TRANSGENIC CLONED COW PRODUCING HUMAN PROUROKINASE AND METHOD FOR PRODUCING THE SAME

TRANSGENIC CLONED COW PRODUCING HUMAN PROUROKINASE AND METHOD FOR PRODUCING THE SAME

TECHNICAL FIELD

The present invention, in general, relates to a method of producing a transgenic animal by gene targeting using a transfection technique in combination with somatic cell cloning, and transgenic animals produced by such a method. In addition, the present invention relates to a method of producing useful human-derived proteins or biomedicines using such transgenic animals.

More particularly, the present invention relates to a method of producing a transgenic cloned cow expressing human prourokinase, comprising the steps of introducing a exogenous gene encoding human prourokinase into adult cow-derived somatic cells; and producing a cloned cow using the transfected somatic cells. Also, the present invention is related to a transgenic cloned cow produced by such a method.

In addition, the present invention, in general, relates to a method of obtaining human prourokinase by gene targeting using a transfection technique in combination with somatic cell cloning. More particularly, the present invention relates to a method of obtaining human prourokinase from cow's milk by introducing a gene encoding human prourokinase into adult cow-derived somatic cells using a gene targeting followed by a transgenic cloned cow expressing human prourokinase in the mammary gland by a somatic cell cloning technique using the transfected somatic cells.

BACKGROUND ART

Typically, a blood clot formed in the blood vessels or the heart is called "thrombus", and pathological conditions associated with the formation of such a thrombus are called thrombosis. Thrombosis occurs at various pathological situations including cerebral infarction, myocardial infarction and pulmonary infarction.

Formation of blood clots is a mechanism whereby the body prevents blood loss from blood vessels damaged by some factors. Formation of blood clot closely relates to changes in blood constituents, abnormalities of blood flow and changes of blood vessel walls. That is, when a blood vessel is injured, platelets adhere to the damaged site and then form aggregates, resulting in prevention of bleeding. At such an aggregation state, the platelets release substances activating clotting factors present in the blood, thus causing further aggregation of platelets and forming more solid plugs. Many factors participate in the formation of blood clot, which consists of a cascade of enzymatic activations in which an activated enzyme activates the next inactive enzyme (Haemostatic system). In addition, some of the clotting factors are activated directly by injury or damaged tissues. Thus, a blood clot is occurred by various factors. In contrast, substances inhibiting blood clotting, that is, anti-coagulating factors are also present in blood, thus suppressing abnormal formation of blood clot. Blood clots are formed when the body needs them. However, when haemostasis is no longer necessary, blood clots are dissolved by some enzymes with the ability to dissolve the clots, and the blood vessel then returns to its original state (Fibrinolytic system). As described above, a broad range of factors participates in formation of thrombus. However, factors directly associated with thrombus formation include platelets, blood clotting factors and fibrinolytic factors. In this regard, with aim to treat thrombosis, substances capable of affecting the blood cells and factors participating in the thrombus formation were developed as pharmaceutical preparations. Treatment of thrombosis is classified into two groups: anti-thrombus therapy preventing formation of thrombus; and thrombolytic therapy dissolving formed thrombus. In addition, the former anti-thrombus therapy is subdivided into anti-platelet therapy and anti-coagulation therapy.

The anti-platelet therapy aims to inhibit the function of platelets that act at an early stage of thrombus formation. Aspirin, agents having aspirin-like effects and other orally administered pharmaceutical preparations were developed for the anti-platelet therapy. On the other hand, anti-coagulation therapy aims to inhibit thrombus formation by suppressing clotting factors. Anti-coagulating agents are largely classified into drugs inhibiting an activity of the clotting factors and drugs suppressing production of the clotting factors. Examples of the former include heparin and enzyme inhibitors. On the other hand, thrombosis can be treated with a mechanism different from the anti-thrombus therapy, that is, by dissolving formed thrombus. This thrombolytic therapy aims not to prevent thrombus formation, but to dissolve thrombus formed in the blood vessels, thereby removing vascular occlusion and re-establishing blood flow. In this therapy, several types of plasminogen activators activate plasminogen into plasmin (Collen, D. and Lijnen, H.R. CRC Critical Reviews in oncology/hematology, 4, 1986, n.3, p.249), and plasmin lyses fibrin clots (Rakoczi. I., Wiman, B. and Collen, D. Biochim. Biophys. Acta., 540, 1978, p295; Robbins, K.C.Summaria, L., Hsieh, B. and Shah, R.S. Biol.Chem. 242, 1967, p2333; Wiman, B. Eur. J. Biochim, 76, 1997, pl29).

Examples of the clot-dissolving drugs used in the thrombus dissolving therapy include biomaterials such as tissue plasminogen activator (hereinafter, referred to as "t-

PA") which is a plasminogen activator converting inactive plasminogen to active plasmin, urokinase or prourokinase (hereinafter, referred to as "proUK"), bacterial enzymes such as staphylokinase or streptokinase, and recombinant products thereof.

Urokinase and streptokinase are plasminogen activators generally used for thrombus dissolution therapy in humans, but are disadvantageous in terms of their nonspecific activity for fibrin and thus of randomly activating circulating plasminogen or plasminogen bound to fibrin (Zamarron, C, Lijnen, H.R., Van Hoef, B. and Collen, D. Thromb. Haemostas. 52, 1984, p.9; and Samama, M. and Kher, A.Sem. Hop. Paris. 61, 1985, n.20, pl423). For this reason, haemostasis disorder occurs in the whole body during the therapy with such thrombolytic agents, urokinase and streptokinase (Samama, M. and Kher, A. Sem. Hop. Paris, 61, 1985, n.20. pl423; Maizel, A.S. and Bookstein, J.J.

Cardiovsac. Intervent. Radiol., 9, 1986, p236; Bell, W.R. Thromb. Haemostas., 35, 1976, p57; and Acar, J., Vahanian, A., Michel, P.L., Slama, M., Cormier, B. and Roger, V., Seminars in Thromb. and Haemost, 13, 1987, n. 2, p.186).

In contrast, t-PA (Hoylaerts, M., Ryken, D.C., Lijnen, H.R. and Collen, D.J. Biol. Chem., 257, 1982, n.6, p2912) and proUK (Husain, S.S. and Gurewich, V. Arch. Biochem.

Biophys. 220. 1983, p31) have a specific activity to fibrin and thus are widely used. In particular, in addition to the specific activity to fibrin, proUK causes milder cerebral hemorrhage than t-PA. For this reason, many studies for proUK are associated with therapeutic effects for cerebral stroke. ProUK spotlighted as a thrombolytic agent is known to be isolated from human urine, plasma and culture supematants of various cell lines. In order to obtain proUK from the human urine, plasma or culture supematants, a purification step must be carried out. Also, these sources are limited in amount for producing proUK. Therefore, there is a need for development of an economic method capable of producing proUK with high- yield.

