAATTTTCCAAGATTCCTTGG

TCTGTGTGGGGCCCTCTGGGGCCCCCGGGGGTGGCTC

CCCTCCTGCCCAGATGGGGCCTCGGCCTGTGGAGCAC

GGGCTGGGCACACAGCTCGAGTCTAGGGCCACAGAGG

CCCGGGCTCAGGGCTCTGTGTGGCCCGGCGACTGGCA

GGGGGCTCGGGTTTTTGGACACCCCCTAATGGGGGCC

ACAGCACTGTGACCATCTTCACAGCTGGGGCCGAGGA

GTCGAGGTCACCGTCTCCTCAGGTGAGTCCTCGTCAG

CCCTCTCTCACTCTCTGGGGGGTTTTGCTGCATTTTG

TGGGGGAAAGAGGATGCCTGGGTCTCAGGTCTAAAGG

TCTAGGGCCAGCGCCGGGGCCCAGGAAGGGGCCGAGG

GGCCAGGCTCGGCTCGGCCAGGAGCAGAGCTTCCAGA

CATCTCGCCTCCTGGCGGCTGCAGTCAGGCCTTTGGC

CGGGGGGGTCTCAGCACCACCAGGCCTCTTGGCTCCC

GAGGTCCCCGGCCCCGGCTGCCTCACCAGGCACCGTG

CGCGGTGGGCCCGGGCTCTTGGTCGGCCACCCTTTCT

TAACTGGGATCCGGGCTTAGTTGTCGCAATGTGACAA

CGGGCTCGAAAGCTGGGGCCAGGGGACCCTAGT*TAC

GACGCCTCGGGTGGGTGTCCCGCACCCCTCCCCACTT

TCACGGCAGTCGGCGAGACCTGGGGAGTCAGGTGTTG

GGGACACTTTGGAGGTCAGGAACGGGAGCTGGGGAGA

GGGCTCTGTCAGCGGGGTCCAGAGATGGGCCGCCCTC

CAAGGACGCCCTGCGCGGGGACAAGGGCTTCTTGGCC

TGGCCTGGCCGCTTCACTTGGGCGTCAGGGGGGGCTT

CCCGGGGCAGGCGGTCAGTCGAGGCGGGTTGGAATTC

TGAGTCTGGGTTCGGGGTTCGGGGTTCGGCCTTCATG

AACAGACAGCCCAGGCGGGCCGTTGTTTGGCCCCTGG

GGGCCTGGTTGGAATGCGAGGTCTCGGGAAGTCAGGA

GGGAGCCTGGCCAGCAGAGGGTTCCCAGCCCTGCGGC

CGAGGGACCTGGAGACGGGCAGGGCATTGGCCGTCGC

AGGGCCAGGCCACACCCCCCAGGTTTTTGTGGGGCGA

GCCTGGAGATTGCACCACTGTGATTACTATGCTATGG

ATCTCTGGGGCCCAGGCGTTGAAGTCGTCGTGTCCTC

AGGTAAGAACGGCCCTCCAGGGCCTTTAATTTCTGCT

CTCGTCTGTGGGCTTTTCTGACTCTGATCCTCGGGAG

GCGTCTGTGCCCCCCCCGGGGATGAGGCCGGCTTGCC

AGGAGGGGTCAGGGACCAGGAGCCTGTGGGAAGTTCT

GACGGGGGCTGCAGGCGGGAAGGGCCCCACCGGGGGG

CGAGCCCCAGGCCGCTGGGCGGCAGGAGACCCGTGAG

AGTGCGCCTTGAGGAGGGTGTCTGCGGAACCACGAAC

GCCCGCCGGGAAGGGCTTGCTGCAATGCGGTCTTCAG

ACGGGAGGCGTCTTCTGCCCTCACCGTCTTTCAAGCC

CTTGTGGGTCTGAAAGAGCCATGTCGGAGAGAGAAGG

GACAGGCCTGTCCCGACCTGGCCGAGAGCGGGCAGCC

CCGGGGGAGAGCGGGGCGATCGGCCTGGGCTCTGTGA

GGCCAGGTCCAAGGGAGGACGTGTGGTCCTCGTGACA

GGTGCACTTGCGAAACCTTAGAAGACGGGGTATGTTG

GAAGCGGCTCCTGATGTTTAAGAAAAGGGAGACTGTA

AAGTGAGCAGAGTCCTCAAGTGTGTTAAGGTTTTAAA

GGTCAAAGTGTTTTAAACCTTTGTGACTGCAGTTAGC

AAGCGTGCGGGGAGTGAATGGGGTGCCAGGGTGGCCG

AGAGGCAGTACGAGGGCCGTGCCGTCCTCTAATTCAG

GGCTTAGTTTTGCAGAATAAAGTCGGCCTGTTTTCTA

AAAGCATTGGTGGTGCTGAGCTGGTGGAGGAGGCCGC

GGGCAGCCCTGGCCACCTGCAGCAGGTGGCAGGAAGC

AGGTCGGCCAAGAGGCTATTTTAGGAAGCCAGAAAAC

ACGGTCGATGAATTTATAGCTTCTGGTTTCCAGGAGG

TGGTTGGGCATGGCTTTGCGCAGCGCCACAGAACCGA