In this regard, an alternative method is to use microorganisms. Human proUK can be obtained by transforming a microorganism with a recombinant plasmid carrying a gene encoding human proUK (PCT/EP89/01168, US 5,866,358, etc.). However, because of producing in microorganisms, this method is disadvantageous in terms of low yield, low stability, loss of biological activity of proUK and management problems.

Also, proUK could be produced in transgenic animals by employing retroviral vectors, DNA microinjection or embryonic stem cells. Of these methods, retro viral vectors are disadvantageous in that they cannot harbor a large-sized gene (about 8 kb) and can cause a viral infection with the retrovirus.

For example, human t-PA could be obtained from milk of transgenic mice (Gordon et al. Bio/Technology 5:1183-1187, 1987; and US 4,873,316). In addition, human t-PA could be produced in transgenic mice (e.g., US 4,736,866), transgenic pig (e.g., Miller, K.J. et al. J. Endocrin. 120, 1989, p481), transgenic sheep (e.g., Nancarrow, et al. Theriogenology 27, 1987, p262), transgenic rabbit (e.g., Hannover, S.V. et al. Deutsche Tierarztliche Wochenschrift 94, 1987, p476) and transgenic cow (e.g., Agner, et al. Theriogenology 21, 1984, p29).

However, because the aforementioned methods introduce a exogenous gene into a cell to produce transgenic animals by pronuclear microinjection, which results in extremely low production yield (below 5%) and occurrence of genetic mosaicism, they are problematic from an economic viewpoint and in terms of being incapable of producing target proteins with desired properties. That is, the pronuclear microinjection is characterized by injection of a desired gene into a pronucleus of a fertilized oocyte within about 18-24 hrs after fertilization, resulting in production of chimeric offspring. In order to produce desired homologous transgenic offspring, a crossing between the offsprings should be carried out again. Moreover, in case that animals have a long gestation period (over 200 days), such as cows, it takes very long to obtain homologous transgenic animals by the pronuclear microinjection. In this regard, the methods of producing transgenic animals by pronuclear microinjection are not effective and problematic. Therefore, there is still a need for development of methods capable of economically producing high-purity desired proteins in a short time. A recent report is concerned with transgenic sheep secreting human clotting factor

IX into milk, which can be produced by transfecting sheep primary embryonic fibroblasts with a neomycin-resistant marker gene and a human clotting factor IX gene and by fusing the transfected cells with enucleated oocytes (Angelika E. et al. Science, Vol. 278, 1997, p.2130). Cloned animals capable of producing useful proteins can be produced by preparing nuclear donor cells from a transgenic fetus carrying a human antithrombin III gene and fusing the donor cells with enucleated oocytes (Brett C. Reggio, et al. Biology of reproduction. 65, 2001, pl528). In these studies, nuclear donor cells used for production of cloned animals were derived from fetuses, and, in particular, the latter case used cells isolated from the transgenic fetus as nuclear donor cells.

With respect to a degree of cell differentiation, a use of donor cells derived from fetuses is advantageous in terms of technically facilitating production of cloned animals by somatic cell nuclear transfer. However, when it is intended to produce cloned animals while maintaining phenotypes of high-capacity animals, the cloned animals should carry genotypes responsible for the phenotypes. Therefore, fetuses are limited in their use for production of cloned animals in terms of giving no information of their phenotypes as well as genotypes, especially their sex.

In this regard, by employing somatic cells derived from an adult animal identified as female instead of somatic cells from a fetus, the present inventors successfully produced a high-capacity cloned animal that possesses the excellent genotype of the adult animal and produces a desired protein into milk.

DISCLOSURE OF THE INVENTION

The present invention relates to a method capable of producing a transgenic animal and a desired protein in the transgenic animal by gene targeting using a transfection technique in combination with somatic cell cloning.

In detail, the present invention relates to a method of producing a transgenic cloned cow expressing human proUK, comprising the steps of introducing a gene encoding human proUK into adult cow-derived somatic cells and producing a transgenic cloned cow using the transfected somatic cells, and a transgenic cloned cow produced by such a method. In addition, the present invention relates to a method of preparing a transgenic nuclear transfer embryo, comprising the steps of introducing a gene encoding human proUK into cow-derived somatic cells and introducing the transfected somatic cells into enucleated cow oocytes, and a transgenic nuclear transfer embryo produced by such a method. Further, the invention relates to a method of producing human proUK in the mammary gland of cows by introducing a gene encoding human proUK into adult cow- derived somatic cells and producing a transgenic cloned cow using the transfected somatic cells.

BRIEF DESCRIPTION OF THE DRAWINGS

The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:

Fig. 1 is a construct of a pbeta2-proUK vector for gene targeting by introduction of a human proUK gene into somatic cell; Fig. 2 is a photograph showing GFP expression in a cell targeted with an exogenous gene;

Fig. 3 is a photograph showing the process of cutting a portion of the zona pellucida of a recipient oocyte (3) using a holding pipette (1) and a cutting pipette (2);

Fig. 4 is a photograph showing the process of enucleation removing the first polar body and the nucleus from the recipient oocyte (3) using a holding pipette (1) and a cutting pipette (2); and

Fig. 5 is a photograph showing the process of transferring a somatic cell into an enucleated oocyte (3) using the holding pipette (1) and a injection pipette (4).

BEST MODE FOR CARRYING OUT THE INVENTION

The present invention relates to a transgenic cloned cow producing a desired protein, wherein the cloned cow is produced by gene targeting using a transfection technique in combination with somatic cell cloning. That is, the cloned cow is produced by a process comprising the steps of introducing a specific gene into somatic cells and employing a somatic cell cloning technique to produce a transgenic animal using the transfected somatic cells.

In detail, the present invention provides a method of producing a transgenic cloned cow expressing human proUK, comprising the steps of introducing a gene encoding human proUK into adult cow-derived somatic cells and producing a transgenic cloned cow expressing human proUK using the transfected somatic cells by somatic cell cloning.

In addition, the present invention provides a method of preparing a transgenic nuclear transfer embryo, comprising the steps of introducing a gene encoding human proUK into cow-derived somatic cells and introducing the transfected somatic cells into an enucleated cow oocyte.

The transgenic nuclear transfer embryo and cloned cow of the present invention are characterized in that they carry an exogenous gene encoding human proUK.

Further, the present invention provides a method of easily producing human proUK by employing the transgenic cloned cow expressing human proUK. Definition of terms

Terms as used herein are necessary to be clearly defined. Typically, all technique and science-related terms not defined herein have the meanings commonly used in the art. However, despite having common meanings in this art, the following terms will be defined to clarify their meanings as well as to establish the scope of the present invention.

The term "vector", as used herein, refers to a plasmid, a cosmid, a phage, a virus, a retrovirus or other carriers, which are capable of accepting insertion, transfer or expression of a nucleic acid encoding human proUK.

The term "promoter", as used herein, refers to a regulatory DNA sequence regulating a transcription of human proUK cDNA.

The term "transformation", as used herein, refers to a change in the genotype of an organism by artificially integrating an exogenous gene into its chromosomal DNA. Transformation could be achieved by various methods, and the most widely used methods are microinjection of DNA into the pronucleus of a fertilized oocyte and somatic cell cloning, used in the present invention.

The term "transgenic animal", as used herein, which may also be called "gene transfer animal", refers to an animal having a partially modified genotype by artificial integration of an exogenous gene into its chromosomal DNA. Therefore, in the present invention, the term "transgenic animal" means a bioreactor producing physiologically active materials useful to humans, a disease model animal genetically exhibiting a specific disease and an animal capable of producing organs transplantable to humans, etc.

The term "nuclear transfer", as used herein, means a gene manipulation technique for cloning animals, whereby a full substance of nuclear DNA from one cell is introduced into an enucleated oocyte in order to produce several cloned animals with excellent genotypes equal to the nuclear DNA source. In the present invention, the fertilized oocyte produced by nuclear transfer is designated "nuclear transfer embryo".

In detail, to produce a transgenic animal using a somatic cell cloning technique, the present invention includes the steps of introducing a desired gene into somatic cells and producing a cloned animal using the transfected somatic cells.

In more detail, the present invention provides a method of producing a transgenic cloned cow expressing human proUK, comprising the steps of introducing a gene encoding human proUK into a cow-derived somatic cell line to prepare a nuclear donor cell; removing cumulus cells surrounding a recipient oocyte and then removing the cytoplasm including the first polar body from the oocyte to prepare a cow-derived enucleated recipient oocyte; transferring the transfected nuclear donor cell into the enucleated recipient oocyte and carrying out cell fusion to generate nuclear transfer embryo; and transplanting the nuclear transfer the embryo into a surrogate mother cow to produce live offspring.

In addition, the present invention provides a method of producing a transgenic nuclear transfer embryo carrying a gene encoding human proUK, comprising the steps of introducing a gene encoding human proUK into a cow-derived somatic cell line to prepare a nuclear donor cell; removing cumulus cells surrounding a recipient oocyte and then removing the cytoplasm including the first polar body from the oocyte to prepare a cow-derived enucleated recipient oocyte; and transferring the transfected nuclear donor cell into the enucleated recipient oocyte and carrying out cell fusion.

Further, the present invention provides a method of producing human proUK, comprising the step of obtaining human proUK from milk of a transgenic cloned cow expressing human proUK in the mammary gland.

The transgenic nuclear transfer oocyte and cloned cow according to the present invention carry an exogenous gene encoding human proUK.

The method of producing a transgenic cloned cow expressing human proUK in its milk will be described in more detail with respect to each step, as follows.

Gene targeting by introduction of human prourokinase gene into somatic cells

The gene encoding human proUK can be introduced into somatic cells by transfection using a biochemical method, a physical method or virus-mediated gene transfer.

Examples of the biochemical method include calcium precipitation using calcium ions as a vehicle, lipofection using a cationic lipid that is a plasma membrane component, and a method using a non-lipid cationic polymer. Such transfection methods have been widely used owing to their simplicity, effectiveness and stability. The physical method includes electroporation, gene gun and intracytoplasmic microinjection. The virus- mediated gene transfer can be achieved by cloning a desired DNA segment into the genome of an adenovirus or a retrovirus, and then infecting cells with the resulting virus.

Preferably, in the present invention, the gene encoding human proUK may be introduced into somatic cells by the biochemical method using a gene targeting vector carrying the gene. More preferably, the gene encoding human proUK may be introduced into somatic cells by the lipid-mediated method using a gene targeting vector carrying the human proUK gene.

Step 1 : Construction of a gene targeting vector carrying a gene encoding human proUK

Plasmid vectors used in the present invention may be prepared by a standard DNA cloning method and PCR. A gene targeting vector to be used in gene targeting by introduction of a gene encoding human proUK into somatic cells may be prepared using a commercially available plasmid, pcDNA3 (Invitrogen, Groningen, Netherlands).

The gene targeting vector for introduction of a gene encoding human proUK into somatic cells may contain bovine β-casein promoter to express a target gene to the mammary gland of the cow. The gene-targeting vector may contain a human proUK gene as a target gene, and further contain a marker gene. A gene that encodes green fluorescent protein (GFP) exhibiting green fluorescence may be used as a marker gene.

The target gene, bovine β-casein promoter and GFP gene are amplified by PCR, and the resulting PCR products are inserted into a plasmid vector by TA cloning.

Step 2: Establishment of somatic cell line

A cell line prepared by culturing cells obtained from an adult cow may be used as donor cells in the present invention. Herein, the variety of the cow is not specially limited. Preferably, the variety of the cow is the Korean native cow (Hanwoo) or Holstein cow. The cells obtained from an adult cow may be cells isolated from uterine perfusion, uterine endometrium, oviduct, ears or muscle, cumulus cells or fetal fibroblasts, and cultured by the modified Mather and Barnes's method (see: Mather & Barnes, Methods in Cell Biology, Vol.57, 1988, Animal Cell Culture Methods, Academic Press) to establish a cell line. For example, uterine perfusion may be mixed with phosphate-buffered saline

(PBS) containing P/S antibiotics (10000 IU penicillin and 10 mg of streptomycin), and centrifuged. The collected cells may be cultured in DMEM (Dulbecco's modified Eagles medium) containing FBS (fetal bovine serum), NEAA (non-essential amino acid) and P/S antibiotics at 39°C under 5% CO₂. Epithelium of oviduct may be collected from a section of the uterine endometrium or oviduct, washed with the PBS solution, incubated in a trypsin-EDTA solution, and centrifuged. The recovered cells may be cultured under the aforementioned conditions.

The cumulus cell-oocyte complex may be treated with hyaluronidase to separate the cumulus cell layer from an oocyte. The separated cumulus cell layer may be treated with trypsin-EDTA at 39°C under 5% CO₂, centrifuged, and cultured under the aforementioned conditions.