AAGTGCCCACTGAGAAAAAACAACTCCTGCTTAATTT

GCATTTTTCTAAAAGAAGAAACAGAGGCTGACGGAAA

CTGGAAAGTTCCTGTTTTAACTACTCGAATTGAGTTT

TCGGTCTTAGCTTATCAACTGCTCACTTAGATTCATT

TTCAAAGTAAACGTTTAAGAGCCGAGGCATTCCTATC

CTCTTCTAAGGCGTTATTCCTGGAGGCTCATTCACCG

CCAGCACCTCCGCTGCCTGCAGGCATTGCTGTCACCG

TCACCGTGACGGCGCGCACGATTTTCAGTTGGCCCGC

TTCCCCTCGTGATTAGGACAGACGCGGGCACTCTGGC

CCAGCCGTCTTGGCTCAGTATCTGCAGGCGTCCGTCT

CGGGACGGAGCTCAGGGGAAGAGCGTGACTCCAGTTG

AACGTGATAGTCGGTGCGTTGAGAGGAGACCCAGTCG

GGTGTCGAGTCAGAAGGGGCCCGGGGCCCGAGGCCCT

GGGCAGGACGGCCCGTGCCCTGCATCACGGGCCCAGC

GTCCTAGAGGCAGGACTCTGGTGGAGAGTGTGAGGGT

GCCTGGGGCCCCTCCGGAGCTGGGGCCGTGCGGTGCA

GGTTGGGCTCTCGGCGCGGTGTTGGCTGTTTCTGCGG

GATTTGGAGGAATTCTTCCAGTGATGGGAGTCGCCAG

TGACCGGGCACCAGGCTGGTAAGAGGGAGGCCGCCGT

CGTGGCCAGAGCAGCTGGGAGGGTTCGGTAAAAGGCT

CGCCCGTTTCCTTTAATGAGGACTTTTCCTGGAGGGC

ATTTAGTCTAGTCGGGACCGTTTTCGACTCGGGAAGA

GGGATGCGGAGGAGGGCATGTGCCCAGGAGCCGAAGG

CGCCGCGGGGAGAAGCCCAGGGCTCTCCTGTCCCCAC

AGAGGCGACGCCACTGCCGCAGACAGACAGGGCCTTT

CCCTCTGATGACGGCAAAGGCGCCTCGGCTCTTGCGG

GGTGCTGGGGGGGAGTCGCCCCGAAGCCGCTCACCCA

GAGGCCTGAGGGGTGAGACTGACCGATGCCTCTTGGC

CGGGCCTGGGGCCGGACCGAGGGGGACTCCGTGGAGG

CAGGGCGATGGTGGCTGCGGGAGGGAACCGACCCTGG

GCCGAGCCCGGCTTGGCGATTCCCGGGCGAGGGCCCT

CAGCCGAGGCGAGTGGGTCCGGCGGAACCACCCTTTC

TGGCCAGCGCCACAGGGCTCTCGGGACTGTCCGGGGC

GACGCTGGGCTGCCCGTGGCAGGCCTGGGCTGACCTG

GACTTCACCAGACAGAACAGGGCTTTCAGGGCTGAGC

TGAGCCAGGTTTAGCGAGGCCAAGTGGGGCTGAACCA

GGCTCAACTGGCCTGAGCTGGGTTGAGCTGGGCTGAC

CTGGGCTGAGCTGAGCTGGGCTGGGCTGGGCTGGGCT

GGGCTGGGCTGGGCTGGACTGGCTGAGCTGAGCTGGG

TTGAGCTGAGCTGAGCTGGCCTGGGTTGAGCTGGGCT

GGGTTGAGCTGAGCTGGGTTGAGCTGGGTTGAGCTGG

GTTGATCTGAGCTGAGCTGGGCTGAGCTGAGCTAGGC

TGGGGTGAGCTGGGCTGAGCTGGTTTGAGTTGGGTTG

AGCTGAGCTGAGCTGGGCTGTGCTGGCTGAGCTAGGC

TGAGCTAGGCTAGGTTGAGCTGGGCTGGGCTGAGCTG

AGCTAGGCTGGGCTGATTTGGGCTGAGCTGAGCTGAG

CTAGGCTGCGTTGAGCTGGCTGGGCTGGATTGAGCTG

GCTGAGCTGGCTGAGCTGGGCTGAGCTGGCCTGGGTT

GAGCTGAGCTGGACTGGTTTGAGCTGGGTCGATCTGG

GTTGAGCTGTCCTGGGTTGAGCTGGGCTGGGTTGAGC

TGAGCTGGGTTGAGCTGGGCTCAGCAGAGCTGGGTTG

GGCTGAGCTGGGTTGAGCTGAGCTGGGCTGAGCTGGC

CTGGGTTGAGCTGGGCTGAGCTGAGCTGGGCTGAGCT

GGCCTGTGTTGAGCTGGGCTGGGTTGAGCTGGGCTGA

GCTGGATTGAGCTGGGTTGAGCTGAGCTGGGCTGGGC

TGTGCTGACTGAGCTGGGCTGAGCTAGGCTGGGGTGA

GCTGGGCTGAGCTGATCCGAGCTAGGCTGGGCTGGTT