Cartilage collected from the skin of the ear, the inner tissue of the soft skin, muscle tissue or cartilage-excluding tissue of fetal body or arms and legs may be washed and cut finely, incubated in a solution containing trypsin-EDTA and collagenase type II at 39°C under 5% CO₂, and centrifuged. The recovered cells may be cultured under the aforementioned conditions.

The cell line prepared as described above may be preserved by subculture that is performed by removing the culture medium and treating with trypsin-EDTA and refed with a new medium at regular time intervals. Also, the established cell line can be preserved by serum starvation culture in DMEM containing a low concentration of fetal bovine serum according to the method suggested by Wilmut et al. (see, Wilmut et al. Nature, 385, 1997, p.810), or by freezing. The preserved cell line can be used as nuclear donor cells.

Step 3: Introduction of an exogenous gene into somatic cells Introduction of an exogenous gene into cells can be achieved by introducing the prepared gene targeting vector into somatic cells. An exogenous gene can be introduced into cells by transfection using a biochemical method, a physical method, or virus- mediated gene transfer. Preferably, the transfection may be carried out by the biochemical method using FuGeneό (Roche Molecular Biochemicals, IN, U.S.A.), LipofectAmine Plus (Life Technologies) and ExGen 500 (MBI Fermentas). The FuGENE6 transfection reagent, which is a multi-component lipid based reagent, is advantageous in terms of having high transfection efficiency in a variety of cell types and low cytotoxicity, functioning both in the presence or absence of serum, and being easy to optimize its complex formation with DNA at a minimum volume. LipofectAmine Plus, which is a cationic lipid, and ExGen 500, which is a non-lipid cationic polymer, were reported to have high transfection efficiency in a variety of cell types.

Preferably, FuGeneό may be used for introduction of human proUK gene into somatic cells. That is, human proUK gene may be mixed with a liposome-forming agent. The resulting DNA-liposome complexes may be incubated in the culture medium for a predetermined period, and introduced into about 50-70%-confluent somatic cells. In order to effectively introduce the human proUK gene into the cells by mediation of FuGeneό, the optimal conditions for each cell type may be determined by optimizing various parameters, thereby maximizing introduction efficiency and expression level of the human proUK gene. In detail, in this step, a gene encoding human proUK may be targeted into a cell line prepared in Step 2 by a transfection method. That is, the gene targeting vector prepared at Step 1 may be mixed with a transfection reagent, incubated in the culture medium, and introduced into somatic cells. After incubation, the transfected cells can be observed using a fluorescent microscope with a standard fluorescein isothiocyanate (FITC) filter set under ultra violet light.

Step 4: Selection, proliferation and cryo-preservation of the somatic cells transfected with human proUK gene

The somatic cells transfected with human proUK gene can be selected by using an antibiotic-resistant gene or another marker gene. The gene targeting vector, carrying a human proUK gene, contains an ampicillin-resistance gene that is used as a positive selectable marker. The ampicillin-resistance gene can be introduced into the cells along with the human proUK gene, and expresses an ampicillin-resistance protein in the cells.

When the targeted cells are cultured in a culture medium containing ampicillin, only cells transfected with the vector survive, and cells not transfected with the vector die due to an action of ampicillin, resulting in proliferation of only the transfected cells carrying the human proUK gene in culture dishes. Therefore, after transfection at Step 3, the cells will be cultured in a normal culture medium for a predetermined period to allow expression of the ampicillin-resistance gene, and then selected in ampicillin-containing medium. Such a selection using antibiotics may be effectively achieved by determining an optimal treatment concentration of antibiotics. Cell proliferation patterns vary according to cell type. However, because cells are generally proliferated from a single cell, it is preferable to proliferate the targeted cells at least up to a level required at the next step. After the selection of the targeted cells is finished, the selected cells are cultured in a normal culture medium, where suitable growth factors and apoptosis-suppressing agents are added to the medium to induce rapid proliferation and reduce unnecessary loss of cells by apoptosis.

In addition, the selected cells in the medium containing a specific antibiotic can be confirmed using a green fluorescent protein (GFP) gene as a marker gene, which encodes a protein exhibiting green fluorescence. The targeted cells transfected with the gene targeting vector carrying a human proUK gene may be observed under a fluorescence microscope equipped with a UV filter to select only green colored cells.

The transfected cells selected by culturing in the presence of a specific antibiotic and GFP expression can be further cultured for proliferation and cryo-preservation. The cells to be used for nuclear transfer may be proliferated from one selected cell. In particular, it takes a great deal of time for fibroblasts to reach a high cell density, and proliferation is slowed down by aging and the cells finally grow no longer. For these reasons, the targeted fibroblasts are preferably cultured up to a high cell density in a short time while retaining their healthy states. For effective preservation, the proliferated cells can be cryo-preserved at each passage. Especially, when stored at a low cell density, the cells will be cryo-preserved at a state suitable for cellular viability as well as stability as nuclear donor cells to be used for nuclear transfer upon thawing.

Preparation of transgenic nuclear transfer embryo by nuclear transfer of the somatic cells transfected with a exogenous gene and production of transgenic cloned animals In the present invention, transgenic cloned animals may be produced by an somatic cell cloning technique. The somatic cell cloning technique can generate reconstructed fertilized embryos with 100% transfection efficiency and without genetic mosaicism, and thus allows the genotype of the targeted somatic cells, prepared by transfection with a exogenous gene as described above, to be expressed in cloned live offspring, thereby effectively producing transgenic cloned animals.

The somatic cell cloning technique used in the present invention is disclosed in international Pat. Application No. PCT/KROO/00707 filed on June 30, 2000 by the present applicant, entitled "Method for Producing Cloned Cows", where somatic cell cloning can be achieved by removing a nucleus containing genetic material from a cow oocyte and then injecting a nucleus from a different cell into the enucleated unfertilized oocyte. The resulting fertilized embryo is called a "reconstructed embryo". After being post-activated and cultured in vitro, the reconstructed embryo is transferred into a surrogate mother to produce live offspring.

Step 1 : Preparation and in vitro maturation of recipient oocytes Recipient oocytes used in the present invention may be prepared by in vitro maturation of immature oocytes collected from the cow's ovary. For example, the collected immature oocytes are selected in TCM199 washing medium prepared by dissolving TCM199 (Tissue Culture Medium 199) in HEPES (N- [hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid]) buffer, and then matured in vitro by culturing in a suitable culture medium for 16-22 hrs under 5% CO₂.

The culture medium suitable for maturation of the immature oocytes comprises TCM, sodium-pyruvate and P/S antibiotics-containing TCM199 culture medium supplemented with estradiol (E2), FSH (follicle stimulating hormone) and fetal bovine serum.

Step2: Enucleation of recipient oocytes

After removing cumulus cells from the mature recipient oocytes prepared in Step 1, a portion of the zona pellucida of the denuded oocytes is cut to give a slit, and a portion of cytoplasm including a first polar body is removed through the slit to generate enucleated oocytes.

Primarily, the mature recipient oocytes are placed into TCM 199 washing medium supplemented with hyaluronidase, and cumulus cells surrounding the oocytes are removed. The denuded oocytes arc washed with the TCM 199 washing medium. After transferring the denuded oocytes to a cytochalasin B solution, a portion of the zona pellucida is cut using a micromanipulator to give a slit. 10-15% of cytoplasm including a first polar body is removed through the slit to generate enucleated oocytes. The enucleated oocytes are washed with the TCM 199 washing medium, and placed in the TCM 199 culture medium until nuclear transfer. The above cytochalasin B solution is prepared by dissolving cytochalasin B in DMSO (dimethylsulfoxide) and diluting the stock solution with TCM199 washing medium containing FBS. Enucleation of the oocytes can be detected by staining the enucleated oocytes with Hoechst 33342 (Sigma Co.) and then observing the stained cytoplasm under ultra violet light.

Step3: Preparation of nuclear donor cells The transfected cells as prepared above are washed with PBS to use as nuclear donor cells. Then, the washed cells are treated with 0.1% trypsin-EDTA to dissociate the attached cells into single cells. After centrifugation, the cell pellet is resuspended in 200 μl of PBS containing 0.5% (v/v) FBS, and transferred to a microcentrifuge tube before use for nuclear transfer.

Step4: Fusion of nuclear donor cells and recipient oocytes and activation of the nuclear transfer embryos

The nuclear donor cells transfected as described above are transferred to the enucleated oocytes, and the resulting nuclear transfer embryos are activated by electrofusion. Primarily, the transgenic nuclear donor cells are transferred to the enucleated oocytes to generate nuclear transfer embryos. The enucleated oocytes in TCM199 culture medium are washed with TCM199 washing medium and transferred into a PHA-P

(phytohemagglutinin-P) solution. The nuclear donor cells are injected into the enucleated oocytes in a PHA-P solution through the slit using an injection pipette. Then, the resulting transgenic nuclear transfer embryos are washed with TCM 199 washing medium and placed in TCM 199 culture medium. The above PHA-P solution is prepared by dissolving PHA-P in TCM 199 washing medium.

The nuclear transfer embryos are electrically fused using a cell manipulator.

First, the nuclear transfer embryos are placed into a TCM 199 washing medium-containing mannitol solution chamber with two stainless steel electrodes connected to the cell manipulator, and manually aligned so that the contact surface of the cytoplast and the donor cell are parallel to the two electrodes and the nuclear donor cells face the cathode. Then, electrofusion of the nuclear transfer embryos is induced by applying a DC pulse of 0.75-2.00 kV/cm for 10-20 μsec at intervals of 0.01-10 sec, preferably, 1 sec and 1-5 times, preferably 2 times. The fused nuclear transfer embryos are washed with a mannitol solution and TCM 199 washing medium, and activated by incubation in the cytochalasin B solution. The mannitol solution is prepared by dissolving MgSO₄ or MgCl₂, BSA and mannitol in HEPES buffer and adjusting the solution to pH 7.2 to 7.4, and optionally contains Ca²⁺. In case that the mannitol solution contains Ca²⁺, the nuclear transfer embryos are activated simultaneously with fusion. In case that the mannitol solution does not contain Ca²⁺, activation should be separately carried out.

When cell fusion is carried out using the mannitol solution not containing Ca²⁺, the fused nuclear transfer embryos are activated by incubation in an ionomycin solution in a dark room, and washed with and incubated in TCM 199 washing medium to remove the ionomycin. The ionomycin solution is prepared by dissolving ionomycin in DMSO and diluting the stock solution with TCM199 washing medium supplemented with BSA.

Step5: Postactivation and in vitro culturing of the fused nuclear transfer embryos The present invention includes the step of postactivating and then in vitro culturing the activated nuclear transfer embryos.

The activated nuclear transfer embryos in TCM199 washing medium containing fetal bovine serum or BSA are incubated in a cycloheximide solution or a DMAP (4- dimethylaminopurine) solution to induce postactivation, and then cultured in an in vitro culture medium by using an incubator under 5% CO₂, or under 5% CO , 7% O₂ and 88% N₂. The cycloheximide solution can be prepared by adding cycloheximide dissolved in ethanol to the in vitro culture medium, and the DMAP solution can be prepared by dissolving DMAP in the in vitro culture medium. In addition, mSOF medium (see, Table 1) is used during in vitro culturing, which contains NaCl, KC1, NaHCO , NaH₂PO , CaCl₂, Na-lactate, glucose, phenol red, BSA, kanamycin, essential amino acids (EAAs), non- essential amino acids (NEAAs) and glutamine.

Optionally, the in vitro cultured nuclear transfer embryos are cryo-preserved, and the stored nuclear transfer embryos can be used after being thawed according to intended use. For cryo-preservation, the nuclear transfer embryos are washed with PBS containing fetal bovine serum, resuspended in a freezing medium containing P/S antibiotics, CaCl₂, glucose, MgCl₂, Na-pyruvate and PBS, cooled slowly, and stored in liquid nitrogen.

Thawing of the frozen nuclear transfer embryos can be achieved by incubation at room temperature for a predetermined period and then in warm water. In order to remove the freezing medium, the thawed nuclear transfer embryos are put into a thawing medium containing glycerol, sucrose, BSA and PBS, and then sequentially washed with the thawing medium while gradually reducing the glycerol content.

The nuclear transfer embryo prepared using the transfected somatic cells derived from an adult Holstein cow as nuclear donor cells was designated "SNU-B1", and deposited at an international depositary authority, KCTC (Korean Collection for Type Cultures; KRIBB, 52, Oun-dong, Yusong-ku, Taejon, Korea) on June 20, 2002, under the accession number KCTC 10286BP. TABLE 1 Composition of mSOF medium

Step 6: Production of transgenic cloned cow

The in vitro cultured nuclear transfer embryos are transferred to a surrogate mother cow to produce cloned offspring. Herein, the nuclear transfer embryos can be suspended in FBS -containing PBS, and then transplanted into the uterus of the surrogate mother.