TGGGCTGAGCTGAGCTGAGCTAGGCTGGATTGATCTG

GCTGAGCTGGGTTGAGCTGAGCTGGGCTGAGCTGGTC

TGAGCTGGCCTGGGTCGAGCTGAGCTGGACTGGTTTG

AGCTGGGTCGATCTGGGCTGAGCTGGCCTGGGTTGAG

CTGGGCTGGGTTGAGCTGAGCTGGGTTGAGCTGGGCT

GAGCTGAGGGCTGGGGTGAGCTGGGCTGAACTAGCCT

AGCTAGGTTGGGCTGAGCTGGGCTGGTTTGGGCTGAG

CTGAGCTGAGCTAGGCTGCATTGAGCAGGCTGAGCTG

GGCTGAGCAGGCCTGGGGTGAGCTGGGCTAGGTGGAG

CTGAGCTGGGTCGAGCTGAGTTGGGCTGAGCTGGCCT

GGGTTGAGGTAGGCTGAGCTGAGCTGAGCTAGGCTGG

GTTGAGCTGGCTGGGCTGGTTTGCGCTGGGTCAAGCT

GGGCCGAGCTGGCCTGGGTTGAGCTGGGCTCGGTTGA

GCTGGGCTGAGCTGAGCCGACCTAGGCTGGGATGAGC

TGGGCTGATTTGGGCTGAGCTGAGCTGAGCTAGGCTG

CATTGAGCAGGCTGAGCTGGGCCTGGAGCCTGGCCTG

GGGTGAGCTGGGCTGAGCTGCGCTGAGCTAGGCTGGG

TTGAGCTGGCTGGGCTGGTTTGCGCTGGGTCAAGCTG

GGCCGAGCTGGCCTGGGATGAGCTGGGCCGGTTTGGG

CTGAGCTGAGCTGAGCTAGGCTGCATTGAGCAGGCTG

AGCTGGGCTGAGCTGGCCTGGGGTGAGCTGGGCTGAG

CTAAGCTGAGCTGGGCTGGTTTGGGCTGAGCTGGCTG

AGCTGGGTCCTGCTGAGCTGGGCTGAGCTGACCAGGG

GTGAGCTGGGCTGAGTTAGGCTGGGCTCAGCTAGGCT

GGGTTGATCTGGCAGGGCTGGTTTGCGCTGGGTCAAG

CTCCCGGGAGATGGCCTGGGATGAGCTGGGCTGGTTT

GGGCTGAGCTGAGCTGAGCTGAGCTAGGCTGCATTGA

GCAGGCTGAGCTGGGCTGAGCTGGCCTGGGGTGAGCT

GGGCTGGGTGGAGCTGAGCTGGGCTGAACTGGGCTAA

GCTGGCTGAGCTGGATCGAGCTGAGCTGGGCTGAGCT

GGCCTGGGGTTAGCTGGGCTGAGCTGAGCTGAGCTAG

GCTGGGTTGAGCTGGCTGGGCTGGTTTGCGCTGGGTC

AAGCTGGGCCGAGCTGGCCTGGGTTGAGCTGGGCTGG

GCTGAGCTGAGCTAGGCTGGGTTGAGCTGGGCTGGGC

TGAGCTGAGCTAGGCTGCATTGAGCTGGCTGGGATGG

ATTGAGCTGGCTGAGCTGGCTGAGCTGGCTGAGCTGG

GCTGAGCTGGCCTGGGTTGAGCTGGGCTGGGTTGAGC

TGAGCTGGGCTGAGCTGGGCTCAGCAGAGCTGGGTTG

AGCTGAGCTGGGTTGAGCTGGGGTGAGCTGGGCTGAG

CAGAGCTGGGTTGAGCTGAGCTGGGTTGAGCTGGGCT

CGAGCAGAGCTGGGTTGAGCTGAGCTGGGTTGAGCTG

GGCTCAGCAGAGCTGGGTTGAGCTGAGCTGGGTTGAG

CTGGGCTGAGCTAGCTGGGCTCAGCTAGGCTGGGTTG

AGCTGAGCTGGGCTGAACTGGGCTGAGCTGGGCTGAA

CTGGGCTGAGCTGGGCTGAGCTGGGCTGAGCAGAGCT

GGGCTGAGCAGAGCTGGGTTGGTCTGAGCTGGGTTGA

GCTGGGCTGAGCTGGGCTGAGCAGAGTTGGGTTGAGC

TGAGCTGGGTTCAGCTGGGCTGAGCTAGGCTGGGTTG

AGCTGGGTTGAGTTGGGCTGAGCTGGGCTGGGTTGAG

CGGAGCTGGGCTGAACTGGGCTGAGCTGGGCTGAGCG

GAACTGGGTTGATCTGAATTGAGCTGGGCTGAGCCGG

GCTGAGCCGGGCTGAGCTGGGCTAGGTTGAGCTTGGG

TGAGCTTGCCTCAGCTGGTCTGAGCTAGGTTGGGTGG

AGCTAGGCTGGATTGAGCTGGGCTGAGCTGAGCTGAT

CTGGCCTCAGCTGGGCTGAGGTAGGCTGAACTGGGCT

GTGCTGGGCTGAGCTGAGCTGAGCCAGTTTGAGCTGG

GTTGAGCTGGGCTGAGCTGGGCTGTGTTGATCTTTCC