The present invention will be explained in more detail with reference to the following examples in conjunction with the accompanying drawings. However, it will be apparent to one skilled in the art that the following examples are provided only to illustrate the present invention, and the present invention is not limited to the examples.

EXAMPLE 1 : Construction of gene targeting vector for introduction of human proUK gene into somatic cells

(1) Polymerase chain reaction (PCR) PCR was carried out by modifying the method suggested first by Saiki et al. (1985). PCR was carried out using the following PCR mixture and under the following conditions. A PCR mixture was composed of 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 1.5 mM MgCl₂, 1 mM dNTPs (Takara Shuzo, Japan), 50 pmol of upstream and downstream primers, 2.5 units of TaKaRaTA Taq polymerase (Takara) and 10 ng of a

DNA template in a total volume of 50 μl. PCR conditions included 33 to 49 cycles comprising the steps of denaturation at 94°C for 30 sec, annealing at 55°C for 33 sec and extension at 72°C for 1 min 30 sec, followed by final extension at 72°C for 15 min.

(2) Construction of gene targeting vector All plasmid vectors were prepared by a standard DNA cloning method (Maniatis et al. 1982) and PCR. A gene targeting vector to be used in gene targeting of the present invention was prepared using a pcDNA3 plasmid (Invitrogen, Groningen, Netherlands). First, 3.7-kb bovine β-casein promoter was obtained by PCR using bovine genome DNA as a template and the following primer set.

Forward primer (SEQ LO NO: 1):

GTCGGTACCAACATGTCGAATCCATCTCTATCAATTAATGTAATT Reverse primer (SEQ ID NO: 2): GACGGATCCTCATTATCTCAATTCCAGGGAATGGGAAGATGAGGA

The amplified bovine β-casein promoter was inserted into Kpnl and BamHI sites of pcDNA3, thus giving a pbeta3.7 vector. Human proUK gene (SEQ ID NO:3) was obtained by PCR using human genome DNA as a template, and inserted into Xhol and Apal sites of the pbeta3.7 vector, thus giving a pbeta2.1-proUK vector. Thereafter, GFP ORF was amplified by PCR using pEGFP-Nl vector (Clontech), and a Smal-BstBI fragment of the amplified product was inserted into the pbeta2.1-proUK vector, thus giving a targeting vector, pbeta2-proUK. All of the constructed vectors were confirmed by DNA sequencing using a sequencing kit (U.S. Biochemical Co.).

The construct of the pbeta2-proUK vector is given in Fig. 1. Fig. 1 shows a schematic structure of the pbeta2-proUK vector, in which the vector contains bovine β- casein promoter, human prourokinase gene (5,000 bp), ampicillin-resistance gene and GFP gene as a marker. The amplified human prourokinase gene as a target gene, bovine β- casein promoter and GFP gene were primarily cloned by TA cloning, and then, as described above, digested with the aforementioned restriction enzymes and subcloned to prepare the gene targeting vector, pbeta2-proUK. Their presence, position and orientation in the pbeta2-proUK vector were identified by restriction mapping and electrophoresis on an agarose gel.

(3) Nucleotide sequence analysis

Nucleotide sequence was analyzed by the dideoxy chain termination method

(Sanger et al. 1997) using a sequencing kit containing sequenase and ³⁵S-dATP (800 Ci/mmol, Amersham). DNA was separated on buffer-gradient or electrolyte sequencing gels by PAGE. All nucleotide sequencing analysis was carried out according to the protocol of a sequencing kit (US Biochemicals Co.)

EXAMPLE 2: Establishment of somatic cell line

Primarily, the inner tissue of the skin collected from cow's ear was washed with phosphate-buffered saline (PBS, Gibco BRL, Life Technologies, USA), and cut to a 100- mesh size. The finely cut tissue was put into PBS containing 0.25% trypsin, 1 mM EDTA and 1 mg/ml of collagenase type II, and incubated at 39°C for 1 hr under 5% CO₂. After centrifugation, the pellet was suspended in DMEM (Dulbecco's modified Eagles medium, Gibco BRL, Life Technologies, U.S.A.) supplemented with 10% FBS (fetal bovine serum), 1% non-essential amino acids and P/S antibiotics, transferred to a culture dish, and incubated at 39°C under 5% CO₂. The obtained somatic cells were further cultured in 0.5% FBS-containing DMEM for 7 days, and then treated with 0.25% trypsin and 1 mM EDTA, wherein the cells were maintained. The cells were resuspended in PBS containing 1% FBS, adjusted to a cell density of 2,000 cells per 0.1 ml, and aliquotted to

Eppendorf tubes. The aliquotted somatic cells were used as nuclear donor cells as described below.

EXAMPLE 3: Gene targeting by introduction of human proUK gene into somatic cells

The somatic cells were transfected with the pbeta2-proUK vector prepared in Step 1 by lipid-mediation using FuGene 6 (Cat. No. 1814443; Roche Molecular Biochemicals,

IN, U.S.A.).

The somatic cells were cultured for one day before transfection. That is, the cells were plated on 35-mm culture dishes at a cell density of l-3xl0⁵ cells per 2 ml medium, and cultured overnight to achieve 50-80%) confluency. Thereafter, the cells were transfected with the pbeta2-proUK vector using FuGene 6 according to the recommended protocol. Simply, 1 μg of pbeta2-proUK DNA was mixed with 3 μl of FuGene 6 reagent and 96 μl of DMEM. The mixture was incubated at room temperature for 15 min, and overlaid onto the cultured cells.

EXAMPLE 4: Selection, proliferation and cryo-preservation of the somatic cells stably transfected with human proUK gene

The somatic cells transfected with human proUK gene were selected in the presence of an antibiotic and by GFP expression. When the gene targeting vector carrying ampicillin-resistance gene and GFP gene as a positive selectable marker and GFP gene was integrated into chromosomal DNA, an ampicillin-resistance protein and GFP were expressed in the cells.

Selection in the presence of ampicillin was performed for 3 weeks with intervals of 3-4 days. In addition, on day 2 after transfection, the transfected cells were evaluated for GFP expression by observation using a fluorescent microscope with a standard fluorescein isothiocyanate (FITC) filter set (excitation wavelength: 450-490 nm; B-mode filter, Nikon, Japan) under ultra violet light (Fig. 2).

The selected somatic cells by the aforementioned ampicillin selection and GFP expression, which carry the human proUK gene, were proliferated for use as nuclear donor cells. In particular, it takes a great deal of time for fibroblasts to reach a high cell density, and proliferation is slowed down by aging and the cells finally cease to grow. For these reasons, the targeted fibroblasts should be cultured up to a high cell density in a short time while maintaining their healthy state. In the presence of ampicillin, the selected cells grew by forming colonies. Each of the colonies was detached by trypsin treatment and transferred to each well of 96-well culture plates. The proliferated cells were transferred to 24-well plates, and further proliferated in 12-well plates and then in 6-well plates.

For effective preservation, the proliferated cells were cryo-stored at each passage. Especially, it is preferable to cryo-preserve the cells in a state suitable for cellular viability and stability as a nuclear donor cell upon thawing, when the cells are stored at a low cell density.

EXAMPLE 5: Preparation of recipient oocytes

Follicles of about 4 mm in diameter were aspirated from bovine ovary collected from a slaughterhouse using a 10 ml syringe with an 18-gauge needle. After transferring the follicles to a 100 mm dish having square lattice (lxl cm) lines, oocytes surrounded by sufficient cumulus cells and having homogeneous cytoplasm were selected.

The selected oocytes were washed with 2 ml of TCM 199 washing medium (see Table 2) in a 35 mm culture dish three times, and finally washed with TCM199 culture medium (see Table 3). Thereafter, the washed oocytes were cultured in a culture medium containing 0.5 μl of an estradiol solution (see Table 4), 12.5 μl of a FSH (follicle stimulating hormone) solution (see Table 5), 450 μl of TCM199 culture medium and 10% FBS, for 20 hrs under 5% CO₂.

TABLE 2 TCM 199 washing medium

TABLE 3 TCM 199 culture medium

TABLE 4 Estradiol solution

EXAMPLE 6: Somatic cell nuclear transfer

The recipient oocytes prepared in Example 5 were washed with TCM199 washing medium once, and transferred into a 0.1% hyaluronidase solution prepared by mixing 1 ml of TCM199 washing medium with 111 μl of a solution prepared by dissolving 0.05g of hyaluronidase (Sigma Chemical Co., U.S.A.) in 5 ml of TCM199 washing medium. Then, cumulus cells were eliminated from the recipient oocytes. The denuded oocytes were washed with TCM 199 washing medium three times, and transferred into a cytochalasin B solution prepared by mixing 1 μl of cytochalasin B (Sigma Chemical Co.,

C-6762, U.S.A.) dissolved in DMSO (dimethyl sulfoxide) at a concentration of 7.5 mg/ml with 1 ml of TCM199 washing medium containing 10%) FBS. A portion of the zona pellucida of each of the denuded oocytes was cut using a micromanipulator (Narishige, Japan) to give a slit. 10-15% of cytoplasm including the first polar body was removed through the slit, thus generating enucleated oocytes.

In detail, the enucleation of the denuded oocytes was carried out as follows. A working dish was put on the micromanipulator plate of the micromanipulator, and the micromanipulator was equipped with a holding pipette on its left arm and a cutting pipette on its right arm. Then, the holding pipette and cutting pipette were positioned in the direction of 9 o'clock and 3 o'clock, respectively, and adjusted to move freely in all directions by placing a pipette controller in the middle. The two pipettes were further adjusted to let them not touch the edge of the working dish and their tips positioned to the middle of a microdroplet by moving them up and down over the microdroplet. The denuded oocyte was transferred from TCM 199 washing medium to a cytochalasin B solution using a washing mouth pipette over 200 μm in inner diameter. Subsequently, the micromanipulator was first focused on the oocyte by using its coarse adjustment screw and fine adjustment screw, and the focus was further adjusted by moving the two pipettes up and down. By moving the two pipettes, the oocyte was oriented with its first polar body facing toward the direction of 12 o'clock, and the holding pipette was placed close to the oocyte in the direction of 9 o'clock of the oocyte to fix the oocyte by applying hydraulic pressure.

Figure 3 shows the process of cutting a portion of the zona pellucida of the recipient oocyte with the holding and cutting pipettes. As shown in Figure 3, the oocyte was penetrated by the cutting pipette (2) from the direction of 1 o'clock to the direction of 11 o'clock with special care to prevent damage the cytoplasm of the oocyte. Hydraulic pressure was applied to the holding pipette (1) to separate the oocyte (3), and the holding pipette was contacted with the cutting pipette penetrating the zona pellucida bordering on the upper part of the first polar body to cut the portion of zona pellucida by rubbing the two pipettes.

Figure 4 shows the enucleation process removing the first polar body and the nucleus from the recipient oocyte. As shown in Figure 4, the oocyte (3) was oriented to place its slit vertically, and the holding pipette (1) was positioned on the lower part of the oocyte to prevent it from moving. Then, the oocyte was squeezed mildly on its upper part with the cutting pipette (2) to give an enucleated oocyte. The enucleated oocyte was washed with TCM199 washing medium three times and put into TCM199 culture medium. Thereafter, the nuclear donor cells prepared prior were transferred to the enucleated recipient oocytes using a micromanipulator. First, a 4 μl injection microdroplet was placed on the middle of an upper part of a working dish using a PHA-P (phytohemagglutinin) solution which was prepared by mixing 100 μl of a PHA-P stock solution prepared by dissolving 5 mg of PHA-P in 10 ml of TCM199 washing medium with 400 μl of TCM 199 washing medium. Then, two 4 μl microdroplets for nuclear donor cells were made above and below the injection microdroplet by using PBS containing 1% FCS. After covering the microdroplets with mineral oil, the working dish was placed on a micromanipulator plate.

After exchanging the cutting pipette installed on the micromanipulator with an injection pipette, the enucleated oocytes in TCM199 washing medium were washed with TCM199 washing medium three times, and transferred to the injection microdroplet.

Then, the nuclear donor cells were transferred into the injection microdroplet using the injection pipette.

Figure 5 shows the process of transferring a somatic cell into an enucleated oocyte. As shown in Figure 5, the enucleated oocyte (3) was placed with its slit oriented toward the direction of 1 o'clock, fixed by using the holding pipette, and injected with the donor cell through the slit using the injection pipette and hydraulic pressure to give a nuclear transfer embryo. The transgenic nuclear transfer embryo was washed three times with TCM 199 washing medium and then incubated in TCM 199 washing medium.

EXAMPLE 7: Cell fusion and activation

The transgenic nuclear transfer embryos were subjected to electrofusion using a

BTX Electro cell manipulator (ECM 2001, BTX, USA), as follows.