TGAACTGGGCTGAGCTGGGCTGAGCTGGCCTAGCTGG

ATTGAACGGGGGTAAGCTGGGCCAGGCTGGACTGGGC

TGAGCTGAGCTAGGCTGAGCTGAGTTGAATTGGGTTA

AGCTGGGCTGAGATGGGCTGAGCTGGGCTGAGCTGGG

TTGAGCCAGGTCGGACTGGGTTACCCTGGGCCACACT

GGGCTGAGCTGGGCGGAGCTCGATTAACCTGGTCAGG

CTGAGTCGGGTCCAGCAGACATGCGCTGGCCAGGCTG

GCTTGACCTGGACACGTTCGATGAGCTGCCTTGGGAT

GGTTCACCTCAGCTGAGCCAGGTGGCTCCAGCTGGGC

TGAGCTGGTGACCCTGGGTGACCTCGGTGACCAGGTT

GTCCTGAGTCCGGGCCAAGCCGAGGCTGCATCAGACT

CGCCAGACCCAAGGCCTGGGCCCCGGCTGGCAAGCCA

GGGGCGGTGAAGGCTGGGCTGGCAGGACTGTCCCGGA

AGGAGGTGCACGTGGAGCCGCCCGGACCCCGACCGGC

AGGACCTGGAAAGACGCCTCTCACTCCCCTTCTCTTC

TGTCCCCTCTCGGGTCCTCAGAGAGCCAGTCTGCCCC

GAATCTCTACCCCCTCGTCTCCTGCGTCAGCCCCCCG

TCCGATGAGAGCCTGGTGGCCCTGGGCTGCCTGGCCC

GGGACTTCCTGCCCAGCTCCGTCACCTTCTCCTGGAA

Porcine Kappa Light Chain

In another embodiment, novel genomic sequences encoding the kappa light chain locus of ungulate immunoglobulin are provided. The present invention provides the first reported genomic sequence of ungulate kappa light chain regions. In one embodiment, nucleic acid sequence is provided that encodes the porcine kappa light chain locus. In another embodiment, the nucleic acid sequence can contain at least one joining region, one constant region and/or one enhancer region of kappa light chain. In a further embodiment, the nucleotide sequence can include at least five joining regions, one constant region and one enhancer region, for example, as represented in Seq ID No. 30. In a further embodiment, an isolated nucleotide sequence is provided that contains at least one, at least two, at least three, at least four or five joining regions and 3′ flanking sequence to the joining region of porcine genomic kappa light chain, for example, as represented in Seq ID No 12. In another embodiment, an isolated nucleotide sequence of porcine genomic kappa light chain is provided that contains 5′ flanking sequence to the first joining region, for example, as represented in Seq ID No. 25. In a further embodiment, an isolated nucleotide sequence is provided that contains 3′ flanking sequence to the constant region and, optionally, the 5′ portion of the enhancer region, of porcine genomic kappa light chain, for example, as represented in Seq ID Nos. 15, 16 and/or 19.

In further embodiments, isolated nucleotide sequences as depicted in Seq ID Nos 30, 12, 25, 15, 16 or 19 are provided. Nucleic acid sequences at least 80, 85, 90, 95, 98 or 99% homologous to Seq ID Nos 30, 12, 25, 15, 16 or 19 are also provided. In addition, nucleotide sequences that contain at least 10, 15, 17, 20, 25 or 30 contiguous nucleotides of Seq ID Nos 30, 12, 25, 15, 16 or 19 are provided. In addition, nucleotide sequences that contain at least 10, 15, 17, 20, 25 or 30 contiguous nucleotides of Seq ID Nos 1, 4 or 29 are provided. In other embodiments, nucleotide sequences that contain at least 50, 100, 1,000, 2,500, 5,000, 7,000, 8,000, 8,500, 9,000, 10,000 or 15,000 contiguous nucleotides of Seq ID No. 30 are provided. Further provided are nucleotide sequences that hybridizes, optionally under stringent conditions, to Seq ID Nos 30, 12, 25, 15, 16 or 19, as well as, nucleotides homologous thereto.

In one embodiment, an isolated nucleotide sequence encoding kappa light chain is provided that includes at least five joining regions, one constant region and one enhancer region, for example, as represented in Seq ID No. 30. In Seq ID No. 30, the coding region of kappa light chain is represented, for example by residues 1-549 and 10026-10549, whereas the intronic sequence is represented, for example, by residues 550-10025, the Joining region of kappa light chain is represented, for example, by residues 5822-7207 (for example, J1:5822-5859, J2:6180-6218, J3:6486-6523, J4:6826-6863, J5:7170-7207), the Constant Region is represented by the following residues: 10026-10549 (C exon) and 10026-10354 (C coding), 10524-10529 (Poly(A) signal) and 11160-11264 (SINE element).

Seq ID No 30

GCGTCCGAAGTCAAAAATATCTGCAGCCTTCATGTAT

TCATAGAAACAAGGAATGTCTACATTTTCCAAAGTGG

GACCAGAATCTTGGGTCATGTCTAAGGCATGTGCATT

TGCACATGGTAGGCAAAGGACTTTGCTTCTCCCAGCA

CATCTTTCTGCAGAGATCCATGGAAACAAGACTCAAC

TCCAAAGCAGCAAAGAAGCAGCAAGTTCTCAAGTGAT

CTCCTCTGACTCCCTCCTCCCAGGCTAATGAAGCCAT

GTTGCCCCTGGGGGATTAAGGGCAGGTGTCCATTGTG

GCACCCAGCCCGAAGACAAGCAATTTGATCAGGTTCT

GAGCACTCCTGAATGTGGACTCTGGAATTTTCTCCTC

ACCTTGTGGCATATCAGCTTAAGTCAAGTACAAGTGA

CAAACAACATAATCCTAAGAAGAGAGGAATCAAGCTG

AAGTCAAAGGATCACTGCCTTGGATTCTACTGTGAAT

GATGACCTGGAAAATATCCTGAACAACAGCTTCAGGG

TGATCATCAGAGACAAAAGTTCCAGAGCCAGgtaggg

aaaccctcaagccttgcaaagagcaaaatcatgccat

tgggttcttaacctgctgagtgatttactatatgtta

ctgtgggaggcaaagcgctcaaatagcctgggtaagt

atgtcaaataaaaagcaaaagtggtgtttcttgaaat

gttagacctgaggaaggaatattgataacttaccaat

aattttcagaatgatttatagatgtgcacttagtcag

tgtctctccaccccgcacctgacaagcagtttagaat

ttattctaagaatctaggtttgctgggggctacatgg

gaatcagcttcagtgaagagtttgttggaatgattca

ctaaattttctatttccagcataaatccaagaacctc

tcagactagtttattgacactgcttttcctccataat

ccatctcatctccgtccatcatggacactttgtagaa

tgacaggtcctggcagagactcacagatgcttctgaa

acatcctttgccttcaaagaatgaacagcacacatac

taaggatctcagtgatccacaaattagtttttgccac