15 μl of a mannitol solution, prepared by dissolving 0.1 mM MgSO4, 0.05% BSA and 0.28 M mannitol in 0.5 mM HEPES buffer, was added to TCM199 washing medium containing the nuclear transfer embryos using a mouth pipette for washing, followed by incubation for 1 min. The nuclear transfer embryos were incubated for 1 min in a mannitol solution containing TCM 199 washing medium, and suspended in the mannitol solution using the mouth pipette. The nuclear transfer embryos were placed in the mannitol solution aliquotted in a chamber (3.2 mm, chamber No. 453) between both electrodes connected to the BTX Electro cell manipulator, in an orientation in which the nuclear donor cells face to the cathode. Thereafter, electrofusion of the nuclear transfer embryos was induced by applying a DC pulse of 1 kV/cm for 15 μsec at intervals of 1 sec 2 times. The fused nuclear transfer embryos were washed with the mannitol solution and then with TCM199 washing medium three times. An ionomycin solution was prepared by adding 1% BSA-containing TCM199 washing medium to an ionomycin stock solution up to a BSA concentration of 5 μM, wherein the ionomycin stock was prepared by dissolving 1 mg of ionomycin (Sigma Chemical Co., U.S.A.) in 1.34 ml of DMSO. The fused nuclear transfer embryos were activated by incubation in the ionomycin solution in a dark room, and washed with 10% FBS -containing TCM 199 washing medium aliquotted in 35-mm culture dishes to remove ionomycin.

EXAMPLE 8: Postactivation and in vitro culturing of the fused nuclear transfer embryos

The activated nuclear transfer embryos were incubated in 25 μl of cycloheximide solution for 4 hrs to induce postactivation. The cycloheximide solution was prepared by adding a cycloheximide stock solution prepared by dissolving 1 g of cycloheximide (Sigma

Chemical Co., U.S.A.) in 100 ml ethanol to an in vitro culture medium, mTALP (see, Table 1) up to a final concentration of 10 μg/ml of cycloheximide. The embryos were then screened, and the selected embryos were incubated in the mTALP medium for 7 days under 5% CO₂. The resulting nuclear transfer embryo was designated "SNU-B1", and deposited at an international depositary authority, KCTC (Korean Collection for Type Cultures; KRIBB, 52, Oun-dong, Yusong-ku, Taejon, Korea) on June 20, 2002, under the accession number KCTC 10286BP.

EXAMPLE 9: Cryo-prcservation, thawing and transplantation of the nuclear transfer embryos

The nuclear transfer embryos were frozen for long-term storage. First, a freezing medium (see, Tables 6 and 7) was aliquotted into 35-mm culture dishes, and cooled to - 5°C. Then, the nuclear transfer embryos selected for freezing were washed with 10% FBS-containing PBS, and incubated in the pre-cooled freezing medium for 20 min. Subsequently, the embryos along with the freezing medium were drawn up into the middle region of a 0.25 ml straw with two layers of air at both ends. After the straw was heat- sealed at both ends using a heated forceps, it was placed in a freezer at -5°C for 5 min, and seeded by mildly grabbing the lower part of the straw with forceps pre-chilled by liquid nitrogen. Immediately after seeding, the straw was cooled down at a rate of -0.3°C/min to -30°C, held for 10 minutes when the temperature reached -30°C, and then stored in liquid nitrogen.

TABLE 6 Freezing PBS

To thaw the frozen nuclear transfer embryos, 3 ml of a thawing medium containing the freezing PBS supplemented with 20% FBS was aliquotted into 35-mm culture dishes, and glycerol was added to the dishes at concentrations of 0%, 3% and 6% (see, Tables 6 and 8). Then, the frozen straw was taken out from the liquid nitrogen tank, held in the air for 5 sec, and incubated for 30 sec in a container over 20 cm in diameter, which contained warm water at 30 °C. After thawing, the straw was cut at the air layers of both ends, and the medium containing the embryos was pushed into the prepared culture dishes. The embryos were observed under a microscope. To remove the freezing medium from the embryos, they were sequentially incubated in the thawing media containing 6% glycerol, 3% glycerol and 0% glycerol, each for 5 min.

TABLE 8 Thawing medium

EXAMPLE 10: Transplantation of nuclear transfer embryos into surrogate mothers The nuclear transfer embryos were placed into 20% FBS-containing PBS, and drawn up into a straw, and then transplanted into the deep region of the uterus cornual of surrogate mothers.

EXAMPLE 1 1 : Production and genetic analysis of cloned live offspring expressing human proUK

Genetic analysis of transgenic live offspring produced in Example 10 was carried out by molecular biological methods, and their phenotype was evaluated with the naked eye. The live offspring were evaluated for GFP expression and introduction of the human proUK gene by the naked eye, as well as by performing Southern blotting, Western blotting and cell culture using their tissues.

First, the offspring were evaluated for GFP expression by investigating induction of green color in their skin, mouths and tongues with the naked eye. In addition, to investigate human proUK expression in the offspring, genomic DNA from the offspring was analyzed by Southern blotting, and protein samples of some tissues were analyzed by Western blotting. As a result, the offspring were found to express human proUK.

Further, some tissues of the live offspring were cultured according to the same method as in Example 2, and the cultured cells were analyzed for GFP expression under a fluorescent microscope equipped with an ultra violet filter. As a result, the live offspring were confirmed to express GFP. Also, when performing Southern blotting using DNA samples from the culture tissues, the live offspring were detected to carry human proUK gene.

EXAMPLE 12: Comparison of development levels of transgenic nuclear transfer embryos according to types of nuclear donor cells Transgenic nuclear transfer embryos were prepared using three different nuclear donor cells according to the same procedure as in the above Examples, and evaluated for development levels. As donor cells, fetal bovine fibroblasts derived from 40-50-day fetuses, and ear fibroblasts and cumulus cells from an adult cow were used.

Human prourokinase gene was introduced into the three-type donor cells, and the transfected cells were fused with enucleated oocytes. The resulting nuclear transfer embryos were evaluated for fusion rates, division rates, development rates to the blastocyte stage and cell number in the blastocyte stage. The results are given in Tables 9 and 10, below.

TABLE 9 Comparison of development levels of nuclear transfer embryos according to types of nuclear donor cells

TABLE 10 Pregnancy rates of nuclear transfer embryos produced by nuclear transfer of three-types donor cells transfected with human proUK gene

INDUSTRIAL APPLICABILITY

As described hereinbefore, the present invention provides a method of producing a transgenic animal by gene targeting using a transfection technique in combination with somatic cell cloning. The method allows economic and effective production of various biomedicines. In particular, the transgenic cloned cows produced by the method of the present invention express human prourokinase in the mammary gland, thereby facilitating production of human prourokinase in cow's milk.

The present invention has been described in an illustrative manner, and it is to be understood that the terminology used is intended to be in the nature of description rather than of limitation. Many modifications and variations of the present invention are possible in light of the above teachings. Therefore, it is to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